Integrative Physiology/Experimental Medicine |
From the Departments of Cardiovascular Medicine (R.M., T.I., T.H., K.I., I.I., K.S.) and Advanced Therapeutics for Cardiovascular Diseases (T.I.), Kyushu University Graduate School of Medical Sciences, Fukuoka, Japan; and the Cardiovascular Research Institute (J.S.), University of Medicine and Dentistry of New Jersey, Newark.
Correspondence to Toshihiro Ichiki, MD, Department of Cardiovascular Medicine, Kyushu University Graduate School of Medical Sciences, 3-1-1 Maidashi, Higashiku, 812-8582 Fukuoka, Japan. E-mail ichiki{at}cardiol.med.kyushu-u.ac.jp
| Abstract |
|---|
|
|
|---|
Methods and Results— Northern and Western blot analysis revealed that resveratrol significantly decreased the expression of AT1R at mRNA and protein levels in a dose- and time-dependent manner. Overexpression of SIRT1 reduced AT1R expression whereas nicotinamide, an inhibitor of SIRT1, increased AT1R expression and reversed the resveratrol-induced AT1R downregulation. AT1R gene promoter activity was decreased by resveratrol, but resveratrol did not affect the AT1R mRNA stability. Deletion analysis showed that the most proximal region of AT1R gene promoter containing Sp1 site is responsible for downregulation. Administration of resveratrol suppressed AT1R expression in the mouse aorta and blunted angiotensin II–induced hypertension.
Conclusion— Resveratrol suppressed AT1R expression through SIRT1 activation both in vivo and in vitro. The inhibition of the renin-angiotensin system may contribute, at least in part, to the resveratrol-induced longevity and antiatherogenic effect of resveratrol.
Sirtuin1 (SIRT1) belongs to class III histone/protein deacetylases and are associated with longevity. Resveratrol significantly suppressed AT1R expression at the transcriptional level through SIRT1 activation both in vivo and in vitro. The downregulation of renin-angiotensin system may contribute to the longevity and antiatherogenic effect of resveratrol.
Key Words: resveratrol SIRT1 angiotensin II receptor vascular smooth muscle cell
| Introduction |
|---|
|
|
|---|
Angiotensin II (Ang II) plays important roles in the pathogenesis of atherosclerosis and hypertension.16 Mammalian cells express 2 types of Ang II receptors, Ang II type 1 receptor (AT1R)17 and Ang II type 2 receptor (AT2R).18 AT1R and AT2R belong to the 7-transmembrane, G protein–coupled receptor family. These receptors exert opposite effects in terms of cell growth and blood pressure regulation.19 However, most of the traditional cardiovascular effects of Ang II such as vasoconstriction and water and sodium retention are mediated by AT1R.20,21 It was also reported that inhibition of Ang II function by AT1R antagonist prolonged the life span of hypertensive rats.22
We, therefore, hypothesized that resveratrol may inhibit the renin-angiontein system and examined whether resveratrol affects AT1R expression in vascular smooth muscle cells (VSMCs).
| Materials and Methods |
|---|
|
|
|---|
-tubulin were from Santa Cruz Biotechnology. An anti-SIRT1, anti–extracellular signal regulated protein kinase (ERK), and anti–phospho ERK (pERK) antibodies were purchased from Cell Signaling. [
-32P]dCTP and [
-32P]ATP were purchased from Perkin-Elmer Life Sciences. Other chemical reagents were purchased from Wako Pure Chemicals unless mentioned specifically.
Cell Culture
VSMCs were isolated from the thoracic aorta of Sprague-Dawley rats and maintained in DMEM supplemented with 10% FBS at 37°C in a humidified atmosphere of 95% air-5% CO2. VSMCs were grown to confluence, cultured in DMEM with 0.1% BSA for additional 2 days, and used in the experiment. Cells between passages 5 and 12 were used.
Northern Blot Analysis
Total RNA was prepared by an acid guanidinium thiocyanate-phenol-chloroform extraction method, and Northern blot analysis of AT1R and 18s ribosomal (r) RNA was performed as described previously.23 The radioactivity of the AT1R mRNA bands was counted with an imaging analyzer and was normalized with the radioactivity of rRNA. The expression level of AT1R was indicated as a ratio of AT1R mRNA to rRNA. To analyze mRNA stability of AT1R, Actinomycin D (5 µg/mL) was added after 6 hours of stimulation with resveratrol (100µmol/L). VSMCs were harvested at 3, 6, 12, 24 hours after addition of actinomycin D. The expression level of AT1R mRNA was determined by Northern blot analysis.
