Translational Science

Cadherin-11 Regulates Cell–Cell Tension Necessary for Calcific Nodule Formation by Valvular Myofibroblasts

Joshua D. Hutcheson, Joseph Chen, M.K. Sewell-Loftin, Larisa M. Ryzhova, Charles I. Fisher, Yan Ru Su, W. David Merryman
https://doi.org/10.1161/ATVBAHA.112.300278
Arteriosclerosis, Thrombosis, and Vascular Biology. 2013;33:114-120
Originally published December 12, 2012

Jump to

Abstract

Objective—Dystrophic calcific nodule formation in vitro involves differentiation of aortic valve interstitial cells (AVICs) into a myofibroblast phenotype. Interestingly, inhibition of the kinase MAPK Erk kinase (MEK)1/2 prevents calcific nodule formation despite leading to myofibroblast activation of AVICs, indicating the presence of an additional mechanotransductive component required for calcific nodule morphogenesis. In this study, we assess the role of transforming growth factor β1–induced cadherin-11 expression in calcific nodule formation.

Methods and Results—As shown previously, porcine AVICs treated with transforming growth factor β1 before cyclic strain exhibit increased myofibroblast activation and significant calcific nodule formation. In addition to an increase in contractile myofibroblast markers, transforming growth factor β1–treated AVICs exhibit significantly increased expression of cadherin-11. This expression is inhibited by the addition of U0126, a specific MEK1/2 inhibitor. The role of increased cadherin-11 is revealed through a wound assay, which demonstrates increased intercellular tension in transforming growth factor β1–treated AVICs possessing cadherin-11. Furthermore, when small interfering RNA is used to knockdown cadherin-11, calcific nodule formation is abrogated, indicating that robust cell–cell connections are necessary in generating tension for calcific nodule morphogenesis. Finally, we demonstrate enrichment of cadherin-11 in human calcified leaflets.

Conclusion—These results indicate the necessity of cadherin-11 for dystrophic calcific nodule formation, which proceeds through an Erk1/2-dependent pathway.

Introduction

The differentiation of quiescent fibroblasts to activated myofibroblasts represents a normal physiological response to injury in vivo; however, persistence of the myofibroblast phenotype contributes to a spectrum of fibrotic disease.1–4 Activated myofibroblasts are characterized by increased contractility attributed to smooth muscle α-actin (αSMA), and in normal physiology, these cells remodel the extracellular matrix by secreting proteases for matrix breakdown and de novo extracellular matrix components such as collagen.1,2 Failure of the myofibroblasts to apoptose or return to quiescence in pathological cases causes impairment of organ systems because of elevated contractions and accumulation of extracellular matrix components. One disease in which the myofibroblast is thought to play a crucial role is calcific aortic valve disease (CAVD).5–10

Increased αSMA expression in aortic valve interstitial cells (AVICs), the resident fibroblast population in the aortic valve, has been observed in excised fibrotic leaflets.11 Increased expression of the profibrotic cytokine transforming growth factor β1 (TGF-β1) has also been observed in these leaflets, and accordingly, TGF-β1 has been shown to lead to myofibroblast activation of AVICs in vitro11–13 Additionally, in ex vivo models of CAVD, TGF-β1 works synergistically with mechanical strain to lead to collagen accumulation, characteristic of early CAVD, and formation of bone-like calcific nodules, an end point of CAVD.14,15 Two distinct calcific nodule morphologies have been observed: dystrophic calcification driven by myofibroblastic phenotypes16–18 and ossification driven by osteogenic phenotypes.19,20 In diseased explants, dystrophic calcification and ossification have been observed in 83% and 13% of explanted diseased valves, respectively.21

In vitro, dystrophic nodule formation involves myofibroblast differentiation of AVICs. Upregulation of αSMA during myofibroblast differentiation by TGF-β1 leads to an increase in mechanical tension between AVICs and subsequent aggregation into nodules, which calcify through apoptotic processes.13,22 When αSMA expression is suppressed, calcific nodules are unable to develop, thereby revealing the essential role of acquired contractility within AVICs in calcific nodule formation.16 Confoundingly, preventing phosphorylation of Erk1/2 with an MEK1/2 inhibitor leads to increased αSMA expression23 yet prevents calcific nodule formation,24 suggesting the requirement of another essential component of nodule formation that is yet to be revealed.

Along with increased αSMA expression, myofibroblast differentiation has been associated with changes in cadherin expression. Specifically, in lung fibroblasts, TGF-β1–induced myofibroblast differentiation leads to an increase in cadherin-11 (aka OB-cadherin) and a decrease in N-cadherin.25 Increased cadherin-11 expression has been implicated in various pathologies, including pulmonary fibrosis and arthritis.26,27 Functionally, the transition to cadherin-11 yields stronger intercellular connections that improve force development in myofibroblast populations. Recent works have shown that elevated intercellular tension, along with increased contractility, drives calcific nodule formation of AVICs in vitro.16,17 Therefore, we hypothesize that TGF-β1–induced cadherin-11 expression through an Erk1/2-dependent pathway is essential for robust cell–cell connections necessary for generating intercellular tension required for calcific nodule formation.

To test this hypothesis, we quantified the expression and contributions of cadherin-11 in calcific nodule formation of AVICs. Here, we show that TGF-β1–induced myofibroblast differentiation of AVICs leads to upregulation of αSMA and cadherin-11 expression in an Erk1/2-dependent fashion, corresponding to increased functional contractility and cell–cell connection strength, respectively. Subsequent knockdown of cadherin-11 inhibits the ability of AVICs to generate calcific nodules similar to knockdown of αSMA,16 demonstrating that both proteins are necessary for dystrophic calcific nodule morphogenesis.

