Published online before print July 19, 2007, doi: 10.1161/ATVBAHA.107.149914
© 2007 American Heart Association, Inc.
Atherosclerosis and Lipoproteins |
Phospholipid Transfer Protein–Deficient Mice Absorb Less Cholesterol
From the Department of Anatomy and Cell Biology (R.L., J.I., C.Y., M.M.H., X.C.J.), SUNY Downstate Medical Center, Brooklyn, NY; and the Department of Medicine, Liver Center and Gastroenterology Division (D.Q.-H.W.), Beth Israel Deaconess Medical Center, Harvard Medical School and Harvard Digestive Diseases Center, Boston, Mass.
Correspondence to M. Mahmood Hussain or Xian-Cheng Jiang, Department of Anatomy and Cell Biology, SUNY Downstate Medical Center, 450 Clarkson Ave, Box 5, Brooklyn, NY 11203. E-mail mhussain{at}downstate.edu or xjiang@downstate.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
Objective— Phospholipid transfer protein (PLTP) plays an important role in lipoprotein metabolism and atherosclerosis. PLTP gene knockout (KO) mice show significant reduction of plasma cholesterol levels. Because small intestine is one of the major tissue expressing PLTP, we hypothesize that PLTP deficient small intestine absorbs less cholesterol, thus contributing to the diminishing of cholesterol levels in the plasma.
Methods and Results— We used dual-labeled cholesterol/sitostanol feeding approach to study cholesterol absorption in PLTP KO and WT mice. We found that PLTP KO mice absorb significant less cholesterol than WT mice. Primary enterocytes isolated from PLTP KO enterocytes took up significant less cholesterol. Moreover, we observed that Niemann-Pick C1-like 1 (NPC1L1) mRNA levels were significantly decreased in the small intestine of PLTP KO mice. Next, we studied the secretion of cholesterol by enterocytes. The amounts of cholesterol transported to plasma and liver were significantly reduced in PLTP KO mice, compared with WT animals. Studies with isolated PLTP KO enterocytes revealed that the secretion of cholesterol via chylomicron and intestinal-HDL was significantly reduced. Furthermore, ATP-binding cassette transporters (ABC) A1 mRNA and microsomal triglyceride transfer protein (MTP) activity levels were significantly decreased in PLTP KO small intestine.
Conclusion— These results indicate that PLTP deficiency results in reduced cholesterol uptake as well as secretion by the intestine. We suggest that PLTP could be a useful target to lower plasma cholesterol levels, thus reducing atherosclerosis.
PLTP deficiency results in reduced cholesterol uptake as well as secretion by the intestine. We suggest that PLTP could be a useful target to lower plasma cholesterol levels, thus reducing atherosclerosis.
Key Words: PLTP gene knockout • cholesterol absorption • intestine • enterocytes • lipoproteins
|
Introduction |
|---|
|
TopAbstractIntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
Lowering plasma cholesterol is of significant importance because high plasma cholesterol levels are associated with cardiovascular and metabolic disorders. A significant portion (30%) of plasma cholesterol is derived via the intestinal absorption.1 It is estimated that a 60% reduction in plasma cholesterol level could be achieved by 100% inhibition of cholesterol absorption.1 Cholesterol absorption is a multi-step process in which cholesterol is micellized by bile acids in the intestinal lumen, taken up by the enterocytes, assembled into lipoproteins, and transported to lymph. Accumulating evidence indicates that Niemann-Pick C1-like 1 (NPC1L1) protein plays a key role in the influx of cholesterol into enterocytes. NPC1L1 deficiency significantly reduces cholesterol absorption2 and has been shown to be the target of ezetimibe, a well-known cholesterol absorption inhibitor.3,4 The role of SR-BI in intestinal cholesterol absorption is controversial, and one report indicated that SR-B1 is involved in cholesterol absorption.5 However, SR-BI knockout (KO) mice do not show significant difference in cholesterol absorption compared with wild-type (WT) mice.6
After uptake, enterocytes excrete some of the cholesterol back to the intestinal lumen involving ATP-binding cassette transporters G5/G8 (ABCG5/G8 activity).7 Nonetheless, a majority of cholesterol taken up by enterocytes is transported to the plasma. It has been shown that this process may involve in at least two, apolipoprotein B (apoB)-dependent and apoB-independent, pathways.8,9 The apoB-dependent pathway requires apoB and microsomal triglyceride transfer protein (MTP) activity.8,9 Apolipoprotein AI and ABCA1 have been shown to play a role in the apoB-independent or the HDL pathway.10
Phospholipid transfer protein (PLTP) circulates bound to HDL and mediates the transfer of phospholipids as well as cholesterol from apoB-containing lipoproteins into HDL.11 PLTP overexpression in mice increased atherosclerosis.12–14 This has been attributed to decreased HDL levels12,13 and increased VLDL secretion.15 Ablation of PLTP in mice dramatically decreases cholesterol levels.11 PLTP deficiency reduced atherosclerosis in apoB-transgenic and apoE-deficient mice most likely because of the diminished production of hepatic apoB-lipoproteins.16 Later, decreased apoB-lipoprotein production was ascribed to postendoplasmic reticulum presecretory proteolysis of these particles because of increased oxidant tone in the PLTP-deficient livers.17 PLTP deficiency also improves the antiinflammatory properties of HDL and reduces the ability of LDL to induce monocyte chemotactic activity.18
PLTP is ubiquitously expressed and its function has long been considered to be confined to the plasma compartment. Accumulating evidence indicate that PLTP might play a role in lung surfactant metabolism,19 brain lipid metabolism,20 and formation of the tear film.21 These studies have raised the possibility that intracellular PLTP might play significant tissue specific functions in addition to its recognized role in the plasma compartment. So far, the function of PLTP in the intestine has not been explored. The current study led to an unanticipated result that PLTP-deficient mice absorb less cholesterol, and this could make a sufficient contribution to the hypocholesterolemia observed in the mice.
