Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2008;28:105-111
Published online before print November 1, 2007, doi: 10.1161/ATVBAHA.107.155499
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
28/1/105    most recent
ATVBAHA.107.155499v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miao, R. Q.
Right arrow Articles by Sessa, W. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miao, R. Q.
Right arrow Articles by Sessa, W. C.
Related Collections
Right arrowRelated Article
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2008;28:105.)
© 2008 American Heart Association, Inc.


Cell Biology/Signaling

Dominant-Negative Hsp90 Reduces VEGF-Stimulated Nitric Oxide Release and Migration in Endothelial Cells

Robert Q. Miao; Jason Fontana; David Fulton; Michelle I. Lin; Kenneth D. Harrison; William C. Sessa

From the Department of Pharmacology and Vascular Biology & Therapeutics Program, Boyer Center for Molecular Medicine, Yale University School of Medicine, New Haven, Conn.

Correspondence to William C. Sessa, Department of Pharmacology and Vascular Biology and Therapeutics Program, Boyer Center for Molecular Medicine, Yale University School of Medicine, New Haven, CT 06536. E-mail william.sessa{at}yale.edu

Abstract

Objectives— Heat-shock protein 90 (Hsp90) coordinates the regulation of diverse signaling proteins. We try to develop a new tool to explore the regulatory functions of Hsp90 in endothelial cells (ECs) instead of the existing chemical approaches.

Methods and Results— We designed a dominant-negative Hsp90 construct by site-direct mutagenesis of residue Asp-88 to Asn (D88N-Hsp90) based on the structure of the ATP/ADP-binding site. Recombinant wild-type Hsp90 protein binds ATP-Sepharose beads in manner inhibited by ATP or 17-AAG, a specific inhibitor for Hsp90, however the binding activity of D88N-Hsp90 was markedly reduced and the inhibitory effects of ATP or 17-AAG were negligible. The dimerization between endogenous Hsp90{alpha} and exogenous HA-Hsp90β was confirmed by immunoprecipitation, however the association between eNOS and D88N-Hsp90 was less than WT-Hsp90. Furthermore, adenoviral transduction of bovine aortic ECs with D88N-Hsp90 suppressed VEGF-induced phosphorylation of Akt, eNOS, and NO release and the inhibitory effect was blocked by okadaic acid. Moreover, D88N-Hsp90 abolished VEGF-stimulated Rac activation and suppressed VEGF-induced stress fiber formation. Transduction with D88N-Hsp90 decreased growth medium mediated migration of wild-type ECs, but not Akt1(–/–) ECs suggesting that Akt is key target of Hsp90.

Conclusions— Our data demonstrate that dominant-negative Hsp90 modulates endothelial cell mobility mainly through PP2A-mediated dephosphorylation of Akt and Rac activation.

To explore functions of Hsp90 in endothelial cells (ECs), a dominant-negative Hsp90 (D88N-Hsp90beta) was generated that could not bind ATP. Adenovirus-mediated transduction of ECs with D88N-Hsp90beta suppressed VEGF-induced phosphorylation of Akt and eNOS and inhibited VEGF-stimulated NO release, stress fiber formation, and VEGF-induced chemotaxis.


Key Words: Hsp90 • ATP-binding • Akt • migration • dominant-negative

Heat shock protein 90 (Hsp90) is an abundant and ubiquitous molecular chaperone that is involved in maintaining appropriate folding and conformational maturation of other proteins.1 Apart from its cochaperones, Hsp90 is known to interact with a number of signaling molecules, including steroid hormone receptors, v-Src, Raf1, Akt, and NOS, and regulate cell signaling and functions.2–4 This superchaperone complex formation cycles between 2 major conformations: the "open" state and "closed" state. In the "open" state, a client protein is loaded onto Hsp90 with the help of the cochaperones, such as Hsp70, Hsp40, Hop, and Hip. On ATP binding and hydrolysis, the complex switches to the "closed" state in which Cdc37, p23, and immunophilins replace the original cochaperones to assist with the conformational maturation of the client proteins and maintain these client proteins in an active state to exert their functions.5 Blocking the ATP-binding site of Hsp90 by inhibitors such as geldanamycin (GA) locks the complex in the "open" state and ultimately results in degradation of some client proteins via an ubiquitin-proteasome–dependent pathway.2

See page 6

Hsp90 exists mainly as a constitutive homodimer, but it may be found as a monomer, as a heterodimer (consisting of {alpha} and β isoforms), or as a higher molecular weight oligomer in mammalian cells,6,7 and its dimerization domain resides mainly within the carboxyl-terminal 90 amino acids. Both Hsp90 {alpha} and β have a highly conserved 25 kDa N-terminal domain that is the ATP-binding pocket and binding site for GA.8,9 ATP binding assists in the dimerization of Hsp90 by changing its conformation and stabilizing Hsp90 client proteins.8,10 Substrate binding at the N-terminal site is affected by nucleotides (ATP and ADP) and by drugs such as GA. GA binds to Hsp90 and disrupts the complex between Hsp90 and certain client proteins such as the protein kinase Akt.11

Structural studies of the ATP/ADP binding site in Hsp90 have shown that the only carboxyl side chain of Asp79 (D79) in yeast Hsp82 or Asp93 (D93) in human Hsp90{alpha} makes a direct hydrogen bond to the exocyclic N6 group of adenine of bound ATP/ADP nucleotide or the carbamate nitrogen of GA,5,12,13 respectively. Site-directed mutagenesis of Asp97 to asparagine (D93N) in Hsp90{alpha} resulted in loss of ATP-binding activity and impaired ATP hydrolysis. Mutations of D79 in yeast Hsp82 to Asn, Arg, or Trp also abolished ATPase activity and yeast growth, suggesting that this conserved Asp residue is necessary for ATP/ADP binding and the function of Hsp90.14,15

Recent work has shown that Hsp90 coordinates the trafficking and regulation of diverse signaling proteins in endothelial cells (ECs). Previous studies have shown that stimulation of ECs with vascular endothelial growth factor (VEGF) recruits eNOS and Akt to the structurally flexible 35-kDa middle domain of Hsp90, which is separated from the N-terminal ATP/ADP binding domain by a divergent charged sequence,16,17 thereby facilitating eNOS phosphorylation and enzyme activation and nitric oxide (NO) release.18 Because Hsp 90 can serves as a general molecular scaffold for signaling in endothelial cells, the central goal of this paper was to develop a mutant form of Hsp90β lacking the conserved Asp in the ATP-binding domain (D88 in Hsp90β) and to generate an adenovirus to assess if overexpression of mutant Hsp90 influences endothelial cell functions in vitro.

Materials and Methods

Cell Culture and Reagents
Mouse lung endothelial cells (MLECs) were isolated from 3-week-old Akt1–/– and WT mice as previously described.22 Cells were propagated in EGM-2 media supplemented with EGM-2 microvascular (MV) SingleQuots (Cambrex).

Site-Direct Mutagenesis and Plasmid Construction
A single amino acid mutation (D88N) was generated in the Hsp90β using the QuickChange site-directed mutagenesis kit (Stratagene) with a primer (AACGTACCCTGACTTTGGT TAACACAGGCATTGGCATGAC) and confirmed by sequencing.

ATP-Sepharose Binding Assay
The ATP-Sepharose binding assay was performed using {gamma}-phosphate–linked ATP-Sepharose resin (Upstate Biotechnologies) and purified Hsp90 protein. Bound protein was eluted from the resin by boiling in SDS sample buffer for subsequent SDS-PAGE and Western blotting using Anti-Hsp90β antibody.

NO Release Assay
The serum-free media were processed for the measurement of nitrite NO2, a stable breakdown product of NO in aqueous solution, using a Sievers NO chemiluminescence detector system as previously described.18,22

Rac Activity Assay
Pull-down of GTP-bound Rac was performed by incubating cell lysates with GST-fusion protein containing the p21-binding domain of PAK-1 bound to glutathione agarose for 1 hour at 4°C. The amount of GTP-bound Rac was examined by immunoblotting using a Rac monoclonal antibody (BD Transduction Laboratories).

Phalloidin Staining
Cells were fixed with 2% formaldehyde and permeabilized with 0.1% Triton X-100 in phosphate buffered saline, pH7.5. F-actin was examined using Alex 568-conjugated phalloidin (Invitrogen).

Migration Assay
The transwell inserts (Costar transwell inserts; Corning) were coated with 0.1% gelatin (Sigma). VEGF at 50 ng/mL (1.1 nmol/L) dissolved in EBM-2 medium containing 0.1% bovine serum albumin (BSA) was added in the bottom chamber of Boyden apparatus. of bovine aortic endothelial cells (BAECs) or murine lung endothelial cells (MLECs; 2x105 cells) suspended in 100 µL aliquot of EBM-2 (Cambrex) containing 0.1% BSA was added to the upper chamber. After 5 hours incubation, cells on both sides of the membrane were fixed and stained with Diff-Quik staining kit (Baxter Healthcare Corp). The average number of cells from five randomly chosen high power (400x) fields on the lower side of the membrane was counted.

For further details, see the supplemental materials.

Results

D88N-Hsp90β Mutant Is Defective in Binding to Immobilized ATP
Figure 1A shows that human Hsp90β shares a high degree of homology with human Hsp90{alpha} and yeast Hsp82 in ATP/ADP-binding domain located at the N-terminal domain of Hsp90 (residues 1 to 220 for the human hsp90 and yeast Hsp82). Previous structure and function analysis has shown that the residue Asp 93 (D93) in human Hsp90{alpha} and Asp 79 (D79) in yeast Hsp82 are critical for ATP/ADP-binding and ATPase activity of the chaperone.12–14 Alignment of human Hsp90β with human Hsp90{alpha} and yeast Hsp82 demonstrated that Asp88 (D88, asterisk) in human Hsp90β is the analogous residue for ATP/ADP-binding and subsequent ATPase function. To confirm this, site-directed mutagenesis of this residue from D88 to N88 was performed, the resultant proteins were expressed and purified from bacteria, and the binding to ATP was assessed via interaction of Hsp90β using a {gamma}-phosphate–linked ATP-Sepharose resin. As seen in Figure 1B, wild-type Hsp90β binds to ATP-Sepharose (lane 1), an effect that can be reduced by the addition of the free nucleotide ATP (lane 2) and the Hsp90 inhibitor 17-aminoallyl geldanamycin (17-AAG; lane 3) to the reaction. However, D88N-Hsp90β has a markedly reduced capacity to bind to ATP Sepharose, (lane 4) compared with WT (lane 1) and ATP and 17-AAG (lanes 5 and 6) did not reduce the binding of D88N-Hsp90β further (data quantified in Figure 1C). These data demonstrate that mutation of D88 to N disrupts the ATP binding capacity of Hsp90β.


Figure 1
View larger version (48K):
[in this window]
[in a new window]

 
Figure 1. Alignment of Hsp90 ATP-binding domains and binding of Hsp90 to ATP-Sepharose (A) Human Hsp90β shares an identical residue (D88) critical for ATP binding as human Hsp90{alpha} (D93) and yeast Hsp82 (D79). B, The binding of Hsp90β to ATP-Sepharose. C, Densitometric analysis of bound Hsp90β to ATP-Sepharose.

Dimerization of Mutant Hsp90 With Endogenous Hsp90 and Complex Formation of eNOS and Akt With Hsp90
Because Hsp90 plays an important role in regulating aspects of EC function, we generated adenoviruses to efficiently infect endothelial cells with cDNAs encoding GFP alone (as a control; Ad-GFP), HA tagged WT Hsp90 (Ad-Hsp90β), or D88N Hsp90 (Ad-D88N Hsp90β). The shuttle vectors for WT and D88N Hsp90 also expressed GFP. Primary cultures of BAECs were infected with different MOI of Ad-GFP or Ad-D88N and the expression of GFP and D88N-Hsp90β mutant was examined by Western blotting using antibodies against GFP and the HA epitope tag, respectively (supplemental Figure IA, available online at http://atvb.ahajournals. org). The results show that Ad-GFP and Ad-D88N achieved identical viral infectivity and expression as confirmed by GFP expression and D88N Hsp90β. To examine whether point mutation in ATP-binding domain influenced the dimerization of expressed Hsp90 with endogenous Hsp90, BAECs were infected with Ad-GFP (control), Ad-Hsp90β WT, and Ad-D88N, and HA-tagged proteins were immunoprecipiated. As seen in supplemental Figure 1B, identical levels of endogenous Hsp90{alpha} were coimmunoprecipitated by HA-Hsp90β WT or D88N mutant demonstrated that D88N mutant did not affect Hsp90 dimerization demonstrating that the D88N mutant may serve as a dominant-negative Hsp90 that interacts with endogenous Hsp90{alpha} and β isoforms. Consistent with previous reports,4,8,11,18 Hsp90β WT formed a ternary complex with eNOS and Akt. However, infection of cells with D88N-Hsp90β mutant reduced complex formation with eNOS and to a lesser extent with Akt (see supplemental Figure IC).

Dominant-Negative Hsp90β (D88N) Inhibits VEGF-Stimulated Phosphorylation of Akt and eNOS, and NO Production
To evaluate the effects of dominant-negative Hsp90β on VEGF-stimulated signaling in endothelial cells, BAECs were noninfected or infected with Ad-GFP or Ad-D88N Hsp90, then stimulated with VEGF (15 minutes), and the phosphorylation of Akt (on S473) and eNOS (on S1179) was examined by Western blotting. Figure 2A shows that D88N Hsp90 reduced the VEGF-stimulated phosphorylation levels of eNOS on serine 1179 and to a lesser extent Akt on serine 473 (as quantified in Figure 2B) in total cell lysates. However, D88N Hsp90 had no effect on the basal phosphorylation levels of eNOS (S1179) or Akt (S473) (quantified in Figure 2B; n=3 experiments). The changes in VEGF phosphorylation of eNOS and Akt were not attributable to changes in the levels of these proteins in the total cell lysates (Figure 2C). Figure 2C also shows the expression levels of exogenous HA-Hsp90β-D88N from adenoviral infections are the similar to the levels of endogenous Hsp90β (Ad-GFP, 48.86±3.87 versus Ad-D88N, 91.32±5.72; P<0.01). Next, we examined VEGF-stimulated NO production in BAECs noninfected or infected with Ad-GFP or Ad-D88N Hsp90β. Infection of BAECs with Ad-D88N Hsp90 or Ad-GFP had no significant inhibitory effects on the basal NO production (Figure 2D, assessed as the stable product nitrite, NO2), whereas VEGF-stimulated NO production was reduced by infection with D88N Hsp90 compared with control and Ad-GFP infected cells (Figure 3D).


Figure 2
View larger version (36K):
[in this window]
[in a new window]

 
Figure 2. A, D88N-Hsp90β inhibits VEGF-stimulated phosphorylation of Akt (S473) and eNOS (S1179). B, The ratio of phosphorylated Akt and eNOS to total Akt and eNOS, respectively. C, The ratio of eNOS, Akt, Hsp90β, and Hsp90{alpha} to β-actin, respectively. D, NO release into medium of Ad-GFP or Ad-D88N infected BAECs.


