Cell Biology and Signaling |
From the Aab Cardiovascular Research Institute and the Department of Medicine, University of Rochester School of Medicine and Dentistry, Rochester, New York.
Correspondence to Bradford C. Berk, MD, PhD, Aab Cardiovascular Research Institute and Department of Medicine, University of Rochester Medical Center, 601 Elmwood Avenue, Box 679, Rochester, NY 14642. E-mail Bradford_berk{at}urmc.rochester.edu
| Abstract |
|---|
|
|
|---|
Methods and Results— Ang II rapidly stimulated phosphorylation of HDAC5 at Ser498 in VSMCs. Knockdown of GIT1 significantly decreased HDAC5 phosphorylation induced by Ang II. The involvement of Src, phospholipase
(PLC
), and CamK II in GIT1-mediated HDAC5 phosphorylation was demonstrated. The association of GIT1 and CamK II was constitutive but increased after stimulation with Ang II. Moreover, the interaction of GIT1 and CamK II through the ARF GTPase-activating protein (ARF-GAP) and coiled-coil domains of GIT1 was essential for the phosphorylation of HDAC5. Finally, knockdown of GIT1 decreased myocyte enhancer factor 2 transcriptional activity induced by Ang II.
Conclusions— This study identifies a novel function for GIT1 as a mediator of Ang II-induced VSMC gene transcription via a Src-PLC
-CamK II-HDAC5 signaling pathway.
Key Words: G protein-coupled receptor-kinase interacting protein1 GIT1 angiotensin II histone heacetylase 5 Ca2+-calmodulin-dependent protein kinase II VSMC
| Introduction |
|---|
|
|
|---|
and MEK1.5–7 Conformational changes in GIT1 induced by tyrosine phosphorylation lead to the activation of PLC
.5 Activation of PLC
is responsible for the elevation of intracellular calcium, which results in the autophosphorylation (activation) of calcium/calmodulin-dependent protein kinase II (CamK II).8,9
Histone acetylation/deacetylation has emerged as a fundamental mechanism for the control of gene expression. Histone acetyltransferases stimulate transcription through acetylation of histones, resulting in relaxation of nucleosomes, and histone deacetylases (HDACs) antagonize this activity and repress transcription.10 Class II HDACs (HDACs 4, 5, 7, and 9) appear to be dedicated to the control of tissue growth and development. Phosphorylation of the amino termini of class II HDACs by CamK II creates docking sites for the 14-3-3 family of chaperone proteins, which promote shuttling of these HDACs from the nucleus to the cytoplasm, thereby derepressing HDAC target genes.11–13 HDAC5 acts as a negative regulator of cardiac growth. Transgenic mice lacking either HDAC5 or HDAC9 develop extremely enlarged hearts in response to pathological signals.14,15 CamK II plays an important role in HDAC5 phosphorylation induced by GPCR ligands.16 Based on these findings, we hypothesized that GIT1 mediates HDAC5 phosphorylation stimulated by Ang II via a pathway dependent on c-Src, PLC
, and CamK II. Furthermore we propose that derepression of HDAC5 increases MEF2 transcriptional activity in VSMCs.
| Materials and Methods |
|---|
|
|
|---|
antibody was from BD Transduction Laboratories. FLAG M2 monoclonal antibody was from Sigma. Xpress monoclonal antibody was from Invitrogen. Phosphospecific-ERK1/2 was from Cell Signal. Phospho-Ser498 HDAC5 and Ser498 HDAC5 antibodies were from Signal Antibody Technology. Ang II was from ICN Biomedicals. PP2, U73122, and KN93 were from Calbiochem. Other chemicals were purchased from Sigma.
Cell Culture and Transfection
VSMCs were obtained from rat aorta as described,17 and passages 6 to 10 were used in the experiments. HEK293 cells and VSMCs were cultured in Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum, penicillin, and streptomycin at 37°C in 5% CO2. HEK293T cells were transfected by Lipofectamine/plus (Invitrogen). For cotransfection with AT1R, a ratio of 3:1 was used. After allowing protein expression for 24 hours, cells were serum-deprived for 16 hours and stimulated with 100 nmol/L Ang II. GIT1 siRNA (AAGCTGCCAAGAAGAAGCTAC) and control nonsilencing siRNA(AATTCTCCGACACGTGTCACT) were designed as described and synthesized by Ambion. VSMCs were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturers protocol as described previously.18 GIT1 siRNA were prepared and transfected at 1 µmol/L for 48 hours as previously described,6 then serum-deprived for 16 hours, and stimulated with 100 nmol/L Ang II.