|
Methods and Materials |
|---|
|
TopAbstractIntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
Materials
[1,2-3H]Cholesterol and [9,10(N)-3H]triolein were purchased from NEN Life Science Products. [4-14C]Cholesterol and [9,10(N)-3H]oleic acid were from Amersham. [5,6-3H]Sitostanol was obtained from American Radiolabeled Chemicals.
Mice and Diet
Age- and sex-matched wild-type (WT) and PLTP KO mice in a C57BL/6 background were investigated in these studies. WT mice were purchased from the Jackson Laboratory (Maine). PLTP KO mice were created and bred in our laboratory.15 Mice had free access to water and rodent chow.
Cholesterol Absorption Studies
Two different protocols, short-term and long-term, were used to study cholesterol absorption as described previously.9,10 Percent cholesterol absorption was calculated as: 
|
|
Cholesterol Transport Across the Primary Enterocytes
Primary enterocytes were isolated from WT and KO mice and cultured at 37°C in a cell culture incubator with 5% CO2 as described before.10 For secretion studies, enterocytes were suspended in 4 mL of DMEM containing 0.2 µCi/mL of [3H]cholesterol and unlabeled cholesterol (0.5 mg/mL) and incubated for 20 minutes. Cells were washed twice and distributed into several tubes. At indicated times 3 tubes were centrifuged, and radioactivity present in the media was measured. At 0 time, radioactivity present in cells was quantified and considered as total cellular [3H]cholesterol (100%).
To characterize lipoprotein secretion, enterocytes were incubated in 4 mL of DMEM containing 1 µCi/mL of [3H]cholesterol for 1 hour, centrifuged (1500 rpm, 5 minutes), washed twice with DMEM, and incubated with micelles and subjected to density gradient ultracentrifugation to separate lipoproteins as previously described,9,10 fractions were collected, and radioactivity was measured. Cell pellets were incubated overnight at 4°C with 1 mL of isopropanol to isolate total lipids. After lipid extraction, 1 mL of 0.1 N NaOH was added to dissolve proteins. Protein was measured by the Bradford method using Coomassie reagent (Pierce Chemical Company).
Collection of Hepatic Biles and Lipid Analyses
Additional groups of the mice (n=5 per group) were examined for biliary lipid secretion studies according to published methods.22 Bile cholesterol, biliary phospholipids, total and individual bile salt were determined as described previously.23–25
Tissue Lipid Extraction and Analysis
Mouse small intestine (0.1g) was homogenized in 2 mL PBS, then 15 mL of CHCl3:CH3OH (2:1) and 6 mL of 0.05% H2SO4 were added to separate 2 phases. Organic phase (2 mL) was taken and dried down under N2. The extracted lipids were dissolved in 50 µL dimethyl sulfoxide and 6 µL of the solution was used for cholesterol, triglyceride, and phospholipid measurements using enzymatic methods (Wako Pure Chemical Industries Ltd).
Quantification of Gene Expression by Real-Time Polymerase Chain Reaction
Total RNA was extracted from jejunum using Trizol (Invitrogen), and cDNA was synthesized using a kit (Invitrogen). PCR was performed in triplicate using the SYBR Green PCR Master kit of Applied Biosystems. 18S rRNA was used as an internal control. The primers used for various mouse genes were as follows: NPC1L1 forward ATCCTCATCCTGGGCTTTGC and reverse GCAAGGTGATCAGGAGGTTGA; ABCG5 forward GCAGGGACCAGTTCCAAGACT and reverse ACGTCTCGCGCACAGTGA; ABCG8 forward AAAGTGAGGAGTGGACAGATGCT and reverse TGCCTGTGATCACGTCGAGTAG; ABCA1 forward TTGGCGCTCAACTTTTACGAA and reverse GAGCGAATGTCCTTCCCCA; HMGCoA reductase forward TCCAGAATCTACGGCACTT and reverse CCAATCACAAGGCATTCCAC; 18S rRNA forward AGTCCCTGCCCTTTGTACACA and reverse GATCCGAGGGCCTCACTAAAC.
