Published online before print February 14, 2008, doi: 10.1161/ATVBAHA.107.160903
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2008 American Heart Association, Inc.
Cell Biology/Signaling |
C-Reactive Protein Enhances Tissue Factor Expression by Vascular Smooth Muscle Cells
Mechanisms and In Vivo Significance
From the Department of Internal Medicine, University of Missouri School of Medicine, and Research Service, Harry S. Truman Memorial Veterans Affairs Hospital, Columbia, MO.
Correspondence to Jianbo Wu, MD, PhD, University of Missouri, MC314 McHaney Hall, One Hospital Drive DC095.00, Columbia, Missouri 65212. E-mail wuji{at}health.missouri.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Objective— We examined the impact of C-reactive protein (CRP) on vascular smooth muscle cell (VSMC) expression of tissue factor (TF) and TF pathway inhibitor (TFPI).
Methods and Results— TF mRNA, protein, and activity levels were significantly higher in VSMCs isolated from CRP-transgenic (Tg) mice than from wild-type (WT) mice. TFPI expression was significantly downregulated in CRP-Tg versus WT VSMCs. Transfection of human VSMCs with CRP expression plasmid significantly increased TF expression and decreased TFPI expression. Gene silencing of Fc
receptor IIIa (FcRIIIa) blocked the effect of CRP on VSMC TF expression. CRP activated p44/42, but not p38 or JNK MAP kinase (MAPK), and the effect of CRP on TF expression was blocked by pharmacological inhibitor of p44/42, but not p38 or JNK MAPK. Reactive oxygen species (ROS) scavengers blocked CRP-induced upregulation of VSMC TF expression. In vivo analyses revealed significant increases in TF expression and decreases in TFPI expression in carotid arteries of CRP-Tg mice versus WT mice.
Conclusion— CRP increases TF and decreases TFPI expression by VSMCs in vitro and in vivo. Induction of TF expression by CRP is mediated by FcRIIIa, p44/42 MAPK, and ROS generation. These data offer important insights into the role of CRP in the pathogenesis of arterial thrombosis.
We show that upregulation of C-reactive protein (CRP) expression increases tissue factor (TF) expression while decreasing TF pathway inhibitor expression in vascular smooth muscle cells, both in vitro and in vivo. Induction of TF expression by CRP is mediated by Fc receptor IIIa, p44/42 MAP kinase, and reactive oxygen species generation.
Key Words: C-reactive protein • tissue factor • VSMC • thrombosis
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Elevated plasma levels of C-reactive protein (CRP) are independently associated with increased risk of myocardial infarction (MI).1 Several studies suggest that CRP is not simply a risk marker but also a contributing factor to vascular disease.2–5 However, CRP promotes atherosclerotic plaque formation only weakly or not at all in animal models,6–8 and plasma CRP levels correlate poorly with atherosclerotic plaque burden in humans,9,10 suggesting that CRP triggers ischemic vascular events by mechanisms other than by accelerating plaque formation. Thrombosis plays a critical role in the pathogenesis of MI and stroke. Injection of highly purified CRP into humans activates the blood coagulation system.11 Therefore, CRP may trigger clinical ischemic events by promoting thrombosis.
See accompanying article on page 601
Tissue factor (TF), a critical initiator of blood clotting, is present in atherosclerotic plaque and triggers thrombosis after plaque rupture.12 CRP is also present in atherosclerotic plaque, because of deposition from plasma and local synthesis by vascular smooth muscle cells (VSMCs) and macrophages.13 CRP stimulates TF expression by cultured VSMCs.14 Therefore, CRP-induced TF expression by VSMCs may promote thrombosis after endothelial disruption. However, the literature regarding the effects of CRP on vascular cells is controversial. Although several studies demonstrated that CRP induced pathological changes in vascular cells,2–4,15 others suggested that contaminants present in CRP preparations, such as sodium azide and lipopolysaccharide (LPS), rather than CRP itself, mediated cell activation.16–18 Furthermore, studies examining the impact of CRP on TF expression by VSMCs and other cell types have been conducted exclusively in vitro. In vivo experiments examining the effects of endogenously generated CRP, as well as in vitro experiments devoid of potential contaminating substances, are necessary to adequately examine the role of CRP in stimulating TF expression by VSMCs. Mice carrying a human CRP transgene exhibit accelerated thrombosis and increased intimal hyperplasia after vascular injury.19,20 The goals of this study were to examine the impact of CRP on TF expression by VSMCs in vitro and in vivo in CRP-transgenic (Tg) mice, and to identify mechanisms by which CRP stimulates VSMC TF expression. We also examined the effect of CRP on tissue factor pathway inhibitor (TFPI) expression by VSMCs.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mice
C57BL/6J mice were from Jackson Labs. C57BL/6-congenic CRP-transgenic (CRP-Tg) mice were a gift from Alexander J. Szalai, PhD, University of Alabama at Birmingham.21
Reagents
SP600125 (specific inhibitor of Jun N-terminal kinase [JNK]), was from EMD Biosciences. U0126 (specific inhibitor of MAPK/extracellular signal regulated kinase (ERK) kinase [MEK1/2]) and SB203580 (specific inhibitor of p38 MAPK) were from Calbiochem. Purified human recombinant CRP (Trichem Resources) was dialyzed extensively against 0.1 mmol/L Tris-HCl, pH 7.5, containing 0.2 mmol/L NaCl, 2 mmol/L CaCl2, and passed over Detoxigel (Pierce). Endotoxin concentration in CRP preparations was <0.06 endotoxin units/mL. N-acetylcysteine (NAC) and pyrrolidine dithiocarbamate (PDTC) were from Sigma.