Plasmid Constructs
The mGIT1 expressed sequence tag clone (GenBank accession number AI414223) was purchased and completely sequenced. Then, full-length mGIT1 (GIT1[WT]) was cloned into the NotI and Xbal sites of Xpress-pcNDA3.1 vector (Invitrogen; Xpress-GIT1[WT]). Using polymerase chain reaction (PCR), GIT1(1 to 420aa), GIT1(420 to 770aa) were cloned into Xpress-pcDNA3.1 vector (Xpress-GIT1 [1 to 635aa], Xpress-GIT1 [1 to 420aa], Xpress-GIT1 [420 to 770aa]). pEBB-Flag-CamK II was a generous gift from Dr Richard A. Mauzer (Department of Cell and Developmental Biology, L215, Oregon Health & Science University, 3181 South West Sam Jackson Park Road, Portland, Oregon, 97239).
Immunoprecipitation and Immunoblotting
For immunoprecipitations, cells were lysed in RIPA buffer (150 mmol/L NaCl, 1% Nonidet P-40, 0.5% deoxycholic acid, 0.1% SDS, 50 mmol/L Tris-HCl, pH 8.0). Protein concentrations in the lysates were determined as described.14,19 The protein samples were separated by SDS-PAGE, transferred to nitrocellulose membranes, and incubated with appropriate primary antibodies. After incubating with fluorescence-conjugated secondary antibodies, immunoreactive proteins were visualized by an Odyssey infrared imaging system (LI-COR Biotechnology). Densitometric analysis of the blots was performed with Odyssey software (LI-COR Biotechnology). Results were normalized by arbitrarily setting the densitometry of control samples to 1.0.
Immunofluorescence
VSMCs cells were starved with serum-free DMEM overnight and then stimulated with Ang II in 0, 5, 10, 30, and 60 minutes. Cells were fixed with 4% formaldehyde for 10 minutes, washed with phosphate-buffered saline 3 times, permeabilized with 0.05% Triton for 5 minutes, and blocked with 10% normal goat serum for 1 hour. Cells were incubated with GIT1, and CamK II antibodies diluted in phosphate-buffered saline followed by Alexa Fluor 546 antirabbit IgG for red fluorescence or by Alexa Fluor 488 goat antimouse for green fluorescence (Molecular Probes Inc) in phosphate-buffered saline at a final concentration of 1.5 to 2 µg/mL each.
Luciferase Reporter Assay
To assess myocyte enhancer factor 2 (MEF2) transcriptional activation, we used 3x MEF2-dependent reporter gene [generous gift from Dr Joseph Miano (Aab Cardiovascular Research Institute, University of Rochester School of Medicine and Dentistry, Rochester, NY 14642)] in which 3 tandem repeats of MEF2 sites were located upstream of the thymidine kinase gene promoter. VSMCs cultured in 24-well dishes were cotransfected with 3x MEF2 luciferase reporter gene, thymidine kinase-renilla-luciferase (an internal control from Promega), Myc-HDAC5-WT plasmid (gift from Dr Eric N. Olson, University of Texas Southwestern Medical Center, Dallas, Texas) control siRNA, or GIT1 siRNA in each experiment using electroporation (Bio-Rad). At 32 hours posttransfection, cells were treated with Ang II for another 16 hours. The luciferase activities in cell lysates were determined using the Dual-Luciferase Reporter Assay kit (Promega) and Wallac 1420 multilabel counter (PerkinElmer).