Methods

AVIC Isolation and Culture

Porcine aortic valve leaflets were excised from euthanized animals within 10 minutes of slaughter at a local abattoir. Leaflets were stored in PBS at 4°C to ensure survival. Within 3 hours of being euthanized, AVICs were isolated as previously described.28 Briefly, after the removal of the endothelium, the leaflet was minced into 1 mm2 pieces and digested in a 1 mg/mL collagenase solution (Worthington Biochemical Corp, Lakewood, NJ) for 1 hour at 37° C and 5% CO2. The collagenase solution with the remaining tissue was passed through a cell strainer to collect a cell solution which was centrifuged at ~400 g for 5 minutes to obtain the cell pellet. The pellet was resuspended in DMEM supplemented with 10% fetal bovine serum (Atlanta Biological, Lawrenceville, GA) and 1% Antibiotic-Antimycotic (Gibco, Grand Island, NY). The cells were seeded on tissue culture dishes and incubated at 37°C and 5% CO2 with media changes every 3 days. AVICs were cyropreserved after the second passage, and all experiments in this study were performed using AVICs between passages 3 and 6.

Calcific Nodule Treatments and Analyses

AVICs were seeded onto BioFlex Pronectin culture plates (Flexcell International Corporation) at a density of 60000 cells/cm2 in 3 mL of media. After reaching confluence (≈48 hours), AVICs were treated with 1 ng/mL TGF-β1, 10 µmol/L U0126, an MEK1/2 inhibitor that prevents Erk1/2 phosphorylation, or U0126+TGF-β1 for 24 hours, after which they were subjected to 15% cyclic equibiaxial strain via the Flexcell-4000 tension system (Flexcell International Corporation) at a frequency of 0.75 Hz for 24 hours. The specific sequence of TGF-β1 for 24 hours followed by 15% cyclic strain results in the formation of dystrophic calcific nodules.17

To quantify nodule counts after treatments, AVICs were rinsed twice with PBS and fixed in 3.7% neutral buffered formaldehyde for 15 minutes. AVICs were rinsed with PBS and, unless immediately stained, stored at 4°C for up to several days. Each 35-mm well was rinsed with deionized H2O and stained with 1 mL of 14 mmol/L Alizarin red S (Sigma; in deionized H2O, pH 4.1, where undissolved particulates were removed with a 0.45-µm filter) for 30 minutes with agitation to determine calcium deposition. After staining, the cells were washed 4× with deionized H2O to remove excess dye. Positively stained nodules were manually counted under the microscope.

To examine the morphology of the nodules formed after treatments, wells were rinsed with PBS and stained with annexin V conjugated with Alexa fluor 488 (5% solution in annexin binding buffer; Invitrogen, Grand Island, NY) for 15 minutes to detect apoptotic cells. Propidium iodide (0.4% solution in annexin-binding buffer; Invitrogen) was used as a counterstain for necrotic cells. Images were taken with a Nikon TE300 inverted tissue culture fluorescence microscope.

Wound Assay

A wound assay to quantify the level of intercellular tension was performed as described previously.17 Briefly, AVICs were seeded on tissue culture polystyrene 6-well plates at 60000 cells/cm2 and allowed to adhere overnight. AVICs were treated with either 1 ng/mL TGF-β1, 10 µmol/L U0126, or a combination of these treatments for 24 hours. Before the introduction of a wound to the monolayer with a pipet tip, the extracellular growth media was washed away and replaced with DMEM media containing 1.8 mmol/L Ca2+ or DMEM diluted with Ca2+-free PBS to give a final concentration of 0.45 mmol/L Ca2+ 5 minutes before wounding to select for function of different cadherins. All cadherins require extracellular Ca2+ for function; however, cadherin-11 functions at lower Ca2+ concentrations than normal cadherins such as N-cadherin. Previous studies have identified 0.3 to 0.8 mmol/L as a threshold concentration range in which cadherin-11 is functional but N-cadherins display reduced functionality in this range.29 Immediately after wounding, each well was imaged, and wound areas were calculated using ImageJ analysis software.

Protein and mRNA Assays

AVIC activation was quantified by assaying for αSMA protein expression using an indirect ELISA as described previously.17,30 AVIC mRNA was isolated per manufacturer protocol using RNeasy isolation kit (Qiagen), and quantitative polymerase chain reaction for αSMA (f: AACCGGGAGAAGATGACCCAGATT; r: accatctccagagtccagcacaat) and cadherin-11 (f: CAAGTTAGTGTACAGTATCCTGG; r: GTCTTTAGCCTTCACTCTTCC) was performed on the HT7900 sequence detection system (Applied Biosystems, VUMC DNA Resource Core). β-actin was used as a housekeeping gene.

Immunofluorescence

AVICs were plated on fibronectin functionalized coverslips and treated with 1 ng/mL TGF-β1, 10 µmol/L U0126, or U0126+TGF-β1 for 24 hours. The cells were then fixed in 3.7% formaldehyde, permeabilized with 0.1% Triton X-100, and blocked with 1% BSA for 1 hour at room temperature. A primary antibody to cadherin-11 (2 μg/mL; Santa Cruz) was added to the coverslips for 3 hours at room temperature. After thorough washing in PBS, a fluorescently labeled secondary antibody (Alexa Fluor 488; Invitrogen) was added to the coverslip for 1 hour. The coverslips were then washed and sealed with ProLong Gold antifade reagent (Invitrogen) overnight before imaging with a Nikon Eclipse E800 equipped with a Spot RT3 camera.

siRNA Knockdown

The necessity of cadherin-11 expression in intercellular tension and calcific nodule morphogenesis was assessed using small interfering RNA (siRNA) knockdown. Cadherin-11–specific siRNA was designed using specialized algorithms, and 40 pmol/L of each of 3 different siRNA duplexes (CCAAGTTAGTGTACAGTAT, GGGATGGATTGTTGAA, CCTTATGACTCCATCCAAA, Sigma) were pooled and transfected into AVICs using Lipofectamine 2000 (Invitrogen) for 6 hours. AVICs were then allowed to reach confluence (≈72 hours) before the addition of TGF-β1 for calcific nodule assay or wounding assay, as described above. Live/dead stain was conducted to assess cell viability after siRNA; Western blotting was used to confirm cadherin-11 knockdown efficiency at 96 hours post-transfection, which was just before the application of strain or wounding.