To determine whether resveratrol-induced AT1R mRNA downregulation requires de novo protein synthesis, VSMCs were pretreated with or without cycloheximide (CHX, 10µmol/L) for 30 minutes and incubated in the presence or absence of resveratrol (RV, 100 µmol/L) for 12 hours. Then the AT1R mRNA level was determined by Northern blot analysis.
Western Blot Analysis
Western blot analysis of AT1R was performed as described previously.24 The specific band was scanned with an imaging analyzer, and
-tubulin was used as a loading control. The expression level of AT1R was indicated as a ratio of AT1R to
-tubulin. Expression of SIRT 1 was examined by the same method.
Measurement of AT1R Gene Promoter Activity
Five deletion mutants of AT1a gene promoter were prepared by digestion with restriction endonucleases and ligated to luciferase gene as described previously.25 AT1R promoter/luciferase DNA constructs and LacZ gene were intrduced to VSMCs with the DEAE-dextran method. Then VSMCs were stimulated with resveratrol (100µmol/L) for 12 hours. Promoter activity of AT1R gene was measured by luciferase assay and normalized by β-galactosidase activity as described previously.26 The AT1R promoter-luciferase construct with mutation in the GC-box-related sequence (wild-type: TGCAGAGCAGCGACGCCCCCTAGGC mutant: TGCAGAGCAGCGA CGTTTCCTAGGC) was a generous gift from Dr Sugawara (Tohoku University, Japan).
Measurement of Cell Viability
Confluent VSMCs were serum deprived for 48 hours and then treated with resveratrol. After 24 hours incubation, attached cells were harvested with trypsin-EDTA. Cells in the medium were collected by centrifugation. These cells were stained with 0.4% trypan blue. The number of total and dead cells was counted with an hemocytometer.27
Adenovirus Vector Expressing SIRT1
A recombinant adenovirus vector expressing a wild-type SIRT1 (AdSIRT1) was described previously.28 VSMCs were grown to 80% confluence, washed twice with phosphate-buffered saline (PBS), and incubated with AdSIRT1 or empty viral vector (AdEmpty) under gentle agitation for 2 hours at room temperature. Then the cells were washed 3 times with PBS, cultured in DMEM with 0.1% BSA for 2 days, and used for the experiments. Multiplicity of infection (moi) indicates the number of virus per cell added to culture dish.
Preparation of Nuclear Extracts and Gel Mobility Shift Assay
Cells were scraped off, washed in ice-cold PBS followed by ice-cold hypotonic buffer (buffer A: 10mmol/L HEPES, pH7.9, 1.5mmol/L MgCl2, 10mmol/L KCl, 0.5mmol/L PMSF, 0.5mmol/L DTT), and then lysed for 10 minutes on ice in the buffer A containing 0.1% Nonident P-40. The lysates were centrifuged for 10 minutes at 10 000g. The pelleted nuclei were suspended in lysis buffer (20 mmol/L HEPES, pH 7.9, 420 mmol/L NaCl, 1.5 mmol/L MgCl2, 0.2 mmol/L EDTA, 25% glycerol, 0.5 mmol/L PMSF, 0.5 mmol/L DTT), incubated for 15 minutes at 4°C, and centrifuged for 10 minutes at 10 000g. The supernatant was used as nuclear extracts.
A synthetic DNA probe (AT1R gene promoter: –40 bp to –6 bp; GGAACCTGCAGAGCA GCGACGCCCCCTAGGCTATA: containing Sp1 site) was labeled with 32P by using [
-32P] ATP and T4 polynucleotide kinase, and purified by Sephadex G-50 column. And A synthetic DNA probe with mutation in Sp1 site (GGAACCTGCAGAGCAGCGACGTTTCCTAGGCTATA) was also prepared and used as a competitor. Twenty µg of nuclear extracts was incubated with 1x105 cpm of labeled DNA probe and 2 µg of poly (dI-dC) in a buffer containing 10 mmol/L Tris-HCl, pH7.5, 1mmol/L EDTA, 4% glycerol, 100 mmol/L NaCl, 2.5mmol/L DTT, 100 mg/L bovine serum albumin for 15 minutes at room temperature. Then the samples were electrophoresed on 5% acrylamide/0.25xTBE gel (1xTBE 90mmol/L of tris borate, 2mmol/L of EDTA). After electrophoresis, gels were dried and exposed to x-ray film at –70°C.