Statistical Analysis
All values are expressed as means±SD from 3 to 6 independent experiments. The significance of the results was assessed by t test. A probability value <0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
-mediated calcium mobilization and CamK II activation, we studied HDAC5 phosphorylation in VSMCs in response to Ang II. Phosphorylation of HDAC5 was determined by phospho-HDAC5-specific antibody, which recognizes phosphorylation at Ser498. In response to 100 nmol/L Ang II, HDAC5 phosphorylation rapidly increased by 2.6-fold within 2 minutes, and reached a maximum at 5 minutes (3.3-fold; Figure 1A). HDAC5 phosphorylation returned to baseline after 30 minutes (Figure 1A). HDAC5 expression did not change during this time course.
|
GIT1 Is Required for Phosphorylation of HDAC5 by Ang II
To show a role for GIT1 in HDAC5 phosphorylation, we used rat GIT1 siRNA to decrease GIT1 expression in VSMCs as previously described.6 Rat control siRNA and rat GIT1siRNA were designed based on unique sequences and ability to inhibit mRNA expression. Transfection of GIT1 siRNA significantly decreased GIT1 protein expression at 48 hours, whereas HDAC5 expression was not altered (Figure 1B). Treatment with rat GIT1 siRNA significantly decreased HDAC5 phosphorylation induced by Ang II (80% inhibition), whereas control siRNA had no significant effect (Figure 1B).
Ang II Stimulates HDAC5 Phosphorylation via Src-Dependent Pathway
Previous data from our laboratory suggested an essential role for c-Src in AT1R signal transduction.20 To investigate the role of c-Src in HDAC5 phosphorylation, the c-Src inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine (PP2) was administrated for 30 minutes in VSMCs, before stimulation with 100 nmol/L Ang II for 5 minutes. Phosphorylation of HDAC5 was significantly decreased by PP2 treatment (supplemental Figure IA). To further confirm the role of c-Src, the dominant negative (DN) chicken c-Src adenovirus (Ad.DN-Src) was used to infect VSMCs.20 Infection of VSMCs with Ad.DN-Src resulted in robust expression of chicken Src (supplemental Figure IB). Infection at MOI of 100 and 300 almost completely blocked Ang II-induced HDAC5 phosphorylation, whereas Ad.Lac-Z infection had no significant effect. In contrast to the dramatic effect of Ad.DN-Src on p-HDAC5, there was significantly less inhibition of p-ERK1/2 (supplemental Figure IB).
PLC
and CamK II Are Required for HDAC5 Phosphorylation by Ang II
c-Src phosphorylates GIT1, which is bound to PLC
in a complex under basal conditions. Conformational changes in GIT1 induced by tyrosine phosphorylation lead to the activation of PLC
which is required for elevation of intracellular calcium, and autophosphorylation of CamK II. To determine the involvement of PLC
and CamK II in HDAC5 phosphorylation in VSMCs, the effects of the PLC
inhibitor, U73122, and the CamK II inhibitor KN93 were investigated. Both U73122 and KN93 dose dependently inhibited the phosphorylation of HDAC5 (supplemental Figure IC and ID). These results suggest that PLC
and CamK II play important roles in the Ang II-stimulated HDAC5 signaling pathway.
Association of CamK II, HDAC5, and 14-3-3 Is Increased by Ang II
Phosphorylation of HDAC5 creates binding sites for the 14-3-3 proteins, which escort p-HDAC5 from the nucleus to the cytoplasm, with consequent activation of HDAC5 target genes. To investigate the association of CamK II with HDAC5 and 14-3-3 after stimulation of Ang II in VSMCs, coimmunoprecipitation was performed. The interaction of CamK II with HDAC5 and 14-3-3 increased rapidly (within 1 minute, Figure 2A), and peaked at 5 minutes, similar to the peak phosphorylation of HDAC5.
|
The Interaction of GIT1 and CamK II Is Increased by Ang II
Because GIT1 is a multidomain scaffold protein,4 we hypothesized that GIT1 functions as a scaffold for CamK II by binding to CamK II. The association of GIT1 and CamK II was assayed by immunoprecipitating CamK II from VSMC lysates. Whereas the binding of GIT1 and CamK II was constitutive (Figure 2B, time 0, supplemental Figure II), in response to Ang II binding rapidly increased and peaked at 5 minutes (2.6-fold increase, Figure 2B, supplemental Figure II), similar to the HDAC5 phosphorylation time course. The time course for GIT1-CamK II binding was similar to the time course for CamK II binding to HDAC5 and 14-3-3 (Figure 2A, supplemental Figure II), suggesting a multiprotein complex. To investigate further the potential interaction of HDAC5 and GIT1, we coexpressed them in HEK293 cells (which have low expression of CamK II). There was no basal interaction, nor increase in response to Ang II (supplemental Figure III).