Tissue PLTP Activity Assay
Mouse liver and small intestine (0.2 g) were homogenized in 0.5 mL of 50 mmol/L Tris-HCl, pH 7.4, 5 mmol/L EDTA, and 250 mmol/L sucrose. After 10 minutes spin at 3000 rpm, supernatants were retained and used for PLTP assay and protein determination. The procedure was same as reported.16
MTP Activity Assay
WT and PLTP KO small intestines (n=5) were homogenized and the supernatants were used to measure MTP transfer activity as described elsewhere.26 The supernatants (50 µg protein) were incubated with small unilamellar donor vesicles containing quenched fluorescent lipids (triacylglycerols) and acceptor vesicles made up of phosphatidylcholine. Increases in fluorescence attributable to MTP-mediated lipid transfer were measured after 30 minutes.
Statistical Analysis
Each experiment was conducted in triplicate and repeated at least 3 times. Data are expressed as mean±SD. Differences between groups were evaluated by Mann-Whitney U test (nonparametric test) and among multiple groups by ANOVA followed by the Post-Hoc test. Probability values less than 0.05 were considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
PLTP Expression in the Small Intestine
To determine whether intestine expresses PLTP, we performed Northern blot analysis by using total RNA extracted from the liver and intestine of mice. Both small intestine and the liver expressed a single transcript of approximately 1.8 kilobases, similar in length to that of human PLTP (supplemental Figure IA, available online at http://atvb.ahajournals.org). To understand the role of PLTP in the small intestine, we used PLTP KO mice that have no PLTP expression in the small intestine and the liver (supplemental Figure IA) as well as other tissues (data not shown). We also determined the PLTP activity in mouse small intestine and the liver and found both tissues contain comparable PLTP activity, whereas no such activity was detected in PLTP KO mice (supplemental Figure IB). We also found that the PLTP KO small intestine contains more cholesterol than that of WT (12.4±1.1 versus 15.7±1.5 µg/mg protein, P<0.05), whereas both small intestines contain same levels of phospholipid and triglyceride (supplemental Table I).
Long-Term Cholesterol Absorption Study
PLTP KO mice have significantly lower plasma cholesterol levels than WT mice.11,16 PLTP deficiency in small intestine could contribute to this phenotype. To explore the relationship between PLTP deficiency and cholesterol absorption, we used a long-term protocol designed to quantify smaller changes in cholesterol absorption.10 In this protocol, animals were gavaged 3 times a day (Figure 1A) with radiolabeled cholesterol and sitostanol along with unlabeled cholesterol in olive oil.10 The amounts of cholesterol absorbed were calculated by dual-isotope ratio method.10,27,28 During the first 24 hours, WT mice absorbed 
60% of the cholesterol (Figure 1B). This absorption was slightly decreased to 50% on day 5. To our surprise, PLTP KO mice absorbed significantly lower amounts on day 1 and continued to absorb significantly lower amounts throughout the feeding schedule (Figure 1B). Overall, PLTP KO mice absorbed 35% to 45% less cholesterol than the WT mice (P<0.01). These studies indicated that PLTP KO mice are less proficient in cholesterol absorption compared with their WT counterparts.
|
To understand the reasons for decreased cholesterol absorption, we measured radiolabeled cholesterol in the intestine, liver, and plasma of WT and KO mice. Mice were fed [14C]cholesterol 3 times a day for 2 days (Figure 1C and Table 1) and plasma, small intestine, as well as liver were collected 12 hours after the 6th feeding. The amounts of cholesterol present in most of the small intestinal segments of PLTP KO mice were significantly lower than those present in WT mice (Figure 1C). Overall, the small intestines, the plasma, and the liver from PLTP KO mice contained significant less [14C]cholesterol than WT animals (Table 1). These data indicated that the PLTP-deficient intestines contained less cholesterol and also transported less cholesterol to plasma.
|
To investigate whether the effect of PLTP deficiency was specific to cholesterol, we fed PLTP KO and WT mice with 0.1 µCi [3H]triolein instead of [14C]cholesterol 3 times a day for 2 days. No significant changes in the [3H]triolein derived counts in the plasma and tissues between the two groups of animals were observed (Table 1) indicating that PLTP deficiency has no effect on triglyceride absorption.