Animal Experiment
All procedures were approved by the institutional animal use and care committee, and were conducted in conformity with institutional guidelines. Nine-week-old C57/B6 mice were purchased from Kyudo Co Ltd (Japan). Resveratrol was suspended in water at 0.1 mg/mL and administered ad libitum. The estimated dose of orally ingested resveratrol was 10 mg/kg/d. In Ang II group, 490 ng/min/kg of Ang II was administered subcutaneously via osmotic minipump (Alzet). Blood pressure and heart rate were measured using tail-cuff method (UR-5000, UEDA). After 1 week, mice were euthanized under pentobarbital anesthesia. Aortas were quickly removed, minced into small pieces, and homogenized on ice in a buffer (0.25 mol/L sucrose, 5 mmol/L Tris-HCl at pH7.5, 1 mmol/L MgCl2). The homogenates were centrifuged at 2000 rpm for 15 minutes at 4°C, and the supernatants were centrifuged at 100 000g for 30 minutes at 4°C. The pellets were used as a membrane fraction and subjected to Western blot analysis of AT1R and
-tubulin.
Statistical Analysis
Statistical analysis was performed with performed 1- or 2-way ANOVA and Fisher test, if appropriate. Data are shown as mean±SEM. P<0.05 was considered to be statistically significant.
| Results |
|---|
|
|
|---|
|
SIRT1 Mediates AT1R mRNA Downregulation
Resveratrol is known to activate SIRT1. We examined whether SIRT1 is involved in the resveratrol-induced AT1R downregulation. The expression level of AT1R mRNA was significantly increased by incubation with nicotinamide, a noncompetitive inhibitor of SIRT1 compared with the control level in a dose-dependent manner (1 to 100 µmol/L, Figure 2A). Resveratrol (RV: 50 µmol/L)-induced suppression of AT1R was significantly reversed by addition of nicotinamide (NAM, 30 µmol/L; Figure 2B). However, resveratrol downregulated AT1R mRNA in the presence of TSA, class I or II HDAC inhibitor (supplemental Figure II). To achieve high expression levels of SIRT1 in VSMCs, we used a recombinant adenovirus vector expressing wild-type of SIRT1 (S, 10 moi) and AdEmpty (E,10 moi; Figure 2C). Overexpression of SIRT1 (3 to 30 moi) significantly suppressed AT1R expression compared with the cells infected with AdEmpty (30 moi; Figure 2D). To clarify whether AT1R downregulation is functional, we examined ERK phosphorylation. AngII (100 nmol/L)-induced ERK phosphorylation was inhibited in SIRT1 overexpressing cells, but not in empty vector-infected cells, suggesting that downregulation of AT1R attenuated the response of VSMCs to AngII (supplemental Figure IIIA). However, PMA-induced ERK phosphorylation was not affected in the same condition, suggesting that the pathway to ERK activation is almost intact in SIRT1 overexpressing cells (supplemental Figure IIIB).
|
De Novo Protein Synthesis Is Not Required for Resveratrol-Induced Downregulation of AT1R Expression
To examine whether resveratrol-induced downregulation of AT1R mRNA requires de novo protein synthesis, we examined the effect of cycloheximide (10µmol/L). Although incubation with cycloheximide alone for 12 hours upregulated the AT1R mRNA expression, resveratrol significantly suppressed the AT1R mRNA level in the presence of cycloheximide (Figure 3A). These data suggest that resveratrol-induced AT1R downregulation does not require de novo protein synthesis. We next examined whether resveratrol affects AT1R mRNA stability. In control, AT1R mRNA levels were reduced by 50% after 24 hours, and resveratrol did not affect the degradation rate of AT1R mRNA (Figure 3B).