GIT1 Recruited CamK II and PLC
to Form a "Calciosome" Complex, Which Mediated HDAC5 Phosphorylation by Ang II
Because GIT1 can associate with both CamK II and PLC
, we hypothesized that GIT1, CamK II, and PLC
could form a complex required for phosphorylation of HDAC5, which we will term the " Calciosome." The association of GIT1, CamK II, PLC
, and HDAC5 was assayed by immunoprecipitating PLC
and GIT1 from VSMC lysates. In VSMCs, GIT1, CamK II, and PLC
were present in the same complex as shown by the findings that any one of these proteins coprecipitated the other two proteins (Figure 2C and 2D) if GIT1 was present. This presumed role of GIT1 as a scaffold molecule for CamK II and PLC
was proved using 293 cells, which express no detectable GIT1. In 293 cells transfected with vector control (pcDNA), there was no interaction between CamK II and PLC
(supplemental Figure IV). However, when cells were transfected with GIT1 cDNA coprecipitation of PLC
and CamK II was readily apparent (supplemental Figure IV). The binding of HDAC5 to the calciosome increased in response to Ang II stimulation through binding to CamK II (Figure 2C and 2D, supplemental Figure II). The peak time was at 5 minutes, similar to peak time of HDAC5 phosphorylation. These data suggested that the calciosome is essential for HDAC5 phosphorylation.
Colocalization of GIT1 and CamK II
To further confirm the interaction of GIT1 and CamK II, immunofluorescence experiments were performed. After serum starvation for 24 hours, VSMCs were incubated with Ang II for up to 60 minutes. GIT1 and CamK II location was assayed by immunohistochemistry. In the absence of Ang II, GIT1 distributed across the entire cell (Figure 3A). The localization of CamK II was similar to GIT1 (Figure 3B). This is consistent with a previous report that CamK II
c locates in cytoplasm while CamK II
b is nuclear.8,21 Dual immunofluorescent detection revealed that GIT1 colocalized with CamK II basally (Figure 3C). After administration of Ang II for 5 to 10 minutes, GIT1 translocated to the perinuclear and nuclear area (Figure 3D, G). CamK II also translocated to the perinuclear and nuclear areas (Figure 3E and 3H). GIT1 and CamK II were mostly colocalized during this period (Figure 3F and 3I), consistent with the imunoprecipitation results (Figure 2). From 30 to 60 minutes, both GIT1 and CamK II returned to the cytoplasmic compartment (Figure 3J through 3O). The similar translocation of GIT1 and CamK II suggests a significant functional interaction.
|
Domains of GIT1 That Mediate Interaction With CamK II
GIT1 is composed of an ARF GAP domain, an ankyrin repeat region, 2 carboxyl paxillin-binding subdomains, a SpaII homology domain (SHD), synaptic localization domain (SLD), and 3 putative coiled-coil (CC) domains (Figure 4A). To define the domains responsible for the GIT1-CamK II interaction, we transfected HEK 293 cells with Flag-CamK II and the GIT1 deletion mutants described in methods. Immunoprecipitation of CamK II with anti-Flag antibody coprecipitated GIT1(1–770), GIT1(1–635), but not GIT1(1–420), GIT1(250–770), or GIT1(420–770; Figure 4B and 4C). These results suggest that both the ARF-GAP and CC2 domains are required for GIT1-CamK II interaction because the only GIT1(1–635) has both the ARF-GAP domain and the CC2 domain, whereas the other mutants lack one of the these domains. GIT1 functions as a scaffold for CamK II by binding to CamK II, which is essential for phosphorylation of HDAC5.
|
To determine the functional significance of GIT1 binding with CamK II, HDAC5 phosphorylation induced by Ang II was studied in 293 cells transfected with Flag-CamK II, Xpress-GIT1 or both (note the AT1R was also cotransfected; Figure 5). Overexpression of GIT1 or CamK II alone had no significant effect on HDAC5 phosphorylation (Figure 5A and 5B). However, when both were overexpressed, HDAC5 phosphorylation significantly increased (2.8-fold, Figure 5A and 5B). Based on the finding that the ARF GAP domain and CC2 domain are essential for GIT1 and CamK II interaction, we determined the ability of GIT1 mutants to increase phosphorylation of HDAC5. As shown in Figure 5C and 5D, GIT1 mutants lacking the ARF-GAP domain (eg, GIT1[420–770]) or CC2 domain (eg, GIT1[1–420]) had significantly less effect on phosphorylation of HDAC5 compared with WT GIT1 (P<0.05, Figure 5C and 5D), but still substantial effect on phosphorylation of HDAC5 compared to pcDNA group (P<0.05, Figure 5C and 5D). However in Figure 4 we showed that these mutants could not bind to CamK II. How can the mutants that do not bind to CamK II still induce HDAC5 phosphorylation? Our hypothesis is that these 2 mutants may bind to CamK II through 1 binding site. However, with loss of 1 required binding domain, this binding is much weaker than the binding of GIT1 (WT) or GIT1(1–635) (including required 2 binding domain) to CamK II. This weak interaction is difficult to detect by immunoprecipatation. All these data suggest that GIT1 functions as a scaffold for CamK II, thereby increasing phosphorylation of HDAC5.
|
GIT1 Is Required for Ang II-Induced MEF2 Transcriptional Activity in VSMCs
In the nucleus, HDAC5 associates with the myocyte enhancer factor-2 (MEF2), which represses MEF2 transcriptional activity.22,23 To determine the role of GIT1 in HDAC5-mediated regulation of MEF2 transcriptional activation in VSMCs, we transfected VSMCs with a 3x MEF2-luciferase reporter plasmid and myc-HDAC5 WT. We then determined the effect of decreasing GIT1 expression with GIT1 siRNA on MEF2 activity. Ang II significantly increased MEF2 transcriptional activity in VSMCs (Figure 6), which was decreased by knockdown of GIT1 (Figure 6).
|
| Discussion |
|---|
|
|
|---|
, and CamK II (supplemental Figure V). Our results suggest that GIT1, via its multi-domain scaffolding function, coordinates Ang II signaling events that control calcium-dependent signaling (PLC
and CamK II).
The focus of the present study is on CamK II which is a family of cytosolic serine/threonine protein kinases that exist as multimers consisting of
, β,
, or
subunits, each encoded by a different gene.24,25 Whereas CamK II
and β are mainly expressed in neuronal tissues, CaMKII
b, CaMKII
c, and CaMKII
are abundant in the heart8,21,26 and VSMCs.27 CaMKII can phosphorylate type II HDACs.11 These HDACs (HDAC 4, 5, 7, and 9) normally repress transcriptional activity (eg, activation driven by MEF2) and favor condensed DNA. When HDAC is phosphorylated in response to neurohumoral stimuli, it is exported from the nucleus (in association with the chaperone protein 14-3-3), MEF2 is derepressed, and a hypertrophic program of gene expression is activated.28 Indeed, genetic knockout of HDAC5 results in marked cardiac hypertrophy.14,15 Ang II is an important cardiovascular hormone that induces cardiomyocyte and VSMC hypertrophy.3,29,30
Here we investigated the role of HDAC5 phosphorylation in MEF2 activation induced by Ang II. Ang II rapidly induces phosphorylation of HDAC5 in rat VSMCs, with a peak at 5 minutes. In VSMCs, Ang II binding to the AT1R activates c-Src. c-Src phosphorylates GIT1, which is bound to PLC
in a complex under basal conditions. Conformational changes in GIT1 induced by Src-dependent tyrosine phosphorylation lead to the activation of PLC
. Activation of PLC
is responsible for elevation of intracellular calcium, which results in the autophosphorylation of CamK II. Activation of CamK II causes HDAC5 phosphorylation and changes in target gene expression. Data to support this pathway include the finding that knockdown of GIT1 by siRNA significantly inhibited phosphorylation of HDAC5. Furthermore, DN-Src adenovirus infection, Src inhibitor PP2, PLC
inhibition, and CamK II inhibition decreased phosphorylation of HDAC5 induced by Ang II. These data show that GIT1 plays an important role in HDAC5-dependent signaling by regulating the activation of PLC
.
We previously showed that GIT1 acted as a scaffold protein for the MEK1-ERK1/2 pathway. Specifically GIT1 exhibits 4 scaffold characteristics4,31 including (1) assembly of specific modules; (2) excluding (or insulating) other molecules; (3) promoting sequential activation of enzymes by physical interaction; and (4) providing feedback regulation of cell surface receptors. Here we show that GIT1 acts as a scaffold protein for CamK II. The interaction of GIT1 and CamK II was constitutive and increased after Ang II stimulation. The interaction of GIT1 and CamK II was further confirmed by immunofluorescence colocalization. Both GIT1 and CamK II (CamK II
b or CamK II
c) translocated from cytoplasm to nucleus in a similar manner after stimulation with Ang II. In contrast, there was no direct interaction between GIT1 and HDAC5, nor between PLC
and CamK II. Rather GIT1 acts as a scaffold protein to assemble a "calcium signaling complex" (eg, "Calciosome"), which includes PLC
as well as CamK II. This complex facilitates phosphorylation of HDAC5 by CamK II. Although it has been reported that PLC
translocates to the nucleus in VSMCs,32 it is unclear how this complex could translocate from cytoplasm to nucleus.
GIT1 is composed of an ARF GAP domain, an ankyrin repeat region, 2 carboxyl paxillin-binding subdomains, a SpaII homology domain (SHD), and 3 putative coiled-coil (CC) domains. The ARF-GAP domain has been shown to be functionally important for endocytosis.33 The CC2 region is important for interactions with PAK,34 the CC3 region (including residues 646 to 770) is essential for interactions with paxillin,35 and the SHD region overlaps with binding sites defined for FAK and PIX.35 The domains of GIT1 required for CamK II interaction are located in the N-terminal ARF GAP domain and CC2 domains. Although binding of CamK II to GIT1 is constitutive, it appears that specific conformational changes occur in GIT1 or CamK II in response to tyrosine phosphorylation of GIT1 that enable GIT1 (and CamK II) translocation to the nucleus. It is likely that dephosphorylation contributes to export from the nucleus.
Recently it was reported that Ang II-dependent phosphorylation of HDAC5 in VSMCs is through a PKC and PKD pathway that is resistant to the calcium chelator BAPTA/AM as well as CaMK inhibitors KN93 and KN62.36 Our data suggest that GIT1 and CamK II play an essential role in phosphorylation of HDAC5, possibly independent of the PKC-PKD signal pathway. The discrepancy regarding the role of calcium and CamK II could be attributable to different cell conditions and experimental procedures.
In summary, we have demonstrated that HDAC5 is phosphorylated in rat VSMCs by Ang II via a pathway that involves PLC
and CamK II. We also found that GIT1 and HDAC5 are involved in Ang II-stimulated MEF2 transcriptional activity (supplemental Figure V). These findings suggest novel roles for GIT1 and HDAC5 in Ang II signaling in VSMCs.
| Acknowledgments |
|---|
This work was supported by grants from the NIH (HL63462 to B.C.B., HL77789 to C.Y.), and AHA EIA 0740021N to C.Y.
Disclosures
None.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Berk BC. Angiotensin II signal transduction in vascular smooth muscle: pathways activated by specific tyrosine kinases. J Am Soc Nephrol. 1999; 10 Suppl 11: S62–S68.[Medline] [Order article via Infotrieve]
3. Berk BC, Haendeler J, Sottile J. Angiotensin II, atherosclerosis, and aortic aneurysms. J Clin Invest. 2000; 105: 1525–1526.[Medline] [Order article via Infotrieve]
4. Hoefen RJ, Berk BC. The multifunctional GIT family of proteins. J Cell Sci. 2006; 119: 1469–1475.
5. Haendeler J, Yin G, Hojo Y, Saito Y, Melaragno M, Yan C, Sharma VK, Heller M, Aebersold R, Berk BC. GIT1 mediates Src-dependent activation of phospholipase Cgamma by angiotensin II and epidermal growth factor. J Biol Chem. 2003; 278: 49936–49944.
6. Yin G, Haendeler J, Yan C, Berk BC. GIT1 functions as a scaffold for MEK1-extracellular signal-regulated kinase 1 and 2 activation by angiotensin II and epidermal growth factor. Mol Cell Biol. 2004; 24: 875–885.
7. Yin G, Zheng Q, Yan C, Berk BC. GIT1 is a scaffold for ERK1/2 activation in focal adhesions. J Biol Chem. 2005; 280: 27705–27712.
8. Ginnan R, Singer HA. CaM kinase II-dependent activation of tyrosine kinases and ERK1/2 in vascular smooth muscle. Am J Physiol Cell Physiol. 2002; 282: C754–C761.
9. Van Riper DA, Schworer CM, Singer HA. Ca2+-induced redistribution of Ca2+/calmodulin-dependent protein kinase II associated with an endoplasmic reticulum stress response in vascular smooth muscle. Mol Cell Biochem. 2000; 213: 83–92.[CrossRef][Medline] [Order article via Infotrieve]
10. Kuo MH, Allis CD. Roles of histone acetyltransferases and deacetylases in gene regulation. Bioessays. 1998; 20: 615–626.[CrossRef][Medline] [Order article via Infotrieve]
11. McKinsey TA, Zhang CL, Lu J, Olson EN. Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation. Nature. 2000; 408: 106–111.[CrossRef][Medline] [Order article via Infotrieve]
12. McKinsey TA, Zhang CL, Olson EN. Activation of the myocyte enhancer factor-2 transcription factor by calcium/calmodulin-dependent protein kinase-stimulated binding of 14-3-3 to histone deacetylase 5. Proc Natl Acad Sci U S A. 2000; 97: 14400–14405.
13. Vega RB, Harrison BC, Meadows E, Roberts CR, Papst PJ, Olson EN, McKinsey TA. Protein kinases C and D mediate agonist-dependent cardiac hypertrophy through nuclear export of histone deacetylase 5. Mol Cell Biol. 2004; 24: 8374–8385.
14. Zhang CL, McKinsey TA, Chang S, Antos CL, Hill JA, Olson EN. Class II histone deacetylases act as signal-responsive repressors of cardiac hypertrophy. Cell. 2002; 110: 479–488.[CrossRef][Medline] [Order article via Infotrieve]
15. Chang S, McKinsey TA, Zhang CL, Richardson JA, Hill JA, Olson EN. Histone deacetylases 5 and 9 govern responsiveness of the heart to a subset of stress signals and play redundant roles in heart development. Mol Cell Biol. 2004; 24: 8467–8476.
16. Wu X, Zhang T, Bossuyt J, Li X, McKinsey TA, Dedman JR, Olson EN, Chen J, Brown JH, Bers DM. Local InsP3-dependent perinuclear Ca2+ signaling in cardiac myocyte excitation-transcription coupling. J Clin Invest. 2006; 116: 675–682.[CrossRef][Medline] [Order article via Infotrieve]
17. Melaragno MG, Wuthrich DA, Poppa V, Gill D, Lindner V, Berk BC, Corson MA. Increased expression of Axl tyrosine kinase after vascular injury and regulation by G protein-coupled receptor agonists in rats. Circ Res. 1998; 83: 697–704.
18. Caplice NM, Bunch TJ, Stalboerger PG, Wang S, Simper D, Miller DV, Russell SJ, Litzow MR, Edwards WD. Smooth muscle cells in human coronary atherosclerosis can originate from cells administered at marrow transplantation. Proc Natl Acad Sci U S A. 2003; 100: 4754–4759.
19. Backs J, Song K, Bezprozvannaya S, Chang S, Olson EN. CaM kinase II selectively signals to histone deacetylase 4 during cardiomyocyte hypertrophy. J Clin Invest. 2006; 116: 1853–1864.[CrossRef][Medline] [Order article via Infotrieve]
20. Ishida M, Ishida T, Thomas S, Berk BC. Activation of extracellular signal-regulated kinases (ERK1/2) by angiotensin II is dependent on c-Src in vascular smooth muscle cells. Circ Res. 1998; 82: 7–12.
21. Hoch B, Meyer R, Hetzer R, Krause EG, Karczewski P. Identification and expression of delta-isoforms of the multifunctional Ca2+/calmodulin-dependent protein kinase in failing and nonfailing human myocardium. Circ Res. 1999; 84: 713–721.
22. McKinsey TA, Kuwahara K, Bezprozvannaya S, Olson EN. Class II histone deacetylases confer signal responsiveness to the ankyrin-repeat proteins ANKRA2 and RFXANK. Mol Biol Cell. 2006; 17: 438–447.
23. Berger I, Bieniossek C, Schaffitzel C, Hassler M, Santelli E, Richmond TJ. Direct interaction of Ca2+/calmodulin inhibits histone deacetylase 5 repressor core binding to myocyte enhancer factor 2. J Biol Chem. 2003; 278: 17625–17635.
24. Hudmon A, Schulman H. Structure-function of the multifunctional Ca2+/calmodulin-dependent protein kinase II. Biochem J. 2002; 364: 593–611.[CrossRef][Medline] [Order article via Infotrieve]
25. Tombes RM, Faison MO, Turbeville JM. Organization and evolution of multifunctional Ca(2+)/CaM-dependent protein kinase genes. Gene. 2003; 322: 17–31.[CrossRef][Medline] [Order article via Infotrieve]
26. Colomer JM, Mao L, Rockman HA, Means AR. Pressure overload selectively up-regulates Ca2+/calmodulin-dependent protein kinase II in vivo. Mol Endocrinol. 2003; 17: 183–192.
27. Schworer CM, Rothblum LI, Thekkumkara TJ, Singer HA. Identification of novel isoforms of the delta subunit of Ca2+/calmodulin-dependent protein kinase II. Differential expression in rat brain and aorta. J Biol Chem. 1993; 268: 14443–14449.
28. Olson EN, Schneider MD. Sizing up the heart: development redux in disease. Genes Dev. 2003; 17: 1937–1956.
29. Watanabe T, Barker TA, Berk BC. Angiotensin II and the Endothelium: Diverse Signals and Effects. Hypertension. 2005; 45: 163–169.
30. Dikalova A, Clempus R, Lassegue B, Cheng G, McCoy J, Dikalov S, San Martin A, Lyle A, Weber DS, Weiss D, Taylor WR, Schmidt HH, Owens GK, Lambeth JD, Griendling KK. Nox1 overexpression potentiates angiotensin II-induced hypertension and vascular smooth muscle hypertrophy in transgenic mice. Circulation. 2005; 112: 2668–2676.
31. Claing A, Perry SJ, Achiriloaie M, Walker JK, Albanesi JP, Lefkowitz RJ, Premont RT. Multiple endocytic pathways of G protein-coupled receptors delineated by GIT1 sensitivity. Proc Natl Acad Sci U S A. 2000; 97: 1119–1124.
32. Egan CG, Wainwright CL, Wadsworth RM, Nixon GF. PDGF-induced signaling in proliferating and differentiated vascular smooth muscle: effects of altered intracellular Ca2+ regulation. Cardiovasc Res. 2005; 67: 308–316.
33. Claing A, Chen W, Miller WE, Vitale N, Moss J, Premont RT, Lefkowitz RJ. beta-Arrestin-mediated ADP-ribosylation factor 6 activation and beta 2-adrenergic receptor endocytosis. J Biol Chem. 2001; 276: 42509–42513.
34. Turner CE, Brown MC, Perrotta JA, Riedy MC, Nikolopoulos SN, McDonald AR, Bagrodia S, Thomas S, Leventhal PS. Paxillin LD4 motif binds PAK and PIX through a novel 95-kD ankyrin repeat, ARF-GAP protein: A role in cytoskeletal remodeling. J Cell Biol. 1999; 145: 851–863.
35. Zhao ZS, Manser E, Loo TH, Lim L. Coupling of PAK-interacting exchange factor PIX to GIT1 promotes focal complex disassembly. Mol Cell Biol. 2000; 20: 6354–6363.
36. Xu X, Ha CH, Wong C, Wang W, Hausser A, Pfizenmaier K, Olson EN, McKinsey TA, Jin ZG. Angiotensin II stimulates protein kinase D-dependent histone deacetylase 5 phosphorylation and nuclear export leading to vascular smooth muscle cell hypertrophy. Arterioscler Thromb Vasc Biol. 2007; 27: 2355–2362.
This article has been cited by other articles:
![]() |
H. Li, W. Li, A. K. Gupta, P. J. Mohler, M. E. Anderson, and I. M. Grumbach Calmodulin kinase II is required for angiotensin II-mediated vascular smooth muscle hypertrophy Am J Physiol Heart Circ Physiol, February 1, 2010; 298(2): H688 - H698. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2008 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |