| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Biology |
From the Departments of Surgery (F.A.K., A.M., S.P.M., J.M.P., T.N.F., T.S.W., J.C.F., C.K.B., C.H.C., G.T., A.D.) and Pharmacology (S.B., W.C.S.) and the Interdepartmental Program in Vascular Biology and Transplantation (C.K.B., G.T., W.C.S., A.D.), Yale University School of Medicine, New Haven, Conn; the VA Connecticut Healthcare System (C.H.C., G.T., A.D.), West Haven, Conn; and the Fujita Health University (T.N.), Nagoya, Japan.
Correspondence to Alan Dardik, MD, PhD, Yale University School of Medicine, Boyer Center for Molecular Medicine, 295 Congress Ave, Room 436, New Haven, CT 06519. E-mail alan.dardik{at}yale.edu
| Abstract |
|---|
|
|
|---|
Methods and Results Eph-B4 transcripts and immunodetectable protein are downregulated in endothelial and smooth muscle cells of patent vein grafts in both humans and in aged rats, whereas Ephrin-B2 transcripts and