|
Resveratrol Inhibits AT1R Expression at the Transcriptional Level
To locate the DNA element responsible for resveratrol-induced AT1R suppression, we examined the transcription activity of the deletion mutants of AT1a gene promoter/luciferase fusion DNA (Figure 4A). The suppression was observed in all mutants, suggesting that the response element exists in the DNA segment between –61 bp and +25 bp, which contains Sp1 site. The luciferase construct with mutation in Sp1 site failed to respond to resveratrol, indicating the important role of Sp1 site in resveratrol-induced downregulation.
|
Reduction of Sp1 Binding by Resveratrol
We examined the DNA binding protein bound to the Sp1 site using gel mobility shift assay (Figure 5). When nuclear extracts from resveratrol-stimulated VSMC were used, DNA binding protein (arrow) was decreased compared with those from unstimulated VSMC (lanes 1 to 2). Addition of 50 times molar excess of unlabeled probe (lane 4) but not the Sp1 mutant probe (lane 3) eliminated this band, confirming the specificity of the binding.
|
Resveratrol Suppresses AT1R Expression In Vivo
Finally, we examined whether resveratrol affects AT1R expression in vivo. Nine-week-old mice were allotted to resveratrol group or water group in a random manner. Blood pressure, heart rate, and body weight were not significantly different between resveratrol- and water-treated mice after 1 week (supplemental Table I). After 1 week, membrane protein of aorta was extracted and Western blot analysis was performed. Western blot revealed that resveratrol reduced expression level of AT1R protein in the aorta (Figure 6A). And then, we examined the effect of resveratrol on AngII-induced hypertension. We found that Ang II–induced hypertension was markedly blunted by resveratrol administration (Figure 6B). Heart rate and body weight were not significantly different between Ang II+vehicle and Ang II+resveratrol-treated mice after 2 weeks (supplemental Table II).
|
| Discussion |
|---|
|
|
|---|
We showed that nicotinamide, a SIRT1 natural inhibitor, upregulated the expression level of AT1R mRNA, and overexpression of SIRT1 significantly suppressed AT1R protein expression. Furthermore, resveratrol-induced suppression of AT1R was reversed by nicotinamide. These data suggested that resveratrol suppressed AT1R expression through SIRT1 activation at least in part.
Haider UG et al reported that resveratrol interfered with Ang II signaling pathways in VSMCs.29 Resveratrol inhibited Ang II–induced tyrosine-phosphorylation of Gab1 and its association with the p85 subunit of phosphatidylinositol-3-kinase. Therefore, resveratrol inhibits AT1R signaling as well as gene expression. Actis-Goretta L reported that red wine inhibits ACE activity more effectively than white wine. However resveratrol was ineffective in the inhibition of ACE activity in rat tissues.30 We supposed that resveratrol may suppress renin-angiotensin system not via ACE downregulation but via AT1R downregulation and inhibition of AT1R signaling.
In a rat model of injured aorta, administration of resveratrol accelerated reendothelialization and inhibited neointimal formation.31 Because Ang II and AT1R play an important role in the neointimal formation after vascular injury, downregulation of AT1R expression by resveratrol may be involved in the suppression of neointimal formation. In addition, resveratrol has been reported to inhibit serum-induced VSMC growth.32 Therefore, direct inhibition of VSMC growth by resveratrol may also play a role.
It was previously reported that resveratrol increased the endothelial nitric oxide synthase (eNOS) mRNA stability in human EA.hy 926 endothelial cells.33 We investigated whether resveratrol affects the AT1R mRNA stability in VSMCs. Resveratrol reduced AT1R gene promoter activity, but resveratrol did not affect AT1R mRNA stability. These data suggest that resveratrol suppressed AT1R gene expression at the transcriptional level rather than posttranscriptional level. The deletion analysis of the AT1R gene promoter revealed that suppression of AT1R expression by resveratrol is dependent on the most proximal promoter region (from –61 bp to +25 bp), which contains Sp1 binding site (GC box). The luciferase construct with mutation in GC box failed to respond to resveratrol, indicating an important role of Sp1 site in resveratrol-induced AT1R downregulation. Gel shift assay showed that DNA binding protein bound to the Sp1 site was decreased in resveratrol-stimulated VSMC. A recent report showed that Sp1 is constitutively acetylated at Lys703,34 and deacetylation of Sp1 induced activation of 12(s)-lipoxygenase gene expression. Conversely, another report showed that HDAC1 mediates repression of transforming growth factor (TGF) β type II receptor gene transcription by deacetylation of Sp1.35 Therefore, the effects of deacetylation of Sp1 on gene expression may be context-dependent. Our data suggest that resveratrol inhibits Sp1 binding to AT1R gene promoter and AT1R gene transcription, supporting the results of the latter report. However, it is not clear how SIRT1 inhibits Sp1 binding at this moment, and further study is needed.