Cell Culture
VSMCs were isolated from aortas of male mice22 and cultured in DMEM containing 10% fetal calf serum. Cells passaged 5 to 9 times were used. Human coronary artery VSMCs were cultured in serum-containing medium provided by the supplier (Cascade). Cells passaged 3 to 6 times were used.
Cell Transfection
Full-length human CRP cDNA (GeneCopoeia) was restricted with NspV and XhoI, and ligated into pReceiver-M03 plasmid (GeneCopoeia), immediately 5' to green fluorescent protein (GFP) cDNA, allowing expression of CRP as a fusion protein with C-terminal GFP (CRP-GFP plasmid). Human VSMCs were transfected with CRP-GFP or GFP (ie, pReceiver-M03, negative control) plasmid using Effectene transfection reagent (Qiagen).
Analysis of Gene Transcription
Total RNA was extracted from cells using TRIzol reagent (Invitrogen) and digested with DNase I (Ambion). Reverse transcriptase (RT)-polymerase chain reaction (PCR) was performed using SuperScript 1-step RT-PCR (Invitrogen). Oligonucleotide primers were: (1) human CRP (AGCCTCTCTCATGCTTTTGG, TGTCTCTTGGTGGCATACGA); (2) murine TF (GAAGGATGTGACCTGGGCC, TACCATTCTTTCTGACTAA); (3) murine TFPI (AATCAACGGCAAACTGACCAACCC, TCGGGAACAAGGCTAAGCAACAGA); (4) human Fc receptor (FcR) Ia (ATGTGGTTCTTGACAACTCTGCTC, ATGTCTGTCTTCTTGAAGGCTGGA; (5) FcRIIa (GACTCCATTCAGTGGTTCCA, GTCAGCTGTTTCATAGTCATTG); (6) FcRIIb (GACTCCATTCAGTGGTTCCA, CCCAACTTTGTCAGCCTCATC); and (7) FcRIIIa (AAGATCTCCCAAAGGCTGTG, ATGGACTTCTAGCTGCACCG).23 Positive control reactions with human leukocyte RNA (Clontech) demonstrated function of all FcR primer pairs. 18S RNA was amplified using universal 18S primer pair (Ambion). Band intensity of RT-PCR products was quantified using Fluochem 8800 Imaging system (Aloha Innotech).
Gene Silencing Experiments
Nearly confluent VSMCs were transfected with siRNA duplexes (5 nmol/L) directed against human FcRIIa (GAGAAGACUCUGGGUUAUAdTdT, UAUAACCCAGAGUCUUCUCdTdT), FcRIIIa (GAGACUGGAAGGACCAUAAdTdT, UUAUGGUCCUUCCAGUCUCdTdT), or with negative control siRNA (Qiagen), using HiPerFect reagent (Qiagen), or with RNA duplexes directed against human p42 and p44 MAPK or negative control siRNA (Cell Signaling), according to manufacturer’s instructions.