Figure 3
View larger version (41K):
[in this window]
[in a new window]

 
Figure 3. A, Dominant-negative Hsp90β (D88N) promotes okadaic acid sensitive mediated Akt dephosphorylation. B, Densitomic analysis of pooled data showing the ratio of phosphorylated Akt to total Akt.

There is evidence that Hsp90 interacts with Akt and preserves Akt activity by preventing its dephosphorylation on S473 by the phosphatase PP2A.11 Infection of BAECs with Ad-D88N Hsp90, but not Ad-GFP, reduced VEGF-induced Akt phosphorylation consistent with previous data using GA,8 and the dephosphorylation of Akt S473 was blocked by treatment of cells with okadaic acid (500 nmol/L), a PP2A inhibitor (Figure 3A and as quantified in Figure 3B). Ad-D88N Hsp90 did not show any effect on the basal activation of Akt (Figure 3A and as quantified in Figure 3B).

D88NHsp90β Suppresses VEGF-Stimulated EC Migration
Hsp90 links VEGF signaling to activation of eNOS and cytoskeletal rearrangements leading to EC migration.4,19–21 Next, we examined the effects of D88N Hsp90 on basal and VEGF-stimulated cell migration in BAECs transduced with Ad-GFP or Ad-D88N Hsp90. Infection with equal MOI of Ad-GFP or D88N Hsp90β had no effect on basal EC attachment and chemokinesis (Figure 4A), however D88N Hsp90β significantly reduced VEGF-stimulated migration of BAECs. Because there is evidence that growth factors may signal through Akt leading to EC migration,19,21–23 we examined the effects of D88N Hsp90β on MLECs isolated from WT or Akt1–/– mice. These isolated MLECs are transformed with the middle T antigen, which strongly activates the PI3 kinase-Akt pathway, thus, we could not examine VEGF-stimulated migration.22 As seen in Figure 4B, expression of D88N Hsp90 significantly suppressed serum stimulated migration in WT MLECs compared with Ad-GFP infected MLECs, similar to results in VEGF-stimulated BAECs. However, as shown in our previous study,22 serum stimulated migration was reduced in Akt1–/– MLECs compared with WT MLECs, and infection with Ad-D88N Hsp90 did not further attenuate serum induced migration in MLECs from Akt-1–/– mice strongly supporting the idea that Hsp90 regulation of Akt1 is a major target for regulating endothelial cell migration.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

 
Figure 4. A, Dominant-negative Hsp90β (D88N) inhibits VEGF-stimulated BAEC migration via Akt1-dependent manner. B, Dominant-negative Hsp90β (D88N) inhibits WT but not Akt1–/– MLEC migration.

D88N Hsp90β Inhibits VEGF-Stimulated Stress Fiber Formation and Rac Activation
Cell migration is associated with regulation of the actin cytoskeleton via activation of Rac GTPase.24,25 As shown previously, VEGF induces edge ruffling26 and stress fiber formation in cultured endothelial cells.19,27 In quiescent BAECs infected with Ad-GFP or Ad-D88N Hsp90, F-actin was found mostly in peripheral membrane structures and unorganized fibers throughout the cell (Figure 5A, top panel). As expected, VEGF induced the formation of long condensed stress fibers (Figure 5A, left panel, bottom). However, VEGF-stimulated stress fiber formation was markedly attenuated in BAECs infected with Ad-D88N Hsp90 (Figure 5A, right panel, bottom). Because Rac is an important regulator of stress fiber formation in endothelial cells,24,25 we examined VEGF stimulated Rac activation in BAECs infected with Ad-GFP or D88N Hsp90. As seen in Figure 5B, VEGF treatment resulted in Rac activation at 5 or 15 minutes in BAECs infected with Ad-GFP, an effect that was attenuated in cells infected with Ad D88N Hsp90. Figure 5C shows that treatment of BAECs with LY294002, PI-3 kinase inhibitor, blocked the VEGF-induced Rac activation at 5 or 15 minutes, whereas a Rac1 inhibitor28 did not suppress VEGF-stimulated Akt activation in BAECs (Figure 5D) indicating that PI-3 kinase, but not Rac, is likely upstream of Akt. Consequently, both LY294002 and the Rac1 inhibitor suppressed VEGF-stimulated BAEC migration, however they did not show any further inhibitory effects on the VEGF-induced migration in cells infected with Ad-D88N Hsp90 (Figure 5E). These data suggest that inhibitory effect of D88N Hsp90β on VEGF-stimulated endothelial cell migration may be mediated by impaired Akt and Rac activation and subsequent formation of stress fibers.


Figure 5
View larger version (24K):
[in this window]
[in a new window]

 
Figure 5. A, Dominant-negative Hsp90β suppresses VEGF-stimulated stress fiber formation in BAECs; Bar=20 µm. B, Rac1 activation in Ad-GFP or Ad-D88N infected BAECs and in BAECs pretreated with LY294002 (1 µmol/L; C). D, Effects of a PI3 kinase inhibitor and Rac1 inhibitor on the phosphorylation of Akt and extracellular signal-regulated kinase (ERK) in BAECs and (E) on migration of BAECs infected with Ad-GFP or Ad-D88N, respectively. For further details, see supplemental materials.

Discussion

This paper characterizes a new reagent to test the cellular functions of Hsp90, namely an ATP-binding mutant that can dimerize with endogenous Hsp90 and serve as an inhibitor of several functions. Because the sites of ATP and GA binding are conserved and have been resolved cyrstallographically, we created an Hsp90 mutant by site-direct mutation of Asp88 (D88) to Asn (N88). Unlike WT Hsp90, recombinant D88N Hsp90 did not bind effectively to an ATP Sepharose column documenting D88 as a critical residue for ATP-binding (Figure 1B). The crystal structure of the N-terminal domain of the D79N mutant in yeast Hsp82 has verified that the loss of adenine nucleotide binding by the D79N mutant was attributable to the local changes in hydrogen bonding at the bottom of ADP/ATP-binding pocket, and not to gross misfolding of the protein as a result of the mutation.15 Similar to previous reports,6,7 D88N Hsp90β can form a homodimer with endogenous Hsp90β and heterodimer with endogenous Hsp90{alpha} (supplemental Figure IB). These results suggest that this mutant D88N can effectively target the endogenous pools of Hsp90 and serve as a dominant-negative to disrupt the association of client proteins with Hsp90 similar to GA or 17-AAG, specific inhibitors.

Previous studies have shown that Akt and eNOS form a complex with Hsp90 in vitro and in vivo.4,18,29–31 Amino acid residues 327 to 340 of Hsp90β has been identified to be involved in the binding of Akt at the amino acid residues 229 to 309.11 Inhibition of Akt-Hsp90 binding using Hsp90 deletion mutants led to the PP2A-mediated dephosphorylation and inactivation of Akt. Inhibition of Hsp90 with 17-AAG also results in the ubiquitination of Akt and its targeting to the proteasome.8 Our previous report showed that Hsp90 associated with eNOS and enhanced the activation of eNOS.4 In additional studies we have identified the M-region of Hsp90 that interacts with the amino terminus of eNOS and Akt, and have demonstrated that Hsp90 modulates Akt-driven phosphorylation of eNOS.18 These results suggest that Hsp90 may function as a scaffold for eNOS and Akt and suggest that model that on activation of endothelial cells with VEGF, eNOS, and Akt are recruiting to an adjacent region on the same domain of Hsp90 to facilitate eNOS phosphorylation and enzyme activation. Supplemental Figure IB shows that eNOS and Akt formed complex with Hsp90β and Hsp90{alpha} and dominant-negative D88N Hsp90β inhibited the association of eNOS and Akt with Hsp90 and resulting in dephosphorylation of Akt (S473) and less phosphorylation of eNOS (S1179; Figure 2A and 2B) and NO release (Figure 2D). Consistent with a previous report,11 the dephosphorylation of Akt and eNOS is mediated by PP2A because okadaic acid can rescue the dephosphorylation caused by D88N Hsp90β (Figure 3). Collectively, these results demonstrate that dominant-negative Hsp90 can interrupt the association of Hsp90 complex with eNOS and Akt and disrupt the VEGF-stimulated phosphorylation signaling in endothelial cells.

We further investigated the effects of dominant-negative Hsp90 on other biological functions in endothelial cells. It has been reported that stimulation of ECs with VEGF leads to the activation of Akt by phosphorylation on threonine 308 and on serine 473x3-phosphoinositide–dependent kinase-1 and -2, respectively.32,33 Besides mediating cell survival in ECs, Akt activates eNOS by phosphorylation on serine 1179,34,35 and phosphorylation of eNOS on serine 1179 enhances NO generation in a partially calcium-independent manner. Recent studies suggest that NO is an essential mediator of EC migration and VEGF-induced angiogenesis. Inhibition of eNOS suppresses the mitogenic and migratory effects of VEGF on ECs in vitro and the VEGF-induced angiogenic response in vivo.36,37 Moreover, it has been demonstrated that Akt mediates the VEGF-induced migration of ECs via activation of eNOS.19,23,38 Here we demonstrate that inhibition of Akt and eNOS phosphorylation by dominant-negative Hsp90 subsequently reduces VEGF-stimulated migration of ECs (Figure 4A). However, this inhibitory effect was diminished by infection of MLEC Akt1–/– cells with D88N Hsp90β (Figure 4B). Our previous study shows that Akt1 is the major isoform in ECs22 important for VEGF-mediated angiogenesis in vivo and in vitro. These results support our hypothesis that Akt and eNOS binding to the scaffold of Hsp90 to facilitate eNOS phosphorylation and activation suggesting that Akt is a major modulator of actions of dominant-negative Hsp90.

Directed cell migration is associated with rearrangement of the actin cytoskeleton. As shown previously, VEGF induces edge ruffling and stress fiber formation in cultured ECs. Our previous results showed that VEGF-induced cell migration and F-actin rearrangement are dependent on Akt activity19,22 and that constitutively activated Akt is sufficient to cause cellular chemokinesis most likely because of its effects on stress fiber formation.19 In the context of cell motility, the effectors of NO are not known. However, NO can influence the tractional forces in activated endothelial cells and influence remodeling of focal adhesions, perhaps by influencing tyrosine phosphorylation of focal adhesion kinase.39 It has been demonstrated that Rac activation is required for haptotaxis on collagen- and VEGF-stimulated chemotaxis. Similar to VEGF, constitutively active Rac increased EC stress fiber formation and focal adhesions.24,25 VEGF treatment of Rac-activated cells had no further effect on the actin cytoskeleton and focal adhesion. Transduction of dominant-negative Rac into ECs inhibited stress fiber and focal adhesion formation and suppressed VEGF-stimulated migration.24,25 These data indicate that Rac activation may be sufficient to activate the necessary downstream events in ECs required for VEGF-induced chemotaxis. In this study, we demonstrated that dominant-negative Hsp90β inhibits VEGF-induced stress fiber formation (Figure 5A) and Rac activation (Figure 5B) and VEGF-stimulated migration of ECs (Figure 4A). However, whether Rac activation and stress fiber formation are modulated by NO production is still unclear and is the focus of additional experiments. Our results also showed that Rac activation is dependent on the activation of PI3 kinase in BAECs because LY294002, a specific PI3 kinase inhibitor, can inhibit the Rac activation in BAECs (Figure 5C), but Rac inhibitor cannot block the activation of Akt mediated by PI3 kinase activation (Figure 5D). As expected, both LY294002 and Rac1 inhibitor can suppress VEGF-stimulated BAEC migration, however they did not show any further inhibitory effects on the VEGF-induced migration of BAECs infected with Ad-D88N Hsp90 (Figure 5E), suggesting that Hsp90 is critical for both pathways.

In summary, our data are the first to report a genetic approach in mammalian cells to demonstrate a critical role of Hsp90 in regulating EC functions including NO release and migration. We have shown that adenoviral expression of dominant-negative Hsp90 is a new tool to investigate the involvement of Hsp90 in a variety of cellular processes and may lead to the identification of new Hsp90 client proteins. The usage of dominant negative Hsp90β can complement the existing chemical approaches such as GA and 17-AAG to dissect the role of Hsp90 in mammalian cells.

Acknowledgments

Sources of Funding

This work was supported by National Institutes of Health Grants HL64793, R01 HL 61371, R01 HL 57665, and P01 HL 70295 and National Heart, Lung, and Blood Institute–Yale Proteomics Contract N01-HV-28186 (to W.C.S.). Q.R.M. is supported by an SDG grant from the American Heart Association.

Disclosures

None.

Footnotes

Original received February 7, 2007; final version accepted October 23, 2007.

References

1. Pratt WB. The role of the hsp90-based chaperone system in signal transduction by nuclear receptors and receptors signaling via MAP kinase. Annu Rev Pharmacol Toxicol. 1997; 37: 297–326.[CrossRef][Medline] [Order article via Infotrieve]

2. Whitesell L, Mimnaugh EG, De Costa B, Myers CE, Neckers LM. Inhibition of heat shock protein HSP90-pp60v-src heteroprotein complex formation by benzoquinone ansamycins: essential role for stress proteins in oncogenic transformation. Proc Natl Acad Sci U S A. 1994; 91: 8324–8328.[Abstract/Free Full Text]

3. Schulte TW, An WG, Neckers LM. Geldanamycin-induced destabilization of Raf-1 involves the proteasome. Biochem Biophys Res Commun. 1997; 239: 655–659.[CrossRef][Medline] [Order article via Infotrieve]

4. Garcia-Cardena G, Fan R, Shah V, Sorrentino R, Cirino G, Papapetropoulos A, Sessa WC. Dynamic activation of endothelial nitric oxide synthase by Hsp90. Nature. 1998; 392: 821–824.[CrossRef][Medline] [Order article via Infotrieve]

5. Prodromou C, Pearl LH. Structure and functional relationships of Hsp90. Curr Cancer Drug Targets. 2003; 3: 301–323.[CrossRef][Medline] [Order article via Infotrieve]

6. Minami Y, Kawasaki H, Miyata Y, Suzuki K, Yahara I. Analysis of native forms and isoform compositions of the mouse 90-kDa heat shock protein, HSP90. J Biol Chem. 1991; 266: 10099–10103.[Abstract/Free Full Text]

7. Nemoto T, Sato N. Oligomeric forms of the 90-kDa heat shock protein. Biochem J. 1998; 330 (Pt 2): 989–995.[Medline] [Order article via Infotrieve]

8. Basso AD, Solit DB, Chiosis G, Giri B, Tsichlis P, Rosen N. Akt forms an intracellular complex with heat shock protein 90 (Hsp90) and Cdc37 and is destabilized by inhibitors of Hsp90 function. J Biol Chem. 2002; 277: 39858–39866.[Abstract/Free Full Text]

9. Grenert JP, Sullivan WP, Fadden P, Haystead TA, Clark J, Mimnaugh E, Krutzsch H, Ochel HJ, Schulte TW, Sausville E, Neckers LM, Toft DO. The amino-terminal domain of heat shock protein 90 (hsp90) that binds geldanamycin is an ATP/ADP switch domain that regulates hsp90 conformation. J Biol Chem. 1997; 272: 23843–23850.[Abstract/Free Full Text]

10. Roe SM, Ali MM, Meyer P, Vaughan CK, Panaretou B, Piper PW, Prodromou C, Pearl LH. The Mechanism of Hsp90 regulation by the protein kinase-specific cochaperone p50(cdc37). Cell. 2004; 116: 87–98.[CrossRef][Medline] [Order article via Infotrieve]

11. Sato S, Fujita N, Tsuruo T. Modulation of Akt kinase activity by binding to Hsp90. Proc Natl Acad Sci U S A. 2000; 97: 10832–10837.[Abstract/Free Full Text]

12. Prodromou C, Roe SM, O’Brien R, Ladbury JE, Piper PW, Pearl LH. Identification and structural characterization of the ATP/ADP-binding site in the Hsp90 molecular chaperone. Cell. 1997; 90: 65–75.[CrossRef][Medline] [Order article via Infotrieve]

13. Stebbins CE, Russo AA, Schneider C, Rosen N, Hartl FU, Pavletich NP. Crystal structure of an Hsp90-geldanamycin complex: targeting of a protein chaperone by an antitumor agent. Cell. 1997; 89: 239–250.[CrossRef][Medline] [Order article via Infotrieve]

14. Obermann WM, Sondermann H, Russo AA, Pavletich NP, Hartl FU. In vivo function of Hsp90 is dependent on ATP binding and ATP hydrolysis. J Cell Biol. 1998; 143: 901–910.[Abstract/Free Full Text]

15. Panaretou B, Prodromou C, Roe SM, O’Brien R, Ladbury JE, Piper PW, Pearl LH. ATP binding and hydrolysis are essential to the function of the Hsp90 molecular chaperone in vivo. Embo J. 1998; 17: 4829–4836.[CrossRef][Medline] [Order article via Infotrieve]

16. Scheibel T, Siegmund HI, Jaenicke R, Ganz P, Lilie H, Buchner J. The charged region of Hsp90 modulates the function of the N-terminal domain. Proc Natl Acad Sci U S A. 1999; 96: 1297–1302.[Abstract/Free Full Text]

17. Scheibel T, Weikl T, Buchner J. Two chaperone sites in Hsp90 differing in substrate specificity and ATP dependence. Proc Natl Acad Sci U S A. 1998; 95: 1495–1499.[Abstract/Free Full Text]

18. Fontana J, Fulton D, Chen Y, Fairchild TA, McCabe TJ, Fujita N, Tsuruo T, Sessa WC. Domain mapping studies reveal that the M domain of hsp90 serves as a molecular scaffold to regulate Akt-dependent phosphorylation of endothelial nitric oxide synthase and NO release. Circ Res. 2002; 90: 866–873.[Abstract/Free Full Text]

19. Morales-Ruiz M, Fulton D, Sowa G, Languino LR, Fujio Y, Walsh K, Sessa WC. Vascular endothelial growth factor-stimulated actin reorganization and migration of endothelial cells is regulated via the serine/threonine kinase Akt. Circ Res. 2000; 86: 892–896.[Abstract/Free Full Text]

20. Murtagh J, Lu H, Schwartz EL. Taxotere-induced inhibition of human endothelial cell migration is a result of heat shock protein 90 degradation. Cancer Res. 2006; 66: 8192–8199.[Abstract/Free Full Text]

21. Sun J, Liao JK. Induction of angiogenesis by heat shock protein 90 mediated by protein kinase Akt and endothelial nitric oxide synthase. Arterioscler Thromb Vasc Biol. 2004; 24: 2238–2244.[Abstract/Free Full Text]

22. Ackah E, Yu J, Zoellner S, Iwakiri Y, Skurk C, Shibata R, Ouchi N, Easton RM, Galasso G, Birnbaum MJ, Walsh K, Sessa WC. Akt1/protein kinase Balpha is critical for ischemic and VEGF-mediated angiogenesis. J Clin Invest. 2005; 115: 2119–2127.[CrossRef][Medline] [Order article via Infotrieve]

23. Dimmeler S, Dernbach E, Zeiher AM. Phosphorylation of the endothelial nitric oxide synthase at ser-1177 is required for VEGF-induced endothelial cell migration. FEBS Lett. 2000; 477: 258–262.[CrossRef][Medline] [Order article via Infotrieve]

24. Soga N, Connolly JO, Chellaiah M, Kawamura J, Hruska KA. Rac regulates vascular endothelial growth factor stimulated motility. Cell Commun Adhes. 2001; 8: 1–13.[Medline] [Order article via Infotrieve]

25. Soga N, Namba N, McAllister S, Cornelius L, Teitelbaum SL, Dowdy SF, Kawamura J, Hruska KA. Rho family GTPases regulate VEGF-stimulated endothelial cell motility. Exp Cell Res. 2001; 269: 73–87.[CrossRef][Medline] [Order article via Infotrieve]

26. Waltenberger J, Claesson-Welsh L, Siegbahn A, Shibuya M, Heldin CH. Different signal transduction properties of KDR and Flt1, two receptors for vascular endothelial growth factor. J Biol Chem. 1994; 269: 26988–26995.[Abstract/Free Full Text]

27. Rousseau S, Houle F, Landry J, Huot J. p38 MAP kinase activation by vascular endothelial growth factor mediates actin reorganization and cell migration in human endothelial cells. Oncogene. 1997; 15: 2169–2177.[CrossRef][Medline] [Order article via Infotrieve]

28. Gao Y, Dickerson JB, Guo F, Zheng J, Zheng Y. Rational design and characterization of a Rac GTPase-specific small molecule inhibitor. Proc Natl Acad Sci U S A. 2004; 101: 7618–7623.[Abstract/Free Full Text]

29. Gratton JP, Fontana J, O’Connor DS, Garcia-Cardena G, McCabe TJ, Sessa WC. Reconstitution of an endothelial nitric-oxide synthase (eNOS), hsp90, and caveolin-1 complex in vitro. Evidence that hsp90 facilitates calmodulin stimulated displacement of eNOS from caveolin-1. J Biol Chem. 2000; 275: 22268–22272.[Abstract/Free Full Text]

30. Takahashi S, Mendelsohn ME. Synergistic activation of endothelial nitric-oxide synthase (eNOS) by HSP90 and Akt: calcium-independent eNOS activation involves formation of an HSP90-Akt-CaM-bound eNOS complex. J Biol Chem. 2003; 278: 30821–30827.[Abstract/Free Full Text]

31. Takahashi S, Mendelsohn ME. Calmodulin-dependent and -independent activation of endothelial nitric-oxide synthase by heat shock protein 90. J Biol Chem. 2003; 278: 9339–9344.[Abstract/Free Full Text]

32. Datta SR, Brunet A, Greenberg ME. Cellular survival: a play in three Akts. Genes Dev. 1999; 13: 2905–2927.[Free Full Text]

33. Fujio Y, Walsh K. Akt mediates cytoprotection of endothelial cells by vascular endothelial growth factor in an anchorage-dependent manner. J Biol Chem. 1999; 274: 16349–16354.[Abstract/Free Full Text]

34. Dimmeler S, Fleming I, Fisslthaler B, Hermann C, Busse R, Zeiher AM. Activation of nitric oxide synthase in endothelial cells by Akt-dependent phosphorylation. Nature. 1999; 399: 601–605.[CrossRef][Medline] [Order article via Infotrieve]

35. Fulton D, Gratton JP, McCabe TJ, Fontana J, Fujio Y, Walsh K, Franke TF, Papapetropoulos A, Sessa WC. Regulation of endothelium-derived nitric oxide production by the protein kinase Akt. Nature. 1999; 399: 597–601.[CrossRef][Medline] [Order article via Infotrieve]

36. Papapetropoulos A, Garcia-Cardena G, Madri JA, Sessa WC. Nitric oxide production contributes to the angiogenic properties of vascular endothelial growth factor in human endothelial cells. J Clin Invest. 1997; 100: 3131–3139.[Medline] [Order article via Infotrieve]

37. Ziche M, Morbidelli L, Choudhuri R, Zhang HT, Donnini S, Granger HJ, Bicknell R. Nitric oxide synthase lies downstream from vascular endothelial growth factor-induced but not basic fibroblast growth factor-induced angiogenesis. J Clin Invest. 1997; 99: 2625–2634.[Medline] [Order article via Infotrieve]

38. Radisavljevic Z, Avraham H, Avraham S. Vascular endothelial growth factor up-regulates ICAM-1 expression via the phosphatidylinositol 3 OH-kinase/AKT/Nitric oxide pathway and modulates migration of brain microvascular endothelial cells. J Biol Chem. 2000; 275: 20770–20774.[Abstract/Free Full Text]

39. Goligorsky MS, Abedi H, Noiri E, Takhtajan A, Lense S, Romanov V, Zachary I. Nitric oxide modulation of focal adhesions in endothelial cells. Am J Physiol. 1999; 276: C1271–1281.[Medline] [Order article via Infotrieve]


Related Article:

Twin Layers of Lightning: A New Role for the Chaperone Hsp90 in Angiogenesis
Xinchun Pi and Cam Patterson
Arterioscler. Thromb. Vasc. Biol. 2008 28: 6-7. [Extract] [Full Text] [PDF]



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Mohan, R. Konopinski, B. Yan, V. E. Centonze, and M. Natarajan
High glucose-induced IKK-Hsp-90 interaction contributes to endothelial dysfunction
Am J Physiol Cell Physiol, January 1, 2009; 296(1): C182 - C192.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Wang, Q. Peng, J. Zhang, and L. Liu
Na+/H+ exchanger is required for hyperglycaemia-induced endothelial dysfunction via calcium-dependent calpain
Cardiovasc Res, November 1, 2008; 80(2): 255 - 262.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
S. Shankar, Q. Chen, S. Ganapathy, K. P. Singh, and R. K. Srivastava
Diallyl trisulfide increases the effectiveness of TRAIL and inhibits prostate cancer growth in an orthotopic model: molecular mechanisms
Mol. Cancer Ther., August 1, 2008; 7(8): 2328 - 2338.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
28/1/105    most recent
ATVBAHA.107.155499v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miao, R. Q.
Right arrow Articles by Sessa, W. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miao, R. Q.
Right arrow Articles by Sessa, W. C.
Related Collections
Right arrowRelated Article