Immunofluorescence, Von Kossa Staining, and mRNA Analysis of Human Aortic Valves

Human aortic valve leaflets were obtained from heart transplant recipients. Patients were enrolled in the Vanderbilt Heart and Vascular Institute Main Heart Registry, under an approved Institutional Review Board protocol (No.90828). Immediately after the heart was explanted, the aortic valve leaflets were dissected and flash frozen in the liquid nitrogen. A small piece of aortic valve was embedded in optimal cutting temperature compound and stored at −80°C. Calcified aortic valve leaflets were obtained from a 58-year-old man with severe aortic valve stenosis and a 52-year-old woman with ischemic heart failure and notable fibrotic aortic valve leaflets, but no stenosis or visible calcific nodules. Because of the state and size of the tissue, we performed quantitative polymerase chain reaction on the leaflet with severe aortic stenosis and immunofluorescence on the fibrotic leaflet. Noncalcified leaflets were obtained from unmatched organ donors; both were men, 51 and 47 years old, respectively, with no previous history of cardiovascular disease. For immunofluorescence, optimal cutting temperature compound-embedded aortic valve leaflets were cut in 5- to 7-μm sections and incubated at room temperature with PBS. Tissue sections were stained for 4 hours at room temperature using a rabbit primary antibody to cadherin-11 (2.5 μg/mL; Cell Signaling, Danvers, MA), rinsed 3× in PBS with 0.01% Triton-X 100, incubated with an Alexa-Fluor 647–conjugated goat-anti-rabbit secondary antibody (6.6 μg/mL; Invitrogen) and a primary antibody to αSMA directly conjugated with Cy3 (5 μg/mL, Sigma-Aldrich, St. Louis, MO), and finally washed 3× in PBS with 0.1% Triton-X 100. Excess moisture was carefully wicked away before samples were mounted in ProLong Gold AntiFade with 4'-6-diamidino-2-phenylindole (Invitrogen) and allowed to dry overnight at room temperature. All sections were imaged using the Nikon Eclipse 80i microscope. Adjacent sections were analyzed using a von Kossa calcium staining kit (PolySciences Inc, Warrington, PA). Total RNA was isolated using miRNeasy Mini kit (Qiagen) following manufacturer’s instructions. Quantitative polymerase chain reaction for cadherin-11 (f:CAAGTTAGTGTACAGTATCCTCG; r:GATCTTTAGCTTTCACTCTTCCT) and αSMA (f; ACAACAGCATCAGTAAGTGT; r:CATCGTATTCCTGTTTGCTGA) was as described above.

Statistical Analyses

Data are reported as the mean of all replicates, and error is given as SE of the mean (n>3). Statistical significance between treatments was determined by 1-way ANOVA, and pairwise differences were identified using post hoc Holm-Sidak testing.

Results

αSMA Expression Is Not Sufficient for Calcific Nodule Formation in a Strain Environment

Consistent with previous results,23 treating AVICs with either 1 ng/mL TGF-β1 or 10 µmol/L U0126 leads to a significant increase in αSMA mRNA and protein expression (Figure 1A). A combination of these treatments also significantly increases αSMA expression compared with nontreated controls. As shown previously,17 AVICs treated with TGF-β1 before the addition of strain form significantly more calcific nodules compared with nontreated, strained control AVICs (Figure 1B), and calcific nodules were determined to be dystrophic with an apoptotic ring surrounding a necrotic core (Figure 1B, inset). The addition of U0126 to the TGF-β1 treatment prevents this increase in calcific nodule formation.

Figure 1.
Figure 1.

The effect of MEK1/2 inhibition on hallmarks of dystrophic calcification. Aortic valve interstitial cells (AVICs) were treated with transforming growth factor β1 (TGF-β1), U0126, U0126+TGF-β1 and assayed for smooth muscle α-actin (αSMA) and calcific nodule formation. MEK1/2 inhibition causes αSMA expression (A) but suppresses dystrophic calcific formation (B) in AVICs, both in the presence and absence of TGF-β1. Inset in B shows calcific nodules with bright field and fluorescence microscopy, demonstrating an apoptotic outer ring surround a necrotic core. Scale bar, 250 μm. All error bars indicate SEM. * indicates significant difference (P<0.005) vs control.

Erk1/2 Inhibition Does Not Affect Canonical TGF-β1 Signaling

U0126 is a specific inhibitor to MEK1/2, the kinase directly upstream of the mitogen-activated protein kinase (MAPK) Erk1/2. Therefore, we assessed the effect of TGF-β1 and U0126 on Erk1/2 phosphorylation in AVICs. Treating AVICs with TGF-β1 for 1 hour significantly increased Erk1/2 phosphorylation (Figure 2A), and this phosphorylation is completely inhibited by the U0126 treatment. We next determined potential off-target effects of U0126 treatment at other common TGF-β1 signaling proteins. TGF-β1 treatment for 1 hour induces significant phosphorylation of its canonical transcription factor Smad3 (pSmad3) in a manner that is not inhibited by U0126 treatment (Figure 2A). In addition to Smad3, we have previously shown that 1 hour of TGF-β1 treatment leads to phosphorylation of the MAPK p38 that is necessary for TGF-β1–induced αSMA expression in AVICs.30 Treating AVICs with U0126 does not inhibit TGF-β1 p38 phosphorylation (Figure 2A). Consistent with the pSmad3 results, treating AVICs with TGF-β1 for 24 hours leads to a significant increase in plasminogen activator inhibitor-1 promoter luciferase activity that is not inhibited by U0126 treatment (Figure 2B).