Short-Term Cholesterol Absorption Study
The above studies indicated that a significant difference in cholesterol absorption between the WT and PLTP KO mice could be observed within a day. In these studies, animals were subjected to 3 gavages per day. To determine the need for multiple gavages, we performed short-term cholesterol absorption studies after a single gavage using the conventional fecal dual-isotope ratio method.10,27,28 As shown in Table 2, there was also a significant reduction in cholesterol absorption (35%, P<0.001).
|
Furthermore, we measured the amounts of cholesterol present in the intestine and those transported to plasma in 24 hours after a single bolus of radiolabeled cholesterol (Table 2). PLTP KO mouse small intestines, plasma, and liver contained significantly less [14C]cholesterol than that of WT mice (Table 2). To study the specificity, we also studied absorption of triglycerides in PLTP KO and WT mice and did not find any significant differences in [3H]triolein-derived counts either in the circulation or in the tissues between the 2 groups of animals (Table 2). These studies indicated that PLTP mice were less efficient in absorbing cholesterol but had no difficulty in triglyceride absorption.
Decreased Cholesterol Uptake by PLTP-Deficient Enterocytes
The data presented above indicate that PLTP deficiency might affect intestinal uptake of cholesterol. To evaluate mechanisms, we measured the mRNA levels of 3 key proteins involved in cholesterol uptake. Relative intestinal mRNA levels of NPC1L1 were significantly lower than WT (45% of WT; Figure 2A), whereas ABCG5 and ABCG8 levels were not significantly changed (data not shown). Decreased NPC1L1 is expected to result in decreased cholesterol uptake by enterocytes. Indeed, PLTP-deficient enterocytes took up significantly lower [3H]cholesterol than the WT enterocytes (Figure 2B). In contrast, the uptake of [3H]oleic acid by the WT and KO enterocytes were similar (Figure 2C). These studies clearly indicate that PLTP deficiency leads to reduce cholesterol uptake.
|
It is reported that elevation of PLTP activity in mice results in rapid disposal of cholesterol from the body via increased conversion into bile acids and subsequent excretion.29 To investigate the effect of PLTP deficiency on biliary lipid compositions and concentrations, we measured cholesterol, phospholipids, and bile salts in the hepatic bile from chow-fed PLTP KO and WT mice. No significant differences were observed (supplemental Tables I and II).
Decreased Cholesterol Secretion by PLTP-Deficient Enterocytes
To determine the effect of PLTP deficiency on cholesterol secretion, enterocytes were isolated from PLTP KO and WT mice, incubated with radiolabeled cholesterol for 20 minutes, washed, and the secretion over time was studied. We found that the medium from PLTP KO enterocyte contained significantly less [14C]cholesterol than that of WT enterocytes (Figure 3A). However, we considered the possibility that decreased secretion was attributable to reduced uptake by these enterocytes. Thus, the data were replotted as percent secretion with respect to the intracellular counts (Figure 3B). PLTP KO enterocytes secreted less percentage of the intracellular [14C]cholesterol than the WT enterocytes (Figure 3B). Experiments were then performed to study the uptake and secretion of [3H]oleic acid. No significant changes were observed (Figure 3C). These data indicated that PLTP deficiency specifically decreased cholesterol secretion by enterocytes.
|
We have previously shown that enterocytes secrete cholesterol as a part of apoB-lipoproteins into lymph, and a part of HDL into the circulation.8–10 To determine which types of lipoproteins were affected by PLTP deficiency, enterocytes were incubated with radiolabeled cholesterol for 1 hour and then chased in the presence of oleic acid for 2 hours (Figure 4). PLTP KO enterocytes took up less (35%) (Figure 4A) and secreted less (45%, P<0.01) cholesterol than WT enterocytes (Figure 4B). The conditioned media was then subjected to density gradient ultracentrifugation to determine the effect of PLTP ablation on cholesterol secretion with chylomicrons and HDL (Figure 4C). Cholesterol secreted by control enterocytes was distributed in two separate fractions, corresponding to apoB lipoproteins (fractions 1 and 2) and HDL (fractions 8 to 10; Figure 4C). Similar analysis with PLTP KO enterocytes revealed that cholesterol secretion in both apoB lipoproteins and HDL were significantly reduced (52% and 48%, P<0.01, respectively). Considering the possibility that decreased secretion was attributable to reduced uptake by these enterocytes, we replotted the results as percent secretion with respect to the total counts present in cells and media. PLTP KO enterocytes secreted less cholesterol than the WT enterocytes in non-HDL and HDL fractions (Figure 4D). These studies indicated that cholesterol secretion by the chylomicron and HDL pathways were diminished in the PLTP-deficient animals.