As shown in Figure 6B, chronic low-dose AngII infusion via osmotic minipump developed hypertension in mice as described previously,36 and Ang II–induced hypertension was blunted by resveratrol. Because resveratrol inhibits AT1R signaling,29 we supposed that this was attributable to inhibition of AT1R signaling and AT1R downregulation as shown Figure 6A by resveratrol. However, it is difficult to dissect these 2 effects in terms of the blood pressure regulation.
Previous studies have demonstrated that resveratrol extends the life span of diverse species.6,7 It was also reported that inhibition of Ang II function by angiotensin converting enzyme inhibitor37 and AT1R antagonist22 prolonged the lifespan of hypertensive rats. Considering that oral administration of resveratrol suppressed the AT1R protein expression in the aorta of mice, the inhibition of the renin-angiotensin system via AT1R suppression may contribute, at least in part, to the longevity by resveratrol. The downregulation of AT1R may also account for antiatherogenic effect of resveratrol.
In conclusion, we demonstrated that resveratrol downregulated AT1R expression through SIRT1. The suppression of AT1R expression may contribute to resveratrol-induced life-span extension, inhibition of atherosclerosis and inflammation.
| Acknowledgments |
|---|
This study was supported in part by Grants-in-aid for Scientific Research from the Ministry of Education, Culture, Sports, Science, and Technology of Japan (19590867) and Kimura Foundation Research Grant 2007 to T.I.
Disclosures
None.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Nonomura S, Kanagawa H, Hashimoto A. Chemical constituents of polygonaceous plants. Studies on the components of Ko-jo-kon(Polygonum Caspidatum Sieb. et Zucc) Yakugaku Zasshi. 1963; 83: 988–990.[Medline] [Order article via Infotrieve]
3. Baur JA, Sinclair DA. Therapeutic potential of resveratrol: the in vivo evidence. Nat Rev Drug Discov. 2006; 5: 493–506.[CrossRef][Medline] [Order article via Infotrieve]
4. Wang Q, Xu J, Rottinghaus GE, Lubahn D, Sun GY, Sun AY. Resveratrol protects against global cerebral ischemic injury in gerbils. Brain Res. 2002; 958: 439–447.[CrossRef][Medline] [Order article via Infotrieve]
5. Jang M, Cai L, Udeani GO, Slowing KV, Thomas CF, Beecher CW, Fong HH, Farnsworth NR, Kinghorn AD, Mehta RG, Moon RC, Pezzuto JM. Cancer chemopreventive activity of resveratrol, a natural product derived from grapes. Science. 1997; 275: 218–220.