Figure 2.
Figure 2.

U0126 does not interfere with canonical transforming growth factor β1 (TGF-β1) signaling. U0126 is a specific MEK1/2 inhibitor as indicated by the complete inhibition of pErk1/2 (A) but no change in pSmad3 (B) or pp38 (C). Inset in A shows representative blots, and A to C are average densitometry from 3 independent experiments. Similar to the pSmad3 results, U0126 does not inhibit plasminogen activator inhibitor (PAI)-1 promoter activity after TGF-β1 treatment (D). All error bars indicate SEM. * indicates significant difference (P<0.005) vs control.

Erk1/2 Inhibition Suppresses TGF-β1–Induced Expression of Cadherin-11

AVICs treated with TGF-β1 for 24 hours exhibit a significant increase in cadherin-11 mRNA that is inhibited by treating AVICs with U0126 (Figure 3A). Immunofluorescence images also indicate changes in cadherin-11 expression and cellular localization after the TGF-β1 and U0126 treatments (Figure 3B). TGF-β1–treated AVICs have visible cadherin-11 expression as indicated by fluorescein isothiocyanate fluorescence between adjacent cells (with nuclei indicated by 4'-6-diamidino-2-phenylindole staining). Expression of cadherin-11 was not observed in AVICs treated with U0126 or in nontreated controls.

Figure 3.
Figure 3.

Transforming growth factor β1 (TGF-β1) incubation for 24 hours increases cadherin-11 expression in aortic valve interstitial cells. A, Quantitative polymerase chain reaction reveals a 1.58-fold increase in cadherin-11 mRNA in samples treated with TGF-β1 and a decrease in cadherin-11 mRNA with inhibition of MEK1/2. B, Immunostaining shows cadherin-11 in TGF-β1 groups with minimal to no stain in other treatment groups. Scale bar, 10 μm. All error bars indicate SEM. * indicates significant difference (P<0.005) vs control.

Cadherin-11 Is Required for Elevated Intercellular Tension and Calcific Nodules

Given that TGF-β1 induces expression of cadherin-11 in a manner that is inhibited by U0126, we next determined whether upregulation of this protein plays a role in increased intercellular tension that is believed to lead to the formation of dystrophic calcific nodules in vitro. When a wound is introduced to statically cultured AVICs in 1.8 mmol/L Ca2+, a concentration that allows all cadherins to function, all treatment groups display increased intercellular tension as shown by larger wound areas compared with nontreated controls (Figure 4A). However, when a wound is applied to AVICs in 0.45 mmol/L Ca2+ media, a concentration that permits functionality of cadherin-11 but below the functional concentration for typical cadherins, only TGF-β1–treated AVICs exhibit a significantly increased wound area, and this area is even greater than AVICs treated with TGF-β1 and wounded in physiological Ca2+ media. Because the low Ca2+ condition is not specific to cadherin-11, we knocked down cadherin-11 at physiological calcium conditions (1.8 mmol/L) with siRNA and found that this significantly reduced wound area after TGF-β1 treatment (Figure 4B).

Figure 4.
Figure 4.

Cadherin-11 generates intercellular tension through smooth muscle α-actin (αSMA), which enables calcific nodule morphogenesis. A, Wound assay reveals strength of intercellular connection which correlates to wound area. At normal Ca2+ levels, with all cadherins functional, transforming growth factor β1 (TGF-β1), U0126, and U0126+TGF-β1 treatments all increased wound area size because of increased αSMA expression. However, at low Ca2+ levels, where cadherin-11 is still functional and others are not, TGF-β1–treated cells created a large wound. B, Small interfering RNA (siRNA) knockdown of cadherin-11 in physiological Ca2+ media decreases TGF-β1 initiated wound area to control levels. C, siRNA knockdown of cadherin-11 prevents calcific nodules. Inset, Western blots show that cadherin-11 is knocked down at the time of the wound assay and calcific nodule experiments. All error bars indicate SEM. * indicates significant difference (P<0.005) vs control. # indicates significant difference (P<0.05) vs Scramble. ** indicates significant difference (P<0.005) vs sham and scramble.

To determine whether cadherin-11 expression is necessary for calcific nodule formation, we used siRNA to knock down cadherin-11 in AVICs. AVICs treated with lipofectamine transfection reagent alone or in combination with a nonspecific scramble siRNA construct generated robust calcific nodules after TGF-β1 treatment for 24 hours and mechanical strain for an additional 24 hours; however, AVICs transfected with siRNA specific to cadherin-11 did not develop calcific nodules (Figure 4C). Introduction of siRNA for cadherin-11 did not affect viability (Figure I in the online-only Data Supplement); no significant differences were observed for AVIC morphology and growth.

Expression of Cadherin-11 Is Elevated in Calcified Human Aortic Valves

We evaluated noncalcified and calcified aortic valve leaflets from human explants with Von Kossa staining for calcification and immunohistochemistry for cadherin-11 and αSMA expression. Von Kossa staining revealed dramatic differences in the diseased valve with a significant accumulation of stain over the majority of the tissue (Figure 5A and 5B). Immunostaining of the leaflets revealed the presence of cadherin-11 in noncalcified valves but very little αSMA expression. Cadherin-11 was prevalent near the periphery of the tissue confirming previous findings of its presence in the endothelium31 (Figure 5A). However, in the calcified valve, cadherin-11 was highly expressed and colocalized with αSMA (Figure 5B, a and b). Furthermore, in contrast to the peripheral staining observed in the noncalcified leaflet, cadherin-11 was detected throughout the interstitium of the leaflet but was not colocalized with αSMA in regions of diffuse calcium staining with von Kossa (Figure 5B, c). Quantitative polymerase chain reaction revealed a 50-fold increase in cadherin-11 and ≈10-fold increase in αSMA mRNA in the calcified leaflet compared with noncalcified leaflets.