|
We have shown previously that microsomal triglyceride transfer protein (MTP) and ABCA1 play a role in the secretion of cholesterol via these 2 pathways. Thus, we measured the MTP activity and ABCA1 mRNA levels in jejunal segments of WT and KO mice. The MTP specific activity was decreased by 30% whereas ABCA1 mRNA levels were reduced by 67%. These studies indicate PLTP deficiency affects cholesterol secretion by both chylomicron and HDL pathways.
|
Discussion |
|---|
|
TopAbstractIntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
The data presented here provide the first evidence that PLTP plays a role in intestinal cholesterol absorption. We observed that PLTP ablation results in decreased cholesterol uptake as well as secretion by enterocytes without affecting the uptake and secretion of fatty acids. Decreased uptake was correlated with lower mRNA levels of NPC1L1. The reduced cholesterol secretion by the enterocytes may be attributable to decreased secretion via both chylomicron and HDL pathways and was associated with lower levels of MTP activity and ABCA1 mRNA.
We considered the possibility that the decreased cholesterol absorption in PLTP KO mice could be related to reduction in bile acids. Post et al have suggested that elevation of PLTP activity in transgenic mice results in rapid disposal of cholesterol from the body, likely via its increased conversion into bile acids in the liver and subsequent excretion in the feces.29 Because these biliary factors could influence intestinal cholesterol absorption,30 we measured hepatic bile concentrations in these mice using high-performance liquid chromatography (HPLC) and did not find significant changes of cholesterol, phospholipids, and bile salts, as well as total lipid concentrations in the bile from PLTP KO mice, compared with WT mice. We also measured radioactivity in bile after [14H]-cholesterol feedings and did not find differences between PLTP KO and WT mice (supplemental Table II). Thus, decreased cholesterol absorption in the PLTP KO mice is probably not related to bile acid deficiency.
The present study shows that PLTP specifically regulates cholesterol uptake without affecting oleic acid uptake. We observed that PLTP deficiency decreased NPC1L1 (Figure 2A). This change could lead to decreased uptake. NPC1L1 has recently been shown to reside mainly in the intracellular organelles and is transported to plasma membrane when cells are deprived of micellar cholesterol.2,3 As the cholesterol-NPC1L1 interaction and structural assembly of NPC1L1 may influence the kinetics of net cholesterol movement across the cell membrane of enterocyte, it is crucial to investigate how structural protein integrity or assembly at the cell membrane level is maintained during the intestinal absorption of cholesterol. It is possible that PLTP deficiency affects phospholipid composition of subcellular organelles, such as plasma membrane and the endoplasmic reticulum, and alters subcellular transport of NPC1L1 resulting in reduced assimilation of cholesterol by enterocytes.
The reason why NPC1L1 mRNA is lower in PLTP KO small intestine (Figure 2A) could be because of the increase of cholesterol levels in the small intestine (supplemental Table I). It has been reported that cholesterol feeding results in downregulation of intestinal NPC1L1 and HMG-CoA reductase mRNA expression levels in WT mice.31 We also found that HMG-CoA reductase mRNA levels are significantly lower in PLTP KO small intestine than in WT (supplemental Figure II).
PLTP deficiency decreased cholesterol secretion with apoB-lipoproteins (Figure 4). The biosynthesis of apoB-lipoproteins involves an initial MTP-dependent lipidation resulting in the formation of primordial chylomicrons.8,32 Subsequently, these lipoproteins undergo "core expansion" resulting in the assembly and secretion of larger nascent chylomicrons.8,32 In this study, we observed a significant reduction in the intestinal MTP activity in PLTP KO mice indicating that PLTP could play a role in the first step of lipidation. Reduced MTP should affect both cholesterol and TG secretion, but we only observed the reduction of cholesterol but not triglyceride levels in the circulation. We do not know the reason so far. It might be attributable to the animals not being challenged with high-fat (triglyceride) diet. It has been reported that the apical media of differentiated Caco-2 cells, supplemented with oleic acid and taurocholate, secrete large chyclomicron, whereas such secretion is not possible without the supplementation.33
We have shown that PLTP activity is present in the Golgi apparatus of hepatocytes and suggested that it might play a role in the assembly and secretion of hepatic apoB-lipoproteins in certain atherogenic mice models.16 The Golgi apparatus is a major site of phospholipid synthesis34 and our previous observations indicate that addition or remodeling of phospholipids on nascent apoB-containing lipoprotein could involve PLTP.16 We also found that PLTP deficiency decreases liver vitamin E content, increases hepatic oxidant tone, and substantially enhances reactive oxygen species–dependent destruction of newly synthesized apoB via a post-ER process.35 In this study, we observed that cholesterol secretion with chylomicrons is impaired in PLTP-deficient mice (Figure 4). Because chylomicron assembly and secretion from enterocytes share common features with VLDL assembly by hepatocytes,8 PLTP deficiency may also play a role in the maturation of apoB-containing lipoprotein in enterocytes. Our findings are likely to be broadly relevant to apoB secretory control in vivo.