Measurement of TF and TFPI Antigen and Activity
Cell Culture
To measure total cell TF activity, VSMCs were lysed with RIPA buffer (Sigma). Equal amounts of cell lysates were added to 96-well microtiter plates containing human factor VIIa (3 nmol/L), human factor X (100 nmol/L, Hematologic Technologies), 8.3 mmol/L CaCl2, and Spectrozyme fXa (0.33 mmol/L, American Diagnostica). After 45 minutes the absorbance of the reaction mixture at 405 nm (A405) was measured. To measure cell surface TF activity, washed VSMCs were overlaid with the above-described reaction mixture. After 45 minutes at 37°C A405 of the reaction mixture was measured. TF activity was determined from a standard curve constructed from recombinant human TF (American Diagnostica). Results are displayed as ratio of activities of experimental/control cells. Chromogenic substrate hydrolysis was negligible if factors VIIa or X were omitted. To measure secreted TFPI antigen and activity, conditioned media (CM) were collected, centrifuged to remove cells, and analyzed with Imubind TFPI ELISA and Actichrome TFPI activity assays (American Diagnostica).
Tissue
Carotid arteries were homogenized in 50 mmol/L Tris-HCl, pH 8.0. Protein concentration of centrifuged extracts was determined with BCA reagent (Pierce). TF activity was measured using Actichrome TF activity assay (American Diagnostica). TFPI activity was measured as described for VSMCs.
Immunohistochemistry
Cell Culture
VSMCs were cultured on glass slides, washed, fixed, permeabilized, and blocked.24 Mouse VSMCs were incubated with rabbit IgG raised against human CRP (Santa Cruz Biotechnology) and sheep IgG raised against rabbit TF (which cross-reacts with mouse TF; American Diagnostica). After washing, slides were incubated with fluorescein isothiocyanate (FITC)-conjugated rabbit IgG raised against sheep IgG and Texas-Red-conjugated goat IgG raised against rabbit IgG (Vector Laboratories). Negative controls lacked primary antibodies. Slides were washed and incubated with 4',6-diamidino-2-phenylindole (DAPI). Human VSMCs were incubated with mouse IgG raised against human TF or mouse IgG raised against human TFPI (American Diagnostica), followed by incubation with Texas-Red-conjugated horse IgG raised against mouse IgG (Vector Laboratories).
Tissue
Carotid artery cross-sections (5 µm) were mounted on glass slides. To detect TF, slides were blocked with BSA and incubated with rabbit IgG raised against mouse TF (American Diagnostica). Negative controls were incubated without primary antibody. Secondary antibody was biotinylated goat IgG raised against rabbit IgG (Santa Cruz Biotechnology). Washed slides were incubated with Vectastain Elite ABC reagent (Vector Laboratories), developed using DAB substrate (Vector Laboratories), and counterstained with methyl green. To detect VSMCs and TFPI, carotid artery cross-sections were incubated with mouse monoclonal IgG raised against smooth muscle 
-actin (Clone 1A4, Sigma-Aldrich) and rabbit IgG raised against mouse TFPI (American Diagnostica). Washed slides were incubated with FITC-conjugated goat IgG raised against mouse IgG and Texas-Red–conjugated goat IgG raised against rabbit-IgG (Vector Laboratories). Slides were examined with a Zeiss LSM 510 2-photon confocal system. Immunostaining conditions and imaging settings were identical for all directly compared cells and tissues. All images shown in figure are representative of at least triplicate experiments.
Other Assays
Western blotting was performed by subjecting VSMC lysates (25 µg total protein) to SDS-PAGE. After transfer and blocking, membranes were incubated with rabbit IgG raised against phosphorylated and nonphosphorylated forms of p44/42, p38, and Jun–amino-terminal kinase (JNK) (Cell Signaling). Secondary antibody was horseradish-peroxidase–conjugated goat IgG raised against rabbit IgG (Santa Cruz Biotechnology). Blots were developed with ECL substrate (Pierce). Reactive oxygen species (ROS) production in VSMC lysates was measured as described.25
Statistical Analysis
Data are expressed as mean±SEM of at least triplicate experiments. Groups were compared using Student 2-tailed t test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CRP Upregulates TF Expression by VSMCs
To examine the impact of CRP on VSMC TF expression, we cultured VSMCs from wild-type (WT) mice and CRP-Tg mice. Immunofluorescence revealed significant increase in CRP expression in CRP-Tg VSMCs compared to WT VSMCs (Figure 1A, panel c versus g). TF mRNA levels, assessed by RT-PCR, were 2.5±0.1-fold higher in CRP-Tg VSMCs than in WT VSMCs (n=3/group, P<0.05, Figure 1B and 1C). Immunofluorescense analysis confirmed greater expression of TF in CRP-Tg VSMCs compared to WT VSMCs (Figure 1A, panel d versus h), cell surface TF activity was significantly greater for CRP-Tg cells than for WT cells (Figure 1D). We also examined the effect of CRP on human VSMC TF expression. Cultured human VSMCs were transfected with CRP-GFP or GFP. Nontransfected VSMCs served as an additional control. TF activity was significantly higher in cells expressing CRP-GFP (2.61±0.38 pmol/L per 105 cells) compared to cells expressing only GFP and nontransfected cells (2.03±0.19 and 1.66±0.28 pmol/L per 105 cells, respectively, P<0.05 versus CRP-GFP group). Immunofluorescence confirmed that transfection efficiency was indistinguishable between groups (data not shown).
|
Fc-Receptor IIIa Mediates Induction of TF Expression by CRP
We examined mechanisms of induction of TF expression by CRP. Because FcRs have been implicated in cell activation by CRP,3,26 we studied expression of FcR Ia, IIa, IIb, and IIIa by RT-PCR. We found low-level expression of FcRIIa and FcRIIIa in human VSMCs under basal culture conditions, but did not detect expression of FcRIa or FcRIIb (Figure 2A). After demonstrating that exogenous CRP induced TF expression in VSMCs (Figure 2B), we examined the effect of FcR gene silencing on CRP-induced TF expression. Human VSMCs, not transfected or transfected with control, FcRIIa, or FcRIIIa siRNA were grown 48 hours. CRP (50 µg/mL) or vehicle control was added to CM. Six hours later TF activity of cell lysates was measured. Only siRNA specific for FcRIIIa significantly inhibited TF expression (Figure 2B). RT-PCR analysis confirmed that FcRIIa and FcRIIIa siRNAs knocked-down expression of the intended gene (Figure 3C), without affecting expression of other FcRs (data not shown).
|
0.2. C, RT-PCR analysis of siRNA knock-down of Fc
|
p44/42 MAPK Pathway Mediates Induction of VSMC TF Expression by CRP
CRP induces MAPK pathway activation in VSMCs.14 To determine the role of MAPK activation in the induction of TF expression by CRP, we transfected human VSMCs with CRP-GFP or GFP and cultured cells, as well as nontransfected VSMCs, for 18 hours in media containing or lacking U0126 (10 µmol/L), SB203580 (0.1 µmol/L), or SP600125 (5 µmol/L). Cells lysates were prepared and subjected to Western blotting, using antibodies against p44/42, p38, and JNK MAPK. Compared to nontransfected cells, transfection of VSMCs with CRP-GFP significantly increased p44/42 phosphorylation, whereas p44/42 phosphorylation was unaffected in VSMCs transfected with GFP (Figure 3A). In VSMCs transfected with CRP-GFP, U0126 completely blocked p44/42 phosphorylation (Figure 3A). Conversely, transfection of VSMCs with CRP-GFP did not induce phosphorylation of p38 or JNK (Figure 3A; control experiments, not shown, demonstrated that antibodies recognized phosphorylated forms of p38 and JNK in positive control cell extracts [Cell Signaling]). Consistent with these data, addition of CRP (50 µg/mL) to CM of human VSMCs induced phosphorylation of p44/42, with levels peaking by 5 minutes after initial exposure (Figure 3B), but not of p38 or JNK (data not shown), and p44/42 phosphorylation was increased in murine CRP-TG VSMCs versus WT VSMCs (Figure 3C). To determine whether p44/42 activation triggered TF expression, human VSMCs, either nontransfected or transfected with CRP-GFP, were grown 18 hours in presence of U0126, SB203580, SP600125, or vehicle control, after which cell lysate TF activity was measured, with results normalized to those of nontransfected, vehicle-treated cells. U0126 blocked induction of TF activity by CRP, whereas SB203580 and SP600125 had no effect (Figure 4A). To determine whether p44/42 gene silencing blocked CRP-induced upregulation of TF activity, human VSMCs were transfected with p44/42 siRNAs or control siRNA. After 24 hours, cells were transfected with CRP-GFP. Control VSMCs, not transfected with siRNA or CRP-GFP, were grown in parallel. After 24 hours, cells were lysed and TF activities, normalized to activity of control VSMCs, were measured. Transfection of VSMCs with p44/42 siRNAs significantly inhibited TF activity and phospho-p44/42 expression, as assessed by Western blotting (Figure 4B).
|
Induction of TF in VSMCs by CRP Involves Oxidative Stress
Transfection of VSMCs with CRP-GFP induced ROS generation (supplemental Figure IA), results consistent with another study.27 To determine whether ROS contribute to induction of TF expression by CRP, we added NAC (10 mmol/L) or PDTC (100 µmol/L) to CM of human VSMCs 30 minutes before transfecting cells with CRP-GFP. ROS scavengers significantly inhibited induction of TF activity by CRP (supplemental Figure IB), suggesting that CRP-induced TF activity involves generation of ROS. Neither NAC nor PDTC inhibited TF procoagulant activity (data not shown).
CRP Increases TF Expression In Vivo
To determine whether CRP increased VSMC TF expression in vivo, we analyzed carotid arteries of WT mice and CRP-Tg mice. Arterial TF mRNA (normalized to 18S) levels were increased 3.1±0.3-fold in CRP-Tg mice versus WT mice (P<0.05, Figure 5A). Immunohistochemistry revealed that TF expression was increased in the media of CRP-Tg mice (n=3) compared to WT mice (n=3; Figure 5B). TF activity was significantly greater in carotid artery extracts of CRP-Tg mice than those of WT mice (Figure 5C).
|
CRP Decreases Vascular Wall TFPI Expression
Mean TFPI activity was significantly lower in CM of CRP-Tg VSMCs (0.041±0.004 U/mg protein) than in those of WT VSMCs (0.059±0.003 U/mg protein, P<0.05). Compared to negative controls, transfection of human VSMCs with CRP-GFP led to significant decreases in TFPI antigen (Figure 6A and 6B) and activity (Figure 6C). Inhibition of MEK1/2 with U0126 abolished CRP-induced downregulation of TFPI activity (Figure 6C). TFPI mRNA, assessed by RT-PCR and normalized to 18S RNA, was significantly decreased in arteries of CRP-Tg mice (0.68±0.01, n=3) compared to WT mice (0.85±0.02, n=3, P<0.01). Immunofluorescence revealed colocalization of TFPI with medial VSMCs of WT mice, and decreased TFPI expression in medial VSMCs of CRP-Tg mice (Figure 6D). TFPI activity of arterial extracts was significantly lower for CRP-Tg mice (0.1±0.01 U/mg protein, n=6) than for WT mice (0.18±0.01 U/mg protein, n=6, P<0.05).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our study demonstrates the CRP induces TF expression by VSMCs under conditions in which sodium azide and bacterial endotoxin, which can contaminate CRP preparations and induce artifact,16–18 were not present. We also showed that the effect of CRP on VSMC TF expression occurs in vivo in response to endogenously expressed CRP, and that CRP suppresses VSMC TFPI expression, both in vitro and in vivo. The ability of CRP to enhance TF expression, while suppressing expression of its major inhibitor, would be expected to promote thrombosis triggered by endothelial denudation. In conjunction with studies suggesting that CRP does not promote atherosclerotic plaque growth,6–10 and the observation that CRP-Tg mice exhibit accelerated thrombosis,19 our results support the hypothesis that CRP promotes thrombosis by increasing net arterial wall TF activity. TF-deficient mice exhibit attenuated VSMC migration and intimal hyperplasia after vascular injury.28 Therefore, CRP-induced increases in TF expression could also promote intimal hyperplasia. Consistent with this hypothesis, CRP-Tg mice exhibit increased intimal hyperplasia after carotid artery ligation.20
Our study offers mechanistic insights into how CRP induces VSMC TF expression. Our data suggest that FcRIIIa (CD16), a cell surface IgG Fc receptor, is expressed by VSMCs, results consistent with a recently published study.29 Furthermore, our siRNA experiments suggest that FcRIIIa mediates CRP-induced upregulation of TF expression. Devaraj et al demonstrated that FcRIa and FcRIIa, but not FcRIIIa, mediate activation of human aortic endothelial cells by CRP (though this group did not examine endothelial cell TF expression).3 Therefore, there may be heterogeneity in the receptors involved in CRP-induced activation of different types of vascular wall cells. We observed that FcRIIa is expressed by human VSMCs, results consistent with another study,27 but did not find evidence that FcRIIa mediates upregulation of TF expression by CRP. Furthermore, mice do not express FcRIIa,30 also supporting the conclusion that FcRIIa does not mediate the upregulation of TF expression in VSMCs by CRP, at least in mice. A previous study suggested that CRP induces activation of extracellular signal-regulated protein kinase (ERK1/2) in VSMCs.14 However, the CRP used in these experiments may have contained sodium azide, and a cause-and-effect relationship between ERK1/2 activation and TF expression was not assessed. Our data suggest that CRP induces VSMC TF expression via p44/42, but not via the p38 or JNK components of the MAPK pathway. These results clarify the intracellular signaling pathways involved in CRP-induced TF expression in VSMCs. Our studies also suggest that CRP induces TF expression in VSMCs via ROS generation, though our data do not define specific mechanisms by which ROS trigger VSMC TF expression. A study involving macrophages suggested that antioxidants inhibit TF expression by impairing translation or causing protein degradation.31 A recent study found that succinobucol, which possesses antioxidant properties, inhibits endotoxin-mediated induction of TF in monocytic and endothelial cells by inhibiting activation of MAPK components and transcription factors AP-1 and Egr-1.32
CRP inhibits TFPI release from cultured endothelial cells,33 but little has been known about the effect of CRP on VSMC TFPI expression, the level of which modulates the thrombotic response to vascular injury.34 Our demonstration that CRP downregulates VSMC TFPI expression in vivo provides another mechanism by which CRP may promote thrombosis. Although we found approximately 3-fold increase in TF mRNA and approximately 50% reduction in TFPI activity in arteries of CRP-Tg mice, the arterial TF activity of CRP-Tg mice was only 2-fold greater than that of WT mice. These observations may be explained by the fact that TF exists in VSMCs in both active and inactive forms. Therefore, the increase in TF activity induced by CRP may be less than that suggested by the increase in TF mRNA levels. It is also possible that enhanced degradation of active TF during extraction from the arterial wall of CRP-Tg mice could result in less than anticipated increase in TF activity.
In conclusion, we demonstrated that CRP induces TF expression and inhibits TFPI expression by VSMCs, that this effect occurs in vivo, and that it occurs independently of contaminating substances that have clouded interpretation of previous studies. Our data suggest that CRP induces TF expression in VSMCs via activation of FcRIIIa and p44/42 MAPK, and by triggering ROS generation. These data identify an important effect of CRP on the vascular wall and help to explain the prothrombotic effects of CRP. They also offer important insights into the role of CRP as a risk factor for MI. Additional studies are warranted to better define the molecular pathways by which CRP modulates TF and TFPI expression in VSMCs and to examine the effect of pharmacological suppression of CRP on TF expression and thrombosis.
|
Acknowledgments |
|---|
Sources of Funding
This work was supported by a Department of Veterans Affairs Merit Award (to W.P.F.) and NHLBI grant HL57346 (to W.P.F.).
Disclosures
None.
|
Footnotes |
|---|
Original received December 12, 2007; final version accepted February 1, 2008.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Ridker PM. High-sensitivity C-reactive protein, inflammation, and cardiovascular risk: from concept to clinical practice to clinical benefit. Am Heart J. 2004; 148: S19–S26.[CrossRef][Medline] [Order article via Infotrieve]
2. Venugopal SK, Devaraj S, Yuhanna I, Shaul P, Jialal I. Demonstration that C-reactive protein decreases eNOS expression and bioactivity in human aortic endothelial cells. Circulation. 2002; 106: 1439–1441.
3. Devaraj S, Du Clos TW, Jialal I. Binding and internalization of C-reactive protein by Fcgamma receptors on human aortic endothelial cells mediates biological effects. Arterioscler Thromb Vasc Biol. 2005; 25: 1359–1363.
4. Devaraj S, Xu DY, Jialal I. C-reactive protein increases plasminogen activator inhibitor-1 expression and activity in human aortic endothelial cells. Circulation. 2003; 107: 398–404.
5. Blaschke F, Bruemmer D, Yin F, Takata Y, Wang W, Fishbein MC, Okura T, Higaki J, Graf K, Fleck E, Hsueh WA, Law RE. C-reactive protein induces apoptosis in human coronary vascular smooth muscle cells. Circulation. 2004; 110: 579–587.
6. Paul A, Ko KWS, Li L, Yechoor V, McCrory MA, Szalai AJ, Chan L. C-reactive protein accelerates the progression of atherosclerosis in apolipoprotein E-deficient mice. Circulation. 2004; 109: 647–655.
7. Hirschfield GM, Gallimore JR, Kahan MC, Hutchinson WL, Sabin CA, Benson GM, Dhillon AP, Tennent GA, Pepys MB. Transgenic human C-reactive protein is not proatherogenic in apolipoprotein E-deficient mice. Proc Natl Acad Sci U S A. 2005; 102: 8309–8314.
8. Trion A, de Maat MPM, Jukema JW, van der Laarse A, Maas MC, Offerman EH, Havekes LM, Szalai AJ, Princen HMG, Emeis JJ. No effect of C-reactive protein on early atherosclerosis development in apolipoprotein E*3-Leiden/human C-reactive protein transgenic mice. Arterioscler Thromb Vasc Biol. 2005; 25: 1635–1640.
9. Zebrack JS, Muhlestein JB, Horne BD, Anderson JL. C-reactive protein and angiographic coronary artery disease: independent and additive predictors of risk in subjects with angina. J Am Coll Cardiol. 2002; 39: 632–637.
10. Khera A, de Lemos JA, Peshock RM, Lo HS, Stanek HG, Murphy SA, Wians FH Jr, Grundy SM, McGuire DK. Relationship between C-reactive protein and subclinical atherosclerosis: The Dallas Heart Study. Circulation. 2006; 113: 38–43.
11. Bisoendial RJ, Kastelein JJP, Levels JHM, Zwaginga JJ, van den Bogaard B, Reitsma PH, Meijers JCM, Hartman D, Levi M, Stroes ESG. Activation of inflammation and coagulation after infusion of C-reactive protein in humans. Circ Res. 2005; 96: 714–716.
12. Marmur JD, Thiruvikraman SV, Fyfe BS, Guha A, Sharma SK, Ambrose JA, Fallon JT, Nemerson Y, Taubman MB. Identification of active tissue factor in human coronary atheroma. Circulation. 1996; 94: 1226–1232.
13. Yasojima K, Schwab C, McGeer EG, McGeer PL. Generation of C-reactive protein and complement components in atherosclerotic plaques. Am J Pathol. 2001; 158: 1039–1051.
14. Cirillo P, Golino P, Calabro P, Cali G, Ragni M, De Rosa S, Cimmino G, Pacileo M, De Palma R, Forte L, Corigliano FG, Angri V, Spagnuolo R, Nitsch L, Chiariello M. C-reactive protein induces tissue factor expression and promotes smooth muscle and endothelial cell proliferation. Cardiovasc Res. 2005; 68: 47–55.
15. Cermak J, Key NS, Bach RR, Balla J, Jacob HS, Vercellotti GM. C-reactive protein induces human peripheral blood monocytes to synthesize tissue factor. Blood. 1993; 82: 513–520.
16. Taylor KE, Giddings JC, van den Berg CW. C-reactive protein-induced in vitro endothelial cell activation is an artefact caused by azide and lipopolysaccharide. Arterioscler Thromb Vasc Biol. 2005; 25: 1225–1230.
17. Liu C, Wang S, Deb A, Nath KA, Katusic ZS, McConnell JP, Caplice NM. Proapoptotic, antimigratory, antiproliferative, and antiangiogenic effects of commercial C-reactive protein on various human endothelial cell types in vitro: Implications of contaminating presence of sodium azide in commercial preparation. Circ Res. 2005; 97: 135–143.
18. Pepys MB, Hawkins PN, Kahan MC, Tennent GA, Gallimore JR, Graham D, Sabin CA, Zychlinsky A, de Diego J. Proinflammatory effects of bacterial recombinant human C-reactive protein are caused by contamination with bacterial products, not by C-reactive protein Itself. Circ Res. 2005; 97: 97–103.[CrossRef]
19. Danenberg HD, Szalai AJ, Swaminathan RV, Peng L, Chen Z, Seifert P, Fay WP, Simon DI, Edelman ER. Increased thrombosis after arterial injury in human C-reactive protein-transgenic mice. Circulation. 2003; 108: 512–515.
20. Wang D, Oparil S, Chen Y, McCrory M, Skibinski G, Feng W, Szalai A. Estrogen treatment abrogates neointima formation in human C-reactive protein transgenic mice. Arterioscler Thromb Vasc Biol. 2005; 25: 2094–2099.
21. Ciliberto G, Arcone R, Wagner EF, Ruther U. Inducible and tissue-specific expression of human C-reactive protein in transgenic mice. EMBO J. 1987; 6: 4017–4022.[Medline] [Order article via Infotrieve]
22. Ray JL, Leach R, Herbert J-M, Benson M. Isolation of vascular smooth muscle cells from a single murine aorta. Meth Cell Sci. 2002; 23: 185–188.
23. Hakonarson H, Grunstein MM. Autologously up-regulated Fc receptor expression and action in airway smooth muscle mediates its altered responsiveness in the atopic asthmatic sensitized state. Proc Natl Acad Sci U S A. 1998; 95: 5257–5262.
24. Szotowski B, Antoniak S, Poller W, Schultheiss HP, Rauch U. Procoagulant soluble tissue factor is released from endothelial cells in response to inflammatory cytokines. Circ Res. 2005; 96: 1233–1239.
25. Stas S, Whaley-Connell A, Habibi J, Appesh L, Hayden MR, Karuparthi PR, Qazi M, Morris EM, Cooper SA, Link CD, Stump C, Hay M, Ferrario C, Sowers JR. Mineralocorticoid receptor blockade attenuates chronic overexpression of the renin-angiotensin-aldosterone system stimulation of reduced nicotinamide adenine dinucleotide phosphate oxidase and cardiac remodeling. Endocrinology. 2007; 148: 3773–3780.
26. Bharadwaj D, Stein M-P, Volzer M, Mold C, Du Clos TW. The major receptor for C-reactive protein on leukocytes is Fc gamma Receptor II. J Exp Med. 1999; 190: 585–590.
27. Ryu J, Lee CW, Shin JA, Park CS, Kim JJ, Park SJ, Han KH. FcgammaRIIa mediates C-reactive protein-induced inflammatory responses of human vascular smooth muscle cells by activating NADPH oxidase 4. Cardiovasc Res. 2007; 75: 555–565.
28. Pyo RT, Sato Y, Mackman N, Taubman MB. Mice deficient in tissue factor demonstrate attenuated intimal hyperplasia in response to vascular injury and decreased smooth muscle cell migration. Thromb Haemost. 2004; 92: 451–458.[Medline] [Order article via Infotrieve]
29. Hernandez-Vargas P, Ortiz-Munoz G, Lopez-Franco O, Suzuki Y, Gallego-Delgado J, Sanjuan G, Lazaro A, Lopez-Parra V, Ortega L, Egido J, Gomez-Guerrero C. Fc gamma receptor deficiency confers protection against atherosclerosis in apolipoprotein E knockout mice. Circ Res. 2006; 99: 1188–1196.
30. McKenzie SE, Taylor SM, Malladi P, Yuhan H, Cassel DL, Chien P, Schwartz E, Schreiber AD, Surrey S, Reilly MP. The role of the human Fc receptor Fc gamma RIIA in the immune clearance of platelets: a transgenic mouse model. J Immunol. 1999; 162: 4311–4318.
31. Brisseau GF, Dackiw AP, Cheung PY, Christie N, Rotstein OD. Posttranscriptional regulation of macrophage tissue factor expression by antioxidants. Blood. 1995; 85: 1025–1035.
32. Luyendyk JP, Piper JD, Tencati M, Reddy KV, Holscher T, Zhang R, Luchoomun J, Chen X, Min W, Kunsch C, Mackman N. A novel class of antioxidants inhibit LPS induction of tissue factor by selective inhibition of the activation of ASK1 and MAP kinases. Arterioscler Thromb Vasc Biol. 2007; 27: 1857–1863.
33. Mousa SA. Inhibitory effect of C-reactive protein on the release of tissue factor pathway inhibitor from human endothelial cells: reversal by low molecular weight heparin. Int Angiol. 2006; 25: 10–13.[Medline] [Order article via Infotrieve]
34. Pan S, Kleppe LS, Witt TA, Mueske CS, Simari RD. The effect of vascular smooth muscle cell-targeted expression of tissue factor pathway inhibitor in a murine model of arterial thrombosis. Thromb Haemost. 2004; 92: 495–502.[Medline] [Order article via Infotrieve]
Related Article:
Arterioscler Thromb Vasc Biol 2008 28: 601-603.
This article has been cited by other articles:
 |
|
 |
|
  L. Lavie and P. Lavie Molecular mechanisms of cardiovascular disease in OSAHS: the oxidative stress link Eur. Respir. J., June 1, 2009; 33(6): 1467 - 1484. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Montecucco, F. Burger, G. Pelli, N. K. Poku, C. Berlier, S. Steffens, and F. Mach Statins inhibit C-reactive protein-induced chemokine secretion, ICAM-1 upregulation and chemotaxis in adherent human monocytes Rheumatology, March 1, 2009; 48(3): 233 - 242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Devaraj, J.-M. Yun, C. Duncan-Staley, and I. Jialal C-reactive protein induces M-CSF release and macrophage proliferation J. Leukoc. Biol., February 1, 2009; 85(2): 262 - 267. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Devaraj, U. Singh, and I. Jialal The Evolving Role of C-Reactive Protein in Atherothrombosis Clin. Chem., February 1, 2009; 55(2): 229 - 238. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Mackman and M. B. Taubman Does Tissue Factor Expression by Vascular Smooth Muscle Cells Provide a Link Between C-Reactive Protein and Cardiovascular Disease? Arterioscler Thromb Vasc Biol, April 1, 2008; 28(4): 601 - 603. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||