Figure 5.
Figure 5.

Cadherin-11 and smooth muscle α-actin (αSMA) expression are increased in calcified human aortic valve leaflets. A, Immunostaining of a noncalcified leaflet reveals cadherin-11 expression along the periphery of the leaflet, sparse αSMA staining, and very little calcification indicated by the von Kossa stain. B, Calcified leaflet shows enriched cadherin-11 and αSMA colocalization in areas of significant calcification (a and b), as seen in the von Kossa stain, but not in areas where calcification is less intense (c). C, mRNA for cadherin-11 and αSMA are increased in the calcified leaflet (n=1) compared with the noncalcified leaflets (n=2). Scale bar, 500 μm for von Kossa and 100 μm for immunofluorescence.

Discussion

Dystrophic calcification in CAVD has been associated with the pathological differentiation of AVICs to myofibroblasts, which is characterized by increased αSMA expression. Treating AVICs with U0126, however, indicates that the presence of αSMA is not sufficient to drive dystrophic calcification, leading to the hypothesis that there exist other relevant mechanisms that have not been elucidated. Here, we present evidence that TGF-β1 treatment of AVICs leads to expression of the atypical cadherin, cadherin-11, and expression of this intercellular adhesion protein is necessary for the development of dystrophic calcific nodules in vitro.

Previous in vitro studies on dystrophic calcific nodule formation revealed the importance of αSMA as a mediator of the process. TGF-β1 treatment of AVICs led to increased expression of αSMA, which reinforces stress fibers and produces a more contractile cell. Benton et al16 showed that this increased contractility leads to contraction events that result in cell aggregates that develop into calcific nodules through an apoptosis-driven pathway. Recently, we found that mechanical strain exacerbated the formation of these aggregates by introducing a force imbalance on the monolayer whereby increased intercellular tension is overcome by the addition of externally applied strain.17 This led us to theorize that TGF-β1–induced myofibroblast populations possessed higher intercellular tension than quiescent fibroblasts, thus making them more sensitive to mechanical strain and subsequent nodule formation.

Interestingly, distinct differences in cadherin expression have been observed in fibroblast and myofibroblastic populations with fibroblasts expressing N-cadherin and myofibroblasts expressing cadherin-11.25 Cadherin-11 junctions withstand 2-fold higher forces when compared with connections formed with N-cadherin.32 Furthermore, on application of forces, cadherin-11–expressing cells will continue to hold on and eventually rip at the plasma membrane, whereas N-cadherin–expressing cells release from each other.25 These stronger intercellular contacts are organized by and work synergistically with increased αSMA expression, leading to the accumulation of tension within myofibroblast populations. To test the effect of cadherin-11 on elevated intercellular tension, we used a wound assay as described previously17; however, in this study we varied the concentration of extracellular Ca2+ to select for function of different cadherins. All cadherins require the presence of extracellular Ca2+ to function, but atypical cadherins such as cadherin-11 have a higher Ca2+ affinity (KD ≈ 0.2 mmol/L) than normal cadherins.29 Therefore, cadherin-11 functions at lower Ca2+ concentrations than normal cadherins such as N-cadherin (KD=0.7 mmol/L). This difference in cadherin Ca2+ affinity is reflected in the wound assay results. At physiological Ca2+ concentration, all cadherins are functional. TGF-β1 and U0126 treatments both lead to an increase in αSMA, thus an increase in AVIC contractility; therefore, these 2 treatment groups cause significant tension as the AVICs pull on each other in the monolayer, ultimately leading to large increases in wound area. When the extracellular Ca2+ is lowered such that only cadherin-11 is functional, intercellular tension does not build in the U0126-treated AVICs, and the wound area for this treatment group is not significantly different than nontreated controls. However, for TGF-β1–treated AVICs in the low Ca2+ case, the presence of cadherin-11 in AVICs treated with TGF-β1 alone allows intercellular tension to build in the monolayer, leading to a significant increase in wound area compared with nontreated control samples. Additionally, because typical surface-adhesion cadherins are weaker in the low Ca2+ case, the increased force imbalance leads to an even larger wound area for AVICs treated with TGF-β1 compared with the physiological Ca2+ case. Illustrating the importance of increased tension conferred by cadherin-11 expression in nodule formation, when siRNA is used to knock down the expression of cadherin-11, intercellular tension is reduced and calcific nodules fail to form after TGF-β1 treatment and mechanical strain. This indicates that robust cell–cell connectivity in conjunction with contraction events is necessary for calcific nodule formation.

From this, we propose the following model of calcific nodule morphogenesis. Activated AVICs express 2 mechanotransductive proteins because of TGF-β1: αSMA and cadherin-11. With the change in protein expression, there is a dramatic change in the physical interaction between the cells in the monolayer. Intercellular tension increases as the cells become tightly connected because of cadherin-11 and as the cells become contractile owing to αSMA. Eventually, the increased tension throughout the monolayer generates an imbalance of forces possibly attributable to cadherin-11 expression differences within individual cells. The application of external forces, such as large tissue deformation during valve closure, increases this tension imbalance, leading to apoptosis of the weaker cell and creating aggregates as the initiating step of calcific nodule morphogenesis. Calcific nodules mature as cells near the periphery of the aggregate experience strain magnification attributable to the nondeformity of the nodule, leading to apoptosis and calcification, as we proposed recently.17