PLTP deficiency also decreased cholesterol secretion via the HDL pathway. We have shown that apoAI and ABCA1 play a role in this pathway.8–10 ABCA1 resides solely on the plasma membrane.36 ABCA1-dependent cholesterol export involves an initial interaction of apoAI with lipid raft membrane domains.37 It is conceivable that PLTP deficiency might influence lipid composition on the plasma membrane of entercytes, thus influence cholesterol efflux. Indeed, it has been reported that PLTP enhances cholesterol efflux from cells by interacting with ABCA1.38 The reason why ABCA1 mRNA and MTP activity are lower in PLTP KO small intestine is unknown. The detailed mechanism involved in the regulation of ABCA1 expression by PLTP requires further investigation.
In summary, we provided evidence to show that PLTP KO mice absorb less cholesterol. This was correlated with downregulation of NPC1L1, ABCA1, and MTP in the intestines. Using isolated enterocytes, we showed that low absorption was attributable to decreased cholesterol uptake as well as its secretion. PLTP KO mice have low plasma cholesterol levels and are resistant to diet-induced atherosclerosis. Decreased cholesterol absorption could be a mechanism contributing to low cholesterol levels and decreased atherosclerosis in these mice. Thus, PLTP might serve as a good candidate for therapeutic intervention, and its inhibition might be useful in lowering plasma cholesterol levels and decreasing atherosclerosis.
|
Acknowledgments |
|---|
Sources of Funding
This work was partially supported by grants DK54012 (to D.Q.-H.W.), DK46900 and HL64272 (to M.M.H.), and HL69817 (to X.C.J.).
Disclosures
None.
|
Footnotes |
|---|
Original received April 27, 2007; final version accepted July 2, 2007.
|
References |
|---|
|
TopAbstractIntroductionMethods and MaterialsResultsDiscussionReferences |
|---|
1. Gylling H, Miettinen TA. The effect of cholesterol absorption inhibition on low density lipoprotein cholesterol level. Atherosclerosis. 1995; 117: 305–308.[CrossRef][Medline] [Order article via Infotrieve]
2. Altmann SW, Davis HR Jr, Zhu LJ, Yao X, Hoos LM, Tetzloff G, Iyer SP, Maguire M, Golovko A, Zeng M, Wang L, Murgolo N, Graziano MP. Niemann-Pick C1 Like 1 protein is critical for intestinal cholesterol absorption. Science. 2004; 303: 1201–1204.
3. Garcia-Calvo M, Lisnock J, Bull HG, Hawes BE, Burnett DA, Braun MP, Crona JH, Davis HR, Dean DC, Detmers PA, Graziano MP, Hughes M, Macintyre DE, Ogawa A, O’neill KA, Iyer SP, Shevell DE, Smith MM, Tang YS, Makarewicz AM, Ujjainwalla F, Altmann SW, Chapman KT, Thornberry NA. The target of ezetimibe is Niemann-Pick C1-Like 1 (NPC1L1). Proc Natl Acad Sci U S A. 2005; 102: 8132–8137.
4. Yu L, Bharadwaj S, Brown JM, Ma Y, Du W, Davis MA, Michaely P, Liu P, Willingham MC, Rudel LL. Cholesterol-regulated translocation of NPC1L1 to cell surface facilitates free cholesterol uptake. J Biol Chem. 2006; 281: 286.
5. Bietrix F, Yan D, Nauze M, Rolland C, Bertrand-Michel J, Coméra C, Schaak S, Barbaras R, Groen AK, Perret B, Tercé F, Collet X. Accelerated lipid absorption in mice overexpressing intestinal SR-BI. J Biol Chem. 2006; 281: 7214–7219.
6. Mardones P, Quiñones V, Amigo L, Moreno M, Miquel JF, Schwarz M, Miettinen HE, Trigatti B, Krieger M, VanPatten S, Cohen DE, Rigotti A. J Lipid Res. 2001; 42: 170–180.
7. Berge KE, Tian H, Graf GA, Yu L, Grishin NV, Schultz J, Kwiterovich P, Shan B, Barnes R, Hobbs HH. Accumulation of dietary cholesterol in sitosterolemia caused by mutations in adjacent ABC transporters. Science. 2000; 290: 1771–1775.
8. Hussain MM, Fatma S, Pan X, Iqbal J. Intestinal lipoprotein assembly. Curr Opin Lipidol. 2005; 16: 281–285.[Medline] [Order article via Infotrieve]
9. Iqbal J, Anwar K, Hussain MM. Multiple, independently regulated pathways of cholesterol transport across the intestinal epithelial cells. J Biol Chem. 2003; 278: 31610–31620.
10. Iqbal J, Hussain MM. Evidence for multiple complementary pathways for efficient cholesterol absorption in mice. J Lipid Res. 2005; 46: 1491–1501.
11. Jiang XC, Bruce C, Mar J, Lin M, Yong J, Francone O, Tall AR. Targeted mutation of plasma phospholipid transfer protein gene markedly reduces high-density lipoprotein levels. J Clin Invest. 1999; 103: 907–914.[Medline] [Order article via Infotrieve]
12. van Haperen R, van Tol A, van Gent T, Scheek L, Visser P, van der Kamp A, Grosveld F, de Crom R. Increased risk of atherosclerosis by elevated plasma levels of phospholipid transfer protein. J Biol Chem. 2002; 277: 48938–48943.
13. Yang XP, Yan D, Qiao C, Liu RJ, Chen JG, Li J, Schneider M, Lagrost L, Xiao X, Jiang XC. Increased atherosclerotic lesions in apoE mice with plasma phospholipid transfer protein overexpression. Arterioscler Thromb Vasc Biol. 2003; 23: 1601–1607.
14. Lie J, de Crom R, van Gent T, van Haperen R, Scheek L, Sadeghi-Niaraki F, van Tol A. Elevation of plasma phospholipid transfer protein increases the risk of atherosclerosis despite lower apolipoprotein B-containing lipoproteins. J Lipid Res. 2004; 45: 805–811.
15. Lie J, de Crom R, van Gent T, van Haperen R, Scheek L, Lankhuizen I, van Tol A. Elevation of plasma phospholipid transfer protein in transgenic mice increases VLDL secretion. J Lipid Res. 2002; 43: 1875–1880.
16. Jiang XC, Qin S, Qiao C, Kawano K, Shucun Qin, Lin M, Skold A, Xiao X, Tall AR. Apolipoprotein B secretion and atherosclerosis are decreased in mice with phospholipid-transfer protein deficiency. Nat Med. 2001; 7: 847–852.[CrossRef][Medline] [Order article via Infotrieve]
17. Jiang XC, Li Z, Liu R, Yang XP, Pan M, Lagrost L, Fisher EA, Williams KJ. Phospholipid transfer protein deficiency impairs apolipoprotein-B secretion from hepatocytes by stimulating a proteolytic pathway through a relative deficiency of vitamin E and an increase in intracellular oxidants. J Biol Chem. 2005; 280: 18336–18340.
18. Yan D, Navab M, Bruce C, Fogelman AM, Jiang XC. PLTP deficiency improves the anti-inflammatory properties of HDL and reduces the ability of LDL to induce monocyte chemotactic activity. J Lipid Res. 2004; 45: 1852–1858.
19. Jiang XC, D’Armiento J, Mallampalli RK, Mar J, Yan SF, Lin M. Expression of plasma phospholipid transfer protein mRNA in normal and emphysematous lungs and regulation by hypoxia. J Biol Chem. 1998; 273: 15714–15718.
20. Vuletic S, Peskind ER, Marcovina SM, Quinn JF, Cheung MC, Kennedy H, Kaye JA, Jin LW, Albers JJ. Reduced CSF PLTP activity in Alzheimer’s disease and other neurologic diseases; PLTP induces ApoE secretion in primary human astrocytes in vitro. J Neurosci Res. 2005; 80: 406–413.[CrossRef][Medline] [Order article via Infotrieve]
21. Jauhiainen M, Setala NL, Ehnholm C, Metso J, Tervo TM, Eriksson O, Holopainen JM. Phospholipid transfer protein is present in human tear fluid. Biochemistry. 2005; 4422: 8111–8116.
22. Wang DQ-H, Lammert F, Paigen B, Carey MC. Phenotypic characterization of Lith genes that determine susceptibility to cholesterol cholelithiasis in inbred mice: pathophysiology of biliary lipid secretion. J Lipid Res. 1999; 40: 2066–2079.
23. Wang DQ-H, Paigen B, Carey MC. Phenotypic characterization of Lith genes that determine susceptibility to cholesterol cholelithiasis in inbred mice: physical-chemistry of gallbladder bile. J Lipid Res. 1997; 38: 1395–1411.[Abstract]
24. Bartlett GR. Phosphorous assay in column chromatography. J Biol Chem. 1959; 234: 466–468.
25. Rossi SS, Converse JL, Hofmann AF. High pressure liquid chromatographic analysis of conjugated bile acids in human bile: Simultaneous resolution of sulfated and unsulfated lithocholyl amidates and the common conjugated bile acids. J Lipid Res. 1987; 28: 589–595.[Abstract]
26. Athar H, Iqbal J, Jiang XC, Hussain MM. A simple, rapid, and sensitive fluorescence assay for microsomal triglyceride transfer protein. J Lipid Res. 2004; 45: 764–772.
27. Sehayek E, Ono JG, Shefer S, Nguyen LB, Wang N, Batta AK, Salen G, Smith JD, Tall AR, Breslow JL. Biliary cholesterol excretion: a novel mechanism that regulates dietary cholesterol absorption. Proc Natl Acad Sci U S A. 1998; 95: 10194–10199.
28. Wang DQ, Carey MC. Measurement of intestinal cholesterol absorption by plasma and fecal dual-isotope ratio, mass balance, and lymph fistula methods in the mouse: an analysis of direct versus indirect methodologies. J Lipid Res. 2003; 44: 1042–1059.
29. Post SM, de Crom R, van Haperen R, van Tol A, Princen HM. Increased fecal bile acid excretion in transgenic mice with elevated expression of human phospholipid transfer protein. Arterioscler Thromb Vasc Biol. 2003; 23: 892–897.
30. Wang DQ-H. Regulation of intestinal cholesterol absorption. Ann Rev Physiol. 2007; 69: 221–248.[CrossRef][Medline] [Order article via Infotrieve]
31. Davis HR Jr, Zhu LJ, Hoos LM, Tetzloff G, Maguire M, Liu J, Yao X, Iyer SP, Lam MH, Lund EG, Detmers PA, Graziano MP, Altmann SW. Niemann-Pick C1 Like 1 (NPC1L1) is the intestinal phytosterol and cholesterol transporter and a key modulator of whole-body cholesterol homeostasis. J Biol Chem. 2004; 279: 33586–33592.
32. Hamilton RL, Wong JS, Cham CM, Nielsen LB, Young SG. Chylomicron-sized lipid particles are formed in the setting of apolipoprotein B deficiency. J Lipid Res. 1998; 39: 1543–1557.
33. Luchoomun J, Hussain MM. Assembly and secretion of chylomicrons by differentiated Caco-2 cells. Nascent triglycerides and preformed phospholipids are preferentially used for lipoprotein assembly. J Biol Chem. 1999; 274: 19565–19572.
34. Fang M, Rivas MP, Bankaitis VA. The contribution of lipids and lipid metabolism to cellular functions of the Golgi complex. Biochim Biophys Acta. 1998; 1404: 85–100.[Medline] [Order article via Infotrieve]
35. Jiang XC, Tall AR, Qin S, Lin M, Schneider M, Lalanne F, Deckert V, Desrumaux C, Athias A, Witztum JL, Lagrost L. Phospholipid transfer protein deficiency protects circulating lipoproteins from oxidation due to the enhanced accumulation of vitamin E. J Biol Chem. 2002; 277: 31850–31856.
36. Lawn RM, Wade DP, Garvin MR, Wang X, Schwartz K, Porter JG, Seilhamer JJ, Vaughan AM, Oram JF. The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway. J Clin Invest. 1999; 104: R25–R31.[Medline] [Order article via Infotrieve]
37. Gaus K, Kritharides L, Schmitz G, Boettcher A, Drobnik W, Langmann T, Quinn CM, Death A, Dean RT, Jessup W. Apolipoprotein A-1 interaction with plasma membrane lipid rafts controls cholesterol export from macrophages. FASEB J. 2004; 18: 574–576.
38. Oram JF, Wolfbauer G, Vaughan AM, Tang C, Albers JJ. Phospholipid transfer protein interacts with and stabilizes ATP-binding cassette transporter A1 and enhances cholesterol efflux from cells. J Biol Chem. 2003; 278: 52379–52385.
This article has been cited by other articles:
 |
|
 |
|
  A. Schlitt, S. Blankenberg, C. Bickel, K. J. Lackner, G. H. Heine, M. Buerke, K. Werdan, L. Maegdefessel, U. Raaz, H. J. Rupprecht, et al. PLTP activity is a risk factor for subsequent cardiovascular events in CAD patients under statin therapy: the AtheroGene Study J. Lipid Res., April 1, 2009; 50(4): 723 - 729. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Masson, X.-C. Jiang, L. Lagrost, and A. R. Tall The role of plasma lipid transfer proteins in lipoprotein metabolism and atherogenesis J. Lipid Res., April 1, 2009; 50(Supplement): S201 - S206. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Shelly, L. Royer, T. Sand, H. Jensen, and Y. Luo Phospholipid transfer protein deficiency ameliorates diet-induced hypercholesterolemia and inflammation in mice J. Lipid Res., April 1, 2008; 49(4): 773 - 781. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||