6. Howitz KT, Bitterman KJ, Cohen HY, Lamming DW, Lavu S, Wood JG, Zipkin RE, Chung P, Kisielewski A, Zhang LL, Sscherer B, Sinclair DA. Small molecule activators of sirtuins extend Saccharomyces cerevisiae lifespan. Nature. 2003; 425: 191–196.[CrossRef][Medline] [Order article via Infotrieve]
7. Valenzano DR, Terzibasi E, Genade T, Cattaneo A, Domenici L, Cellerino A. Resveratrol prolongs lifespan and retards the onset of age-related markers in a short-lived vertebrate. Curr Biol. 2006; 16: 296–300.[CrossRef][Medline] [Order article via Infotrieve]
8. Baur JA, Pearson KJ, Price NL, Jamieson HA, Lerin C, Kalra A, Prabhu VV, Allard JS, Lopez-Lluch G, Lewis K, Pistell PJ, Poosala S, Becker KG, Boss O, Gwinn D, Wang M, Ramaswamy S, Fishbein KW, Spencer RG, Lakatta EG, Le Couteur D, Shaw RJ, Navas P, Puigserver P, Ingram DK, de Cabo R, Sinclair DA. Resveratrol improves health and survival of mice on a high-calorie diet. Nature. 2006; 444: 337–342.[CrossRef][Medline] [Order article via Infotrieve]
9. Okamoto H, Fujioka Y, Takahashi A, Takahashi T, Taniguchi T, Ishikawa Y, Yokoyama M. Trichostatin A, an inhibitor of histone deacetylase, inhibits smooth muscle cell proliferation via induction of p21(WAF1). J Atheroscler Thromb. 2006; 13: 183–191.[Medline] [Order article via Infotrieve]
10. Denu JM. Linking chromatin function with metabolic networks: Sir2 family of NAD(+)-dependent deacetylases. Trends Biochem Sci. 2003; 28: 41–48.[CrossRef][Medline] [Order article via Infotrieve]
11. Imai S, Christopher MA, Matt K, Leonard G. Transcriptional silencing and longevity protein Sir2 is an NAD-dependent histone deacetylase. Nature. 1999; 403: 795–800.[CrossRef]
12. Bitterman KJ, Anderson RM, Cohen HY, Latorre-Esteves M, Sinclair DA. Inhibition of silencing and accelerated aging by nicotinamide, a putative negative regulator of yeast sir2 and human SIRT1. J Biol Chem. 2002; 277: 45099–45107.
13. Dryden SC, Nahhas FA, Nowak JE, Goustin AS, Tainsky MA. Role for human SIRT2 NAD-dependent deacetylase activity in control of mitotic exit in the cell cycle. Mol Cell Biol. 2003; 23: 3173–3185.
14. Blander G, Guarente L. The Sir2 family of protein deacetylases. Annu Rev Biochem. 2004; 73: 417–435.[CrossRef][Medline] [Order article via Infotrieve]
15. Cohen HY, Miller C, Bitterman KJ, Wall NR, Hekking B, Kessler B, Howitz KT, Gorospe M, de Cabo R, Sinclair DA. Calorie restriction promotes mammalian cell survival by inducing the SIRT1 deacetylase. Science. 2004; 305: 390–392.
16. Goodfriend TL, Elliott ME, Catt KJ. Drug therapy: angiotensin receptors and their antagonists. N Engl J Med. 1996; 334: 1649–1654.
17. Sasaki K, Yamano Y, Bardhan S, et al. Cloning and expression of a complementary DNA encoding a bovine adrenal angiotensin II type-1 receptor. Nature. 1991; 351: 230–233.[CrossRef][Medline] [Order article via Infotrieve]
18. Kambayashi Y, Bardhan S, Takahashi K, et al. Molecular cloning of a novel angiotenin II receptor isoform involved in phosphotyrosine phosphatase inhibition. J Biol Chem. 1993; 268: 24543–24546.
19. Horiuchi M, Akishita M, Dzau VJ. Recent progress in angiotensin II type 2 receptor research in the cardiovascular system. Hypertension. 1999; 33: 613–621.
20. Touyz RM, Schiffrin EL. Signal transduction mechanisms mediating the physiological and pathophysiological actions of angiotensin II in vascular smooth muscle cells. Pharmacol Rev. 2000; 52: 639–672.
21. Paradis P, Dali-Youcef N, Paradis FW, Thibault G, Nemer M. Overexpression of angiotensin II type 1 receptor in cardiomyocytes induces cardiac hypertrophy and remodeling. Proc Natl Acad Sci U S A. 2000; 97: 931–936.
22. Wolfgang L, Holger H, Bernward AS, Gabriele W. Long-term angiotensin II type 1 receptor blockade with Fonsartan doubles lifespan of hypertensive rats. Hypertension. 2000; 35: 908–913.
23. Ichiki T, Usui M, Kato M, Funakoshi Y, Ito K, Egashira K, Takeshita A. Downregulation of angiotensin II type 1 receptor gene transcription by nitric oxide. Hypertension. 1998; 31: 342–348.
24. Imayama I, Ichiki T, Inanaga K, Ohtsubo H, Fukuyama K, Ono H, Hashiguchi Y, Sunagawa K. Telmisartan downregulates angiotensin II type 1 receptor through activation of peroxisome proliferator-activated receptor
. Cardiovasc Res. 2006; 72: 184–190.