Expression of cadherin-11 by TGF-β1 is blocked by pretreating AVICs with U0126, an inhibitor to MEK1/2. MEK1/2 is an MAPK kinase that when activated leads to phosphorylation of the MAPK Erk1/2. TGF-β1–induced phosphorylation of Erk1/2 has been observed in a wide variety of cell types and has been shown to be necessary for numerous cellular responses.33–35 Activation of Erk1/2 has also been shown to suppress αSMA expression in mouse embryonic fibroblasts.36 Consistently, U0126 treatment leads to a significant increase in αSMA expression in AVICs. Our previous results indicate that TGF-β1–induced expression of αSMA in AVICs requires phosphorylation of a different noncanonical MAPK p38.30 Therefore, it seems that these 2 noncanonical pathways may independently lead to expression of proteins that are characteristic of pathological differentiation of AVICs. In contrast, canonical TGF-β1 signaling leads to increased expression of plasminogen activator inhibitor-1, and we have hypothesized that upregulation of plasminogen activator inhibitor-1 through activation of the canonical Smad2/3 pathway may involve a negative feedback of TGF-β1 signaling.30 Therefore, the results of these studies suggest a divergence in TGF-β1 signaling that leads to AVIC myofibroblastic differentiation through activation of noncanonical pathways (p38 and Erk1/2) that each lead to a different cellular outcome that may be very important in CAVD, whereas canonical Smad pathways may not be directly involved in pathological signaling for CAVD. Additionally, Erk1/2 phosphorylation has been shown to be required for mechanically induced calcific mineralization by calcifying vascular cells,37 suggesting that these pathways may be important in a variety of calcification processes. We believe that the results of this study suggest a therapeutic approach for CAVD by targeting either of these noncanonical pathways or direct inhibition of cadherin-11 function.

Finally, we do show here the presence of increased cadherin-11 in calcified human aortic valve leaflets, which is colocalization with αSMA. The drastic changes in cadherin-11 in the calcified leaflets (Figure 5) is supported by a recent report of significant cadherin-11 mRNA upregulation in stenotic human leaflets versus nonstenotic leaflets.38 Mechanistically, this seems reasonable as sclerosis often causes stenosis, both of which precede calcification. For the current work to realize a larger clinical impact, the in vitro mechanisms and AVIC outcomes identified in this study should be examined in vivo. However, in vivo research into the mechanisms of CAVD is currently limited by the lack of an animal model that accurately recapitulates human pathology. Nonetheless, we believe that identification of cadherin-11 may provide a useful tool for better understanding the pathogenesis of CAVD, and these results may have implications beyond solely elucidating mechanisms of calcific nodule formation. AVIC myofibroblast activation is believed to be one of the earliest processes in CAVD; however, early valvular changes are difficult to detect in patients. Very few markers of this differentiation are known, and the most commonly used ones such as αSMA do not lend themselves to imaging techniques because of their cytosolic expression. Because cadherin-11 is a transmembrane protein, it allows for targeting via molecular imaging tracers and may provide a molecular fingerprint for the onset of CAVD.

Acknowledgments

We thank the Vanderbilt Heart and Vascular Institute Main Heart Registry for supplying the diseased leaflets and supporting the study. We also thank Tarek Absi, MD for supplying the noncalcified aortic valve leaflets.

Sources of Funding

This work was supported by the American Heart Association (AHA; 0835496N and 09GRNT2010125) and National Institutes of Health (HL094707), all to W.D.M. J.D.H. (10PRE4290020), J.C. (11PRE7990023), and M.K.S.L. (12PRE12070154) were supported by AHA Predoctoral Fellowships.

Disclosures

None.

Footnotes

  • Received August 7, 2012.
  • Accepted October 31, 2012.

References

  1. 1.↵
    1. Hinz B
    . Formation and function of the myofibroblast during tissue repair. J Invest Dermatol. 2007;127:526–537.
    OpenUrlCrossRefPubMed
  2. 2.↵
    1. Tomasek JJ,
    2. Gabbiani G,
    3. Hinz B,
    4. Chaponnier C,
    5. Brown RA
    . Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol. 2002;3:349–363.
    OpenUrlCrossRefPubMed
  3. 3.↵
    1. Hinz B
    . The myofibroblast: paradigm for a mechanically active cell. J Biomech. 2010;43:146–155.
    OpenUrlCrossRefPubMed
  4. 4.↵
    1. Serini G,
    2. Gabbiani G
    . Mechanisms of myofibroblast activity and phenotypic modulation. Exp Cell Res. 1999;250:273–283.
    OpenUrlCrossRefPubMed
  5. 5.↵
    1. Goldbarg SH,
    2. Elmariah S,
    3. Miller MA,
    4. Fuster V
    . Insights into degenerative aortic valve disease. J Am Coll Cardiol. 2007;50:1205–1213.
    OpenUrlCrossRefPubMed
  6. 6.↵
    1. Freeman RV,
    2. Otto CM
    . Spectrum of calcific aortic valve disease: pathogenesis, disease progression, and treatment strategies. Circulation. 2005;111:3316–3326.
    OpenUrlFREE Full Text
  7. 7.↵
    1. Helske S,
    2. Kupari M,
    3. Lindstedt KA,
    4. Kovanen PT
    . Aortic valve stenosis: an active atheroinflammatory process. Curr Opin Lipidol. 2007;18:483–491.
    OpenUrlPubMed
  8. 8.↵
    1. Mohler ER 3rd.,
    2. Chawla MK,
    3. Chang AW,
    4. Vyavahare N,
    5. Levy RJ,
    6. Graham L,
    7. Gannon FH
    . Identification and characterization of calcifying valve cells from human and canine aortic valves. J Heart Valve Dis. 1999;8:254–260.
    OpenUrlPubMed
  9. 9.↵
    1. Rajamannan NM
    . Calcific aortic valve disease: cellular origins of valve calcification. Arterioscler Thromb Vasc Biol. 2011;31:2777–2778.
    OpenUrlFREE Full Text
  10. 10.↵
    1. Rajamannan NM,
    2. Evans FJ,
    3. Aikawa E,
    4. Grande-Allen KJ,
    5. Demer LL,
    6. Heistad DD,
    7. Simmons CA,
    8. Masters KS,
    9. Mathieu P,
    10. O’Brien KD,
    11. Schoen FJ,
    12. Towler DA,
    13. Yoganathan AP,
    14. Otto CM
    . Calcific aortic valve disease: not simply a degenerative process: A review and agenda for research from the National Heart and Lung and Blood Institute Aortic Stenosis Working Group. Executive summary: calcific aortic valve disease-2011 update. Circulation. 2011;124:1783–1791.
    OpenUrlFREE Full Text
  11. 11.↵
    1. Chen JH,
    2. Chen WL,
    3. Sider KL,
    4. Yip CY,
    5. Simmons CA
    . β-catenin mediates mechanically regulated, transforming growth factor-β1-induced myofibroblast differentiation of aortic valve interstitial cells. Arterioscler Thromb Vasc Biol. 2011;31:590–597.
    OpenUrlAbstract/FREE Full Text
  12. 12.↵
    1. Cushing MC,
    2. Liao JT,
    3. Anseth KS
    . Activation of valvular interstitial cells is mediated by transforming growth factor-beta1 interactions with matrix molecules. Matrix Biol. 2005;24:428–437.
    OpenUrlCrossRefPubMed
  13. 13.↵
    1. Walker GA,
    2. Masters KS,
    3. Shah DN,
    4. Anseth KS,
    5. Leinwand LA
    . Valvular myofibroblast activation by transforming growth factor-beta: implications for pathological extracellular matrix remodeling in heart valve disease. Circ Res. 2004;95:253–260.
    OpenUrlAbstract/FREE Full Text
  14. 14.↵
    1. Balachandran K,
    2. Sucosky P,
    3. Jo H,
    4. Yoganathan AP
    . Elevated cyclic stretch induces aortic valve calcification in a bone morphogenic protein-dependent manner. Am J Pathol. 2010;177:49–57.
    OpenUrlCrossRefPubMed
  15. 15.↵
    1. Merryman WD,
    2. Lukoff HD,
    3. Long RA,
    4. Engelmayr GC Jr.,
    5. Hopkins RA,
    6. Sacks MS
    . Synergistic effects of cyclic tension and transforming growth factor-beta1 on the aortic valve myofibroblast. Cardiovasc Pathol. 2007;16:268–276.
    OpenUrlCrossRefPubMed
  16. 16.↵
    1. Benton JA,
    2. Kern HB,
    3. Leinwand LA,
    4. Mariner PD,
    5. Anseth KS
    . Statins block calcific nodule formation of valvular interstitial cells by inhibiting alpha-smooth muscle actin expression. Arterioscler Thromb Vasc Biol. 2009;29:1950–1957.
    OpenUrlAbstract/FREE Full Text
  17. 17.↵
    1. Fisher CI,
    2. Chen J,
    3. Merryman WD
    . Calcific nodule morphogenesis by heart valve interstitial cells is strain dependent. Biomech Model Mechanobiol. 2013. In press.
  18. 18.↵
    1. Jian B,
    2. Narula N,
    3. Li QY,
    4. Mohler ER 3rd.,
    5. Levy RJ
    . Progression of aortic valve stenosis: TGF-beta1 is present in calcified aortic valve cusps and promotes aortic valve interstitial cell calcification via apoptosis. Ann Thorac Surg. 2003;75:457–65; discussion 465.
    OpenUrlCrossRefPubMed
  19. 19.↵
    1. Yip CY,
    2. Chen JH,
    3. Zhao R,
    4. Simmons CA
    . Calcification by valve interstitial cells is regulated by the stiffness of the extracellular matrix. Arterioscler Thromb Vasc Biol. 2009;29:936–942.
    OpenUrlAbstract/FREE Full Text
  20. 20.↵
    1. Chen JH,
    2. Yip CY,
    3. Sone ED,
    4. Simmons CA
    . Identification and characterization of aortic valve mesenchymal progenitor cells with robust osteogenic calcification potential. Am J Pathol. 2009;174:1109–1119.
    OpenUrlCrossRefPubMed
  21. 21.↵
    1. Mohler ER 3rd.,
    2. Gannon F,
    3. Reynolds C,
    4. Zimmerman R,
    5. Keane MG,
    6. Kaplan FS
    . Bone formation and inflammation in cardiac valves. Circulation. 2001;103:1522–1528.
    OpenUrlAbstract/FREE Full Text
  22. 22.↵
    1. Benton JA,
    2. Kern HB,
    3. Anseth KS
    . Substrate properties influence calcification in valvular interstitial cell culture. J Heart Valve Dis. 2008;17:689–699.
    OpenUrlPubMed
  23. 23.↵
    1. Cushing MC,
    2. Mariner PD,
    3. Liao JT,
    4. Sims EA,
    5. Anseth KS
    . Fibroblast growth factor represses Smad-mediated myofibroblast activation in aortic valvular interstitial cells. FASEB J. 2008;22:1769–1777.
    OpenUrlAbstract/FREE Full Text
  24. 24.↵
    1. Gu X,
    2. Masters KS
    . Role of the MAPK/ERK pathway in valvular interstitial cell calcification. Am J Physiol Heart Circ Physiol. 2009;296:H1748–H1757.
    OpenUrlAbstract/FREE Full Text
  25. 25.↵
    1. Hinz B,
    2. Pittet P,
    3. Smith-Clerc J,
    4. Chaponnier C,
    5. Meister JJ
    . Myofibroblast development is characterized by specific cell-cell adherens junctions. Mol Biol Cell. 2004;15:4310–4320.
    OpenUrlAbstract/FREE Full Text
  26. 26.↵
    1. Lee DM,
    2. Kiener HP,
    3. Agarwal SK,
    4. Noss EH,
    5. Watts GF,
    6. Chisaka O,
    7. Takeichi M,
    8. Brenner MB
    . Cadherin-11 in synovial lining formation and pathology in arthritis. Science. 2007;315:1006–1010.
    OpenUrlAbstract/FREE Full Text
  27. 27.↵
    1. Schneider DJ,
    2. Wu M,
    3. Le TT,
    4. Cho SH,
    5. Brenner MB,
    6. Blackburn MR,
    7. Agarwal SK
    . Cadherin-11 contributes to pulmonary fibrosis: potential role in TGF-β production and epithelial to mesenchymal transition. FASEB J. 2012;26:503–512.
    OpenUrlAbstract/FREE Full Text
  28. 28.↵
    1. Merryman WD,
    2. Liao J,
    3. Parekh A,
    4. Candiello JE,
    5. Lin H,
    6. Sacks MS
    . Differences in tissue-remodeling potential of aortic and pulmonary heart valve interstitial cells. Tissue Eng. 2007;13:2281–2289.
    OpenUrlCrossRefPubMed
  29. 29.↵
    1. Heupel WM,
    2. Baumgartner W,
    3. Laymann B,
    4. Drenckhahn D,
    5. Golenhofen N
    . Different Ca2+ affinities and functional implications of the two synaptic adhesion molecules cadherin-11 and N-cadherin. Mol Cell Neurosci. 2008;37:548–558.
    OpenUrlPubMed
  30. 30.↵
    1. Hutcheson JD,
    2. Ryzhova LM,
    3. Setola V,
    4. Merryman WD
    . 5-HT(2B) antagonism arrests non-canonical TGF-β1-induced valvular myofibroblast differentiation. J Mol Cell Cardiol. 2012;53:707–714.
    OpenUrlCrossRefPubMed
  31. 31.↵
    1. Butcher JT,
    2. Tressel S,
    3. Johnson T,
    4. Turner D,
    5. Sorescu G,
    6. Jo H,
    7. Nerem RM
    . Transcriptional profiles of valvular and vascular endothelial cells reveal phenotypic differences: influence of shear stress. Arterioscler Thromb Vasc Biol. 2006;26:69–77.
    OpenUrlAbstract/FREE Full Text
  32. 32.↵
    1. Pittet P,
    2. Lee K,
    3. Kulik AJ,
    4. Meister JJ,
    5. Hinz B
    . Fibrogenic fibroblasts increase intercellular adhesion strength by reinforcing individual OB-cadherin bonds. J Cell Sci. 2008;121(pt 6):877–886.
    OpenUrlAbstract/FREE Full Text
  33. 33.↵
    1. Samarakoon R,
    2. Higgins PJ
    . Integration of non-SMAD and SMAD signaling in TGF-beta1-induced plasminogen activator inhibitor type-1 gene expression in vascular smooth muscle cells. Thromb Haemost. 2008;100:976–983.
    OpenUrlPubMed
  34. 34.↵
    1. Li J,
    2. Zhao Z,
    3. Liu J,
    4. Huang N,
    5. Long D,
    6. Wang J,
    7. Li X,
    8. Liu Y
    . MEK/ERK and p38 MAPK regulate chondrogenesis of rat bone marrow mesenchymal stem cells through delicate interaction with TGF-beta1/Smads pathway. Cell Prolif. 2010;43:333–343.
    OpenUrlCrossRefPubMed
  35. 35.↵
    1. Jiang W,
    2. Zhang Y,
    3. Wu H,
    4. Zhang X,
    5. Gan H,
    6. Sun J,
    7. Chen Q,
    8. Guo M,
    9. Zhang Z
    . Role of cross-talk between the Smad2 and MAPK pathways in TGF-beta1-induced collagen IV expression in mesangial cells. Int J Mol Med. 2010;26:571–576.
    OpenUrlPubMed
  36. 36.↵
    1. Greenberg RS,
    2. Bernstein AM,
    3. Benezra M,
    4. Gelman IH,
    5. Taliana L,
    6. Masur SK
    . FAK-dependent regulation of myofibroblast differentiation. FASEB J. 2006;20:1006–1008.
    OpenUrlAbstract/FREE Full Text
  37. 37.↵
    1. Simmons CA,
    2. Nikolovski J,
    3. Thornton AJ,
    4. Matlis S,
    5. Mooney DJ
    . Mechanical stimulation and mitogen-activated protein kinase signaling independently regulate osteogenic differentiation and mineralization by calcifying vascular cells. J Biomech. 2004;37:1531–1541.
    OpenUrlCrossRefPubMed
  38. 38.↵
    1. Grossman M,
    2. Barsoum A,
    3. Lang S,
    4. Kaden JJ,
    5. Kallenbach K,
    6. Borggrefe M,
    7. Akat KM
    . Osteoblast-like differentiation in aortic valve stenosis is accompanied by changes in n-cadherin and cadherin-11 expression. Eur Heart J. 2010;31:964.
    OpenUrl
View Abstract

This Issue

Jump to

Article Tools

Share this Article

  • Email
  • Cadherin-11 Regulates Cell–Cell Tension Necessary for Calcific Nodule Formation by Valvular Myofibroblasts
    Joshua D. Hutcheson, Joseph Chen, M.K. Sewell-Loftin, Larisa M. Ryzhova, Charles I. Fisher, Yan Ru Su and W. David Merryman
    Arteriosclerosis, Thrombosis, and Vascular Biology. 2013;33:114-120, originally published December 12, 2012
    https://doi.org/10.1161/ATVBAHA.112.300278
    del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo

Related Articles

Cited By...

Subjects