25. Guo DF, Uno S, Ishihata A, Nakamura N, Inagami T. Identification of a cis-acting glucocorticoid responsive element in the rat angiotensin II type 1A promoter. Circ Res. 1995; 77: 249–257.
26. Tokunou T, Ichiki T, Takeda K, Funakoshi Y, Iino N, Shimokawa H, Egashira K, Takeshita A Thrombin induces interleukin-6 expression through the cAMP response element in vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 2001; 21: 1759–1763.
27. Fukuyama K, Ichiki T, Takeda K, Tokunou T, Iino N, Masuda S, Ishibashi M, Egashira K, Shimokawa H, Hirano K, Kanaide H, Takeshita A. Downregulation of vascular angiotensin II type 1 receptor by thyroid hormone. Hypertension. 2003; 41: 598–603.
28. Alcendor RR, Kirshenbaum LA, Imai S, Vatner SF, Sadoshima J. Silent information regulator 2alpha, a longevity factor and class III histone deacetylase, is an essential endogenous apoptosis inhibitor in cardiac myocytes. Circ Res. 2004; 95: 971–980.
29. Haider UG, Roos TU, Kontaridis MI, Neel BG, Sorescu D, Griendling KK, Vollmar AM, Dirsch VM, Resveratrol inhibits angiotensin II- and epidermal growth factor-mediated Akt activation: role of Gab1 and Shp2. Mol Pharmacol. 2005; 68: 41–48.
30. Actis-Goretta L, Ottaviani JI, Fraga CG. Inhibition of angiotensin converting enzyme activity by flavanol-rich foods. J Agric Food Chem. 2006; 54: 229–234.[CrossRef][Medline] [Order article via Infotrieve]
31. J G, Cq W, Hh F, Hy D, Xl X, Ym X, By W, Dj H. Effects of resveratrol on endothelial cells and their contributions to reendothelialization in intima-injured rats. J Cardiovasc Pharmacol. 2006; 47: 711–721.[CrossRef][Medline] [Order article via Infotrieve]
32. Mnjoyan ZH, Fujise K. Profound negative regulatory effects by resveratrol on vascular smooth muscle cells: a role of p53-p21(WAF1/CIP1) pathway. Biochem Biophys Res Commun. 2003; 311: 546–552.[CrossRef][Medline] [Order article via Infotrieve]
33. Das S, Fraga CG, Das DK. Cardioprotective effect of resveratrol via HO-1 expression involves p38 map kinase and PI-3-kinase signaling, but does not involve NFkappaB. Free Radic Res. 2006; 40: 1066–1075.[CrossRef][Medline] [Order article via Infotrieve]
34. Hung JJ, Wang YT, Chang WC. Sp1 deacetylation induced by phorbol ester recruits p300 to activate 12(S)-lipoxygenase gene transcription. Mol Cell Biol. 2006; 26: 1770–1785.
35. Zhao S, Venkatasubbarao K, Li S, Freeman JW. Requirement of a specific Sp1 site for histone deacetylase-mediated repression of transforming growth factor β type II receptor expression in human pancreatic cancer cells. Cancer Research. 2003; 63: 2624–2630.
36. Tomasz JG, Nyssa EH, Kathryn AB, Louise AM, Ayaz R, Sergey D, Jorg G, Cornelia W, and David GH. Role of the T cell in the genesis of angiotensin II–induced hypertension and vascular dysfunction. J Exp Med. 2007; 204: 2449–2460.
37. Linz W, Jessen T, Becker RHA, Schölkens BA, Wiemer G. Long-term ACE inhibition doubles lifespan of hypertensive rats. Circulation. 1997; 96: 3164–3172.
This article has been cited by other articles:
![]() |
Z. Lu, I. Scott, B. R. Webster, and M. N. Sack The Emerging Characterization of Lysine Residue Deacetylation on the Modulation of Mitochondrial Function and Cardiovascular Biology Circ. Res., October 23, 2009; 105(9): 830 - 841. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Venkatesan, A. J. Valente, V. S. Reddy, D. A. Siwik, and B. Chandrasekar Resveratrol blocks interleukin-18-EMMPRIN cross-regulation and smooth muscle cell migration Am J Physiol Heart Circ Physiol, August 1, 2009; 297(2): H874 - H886. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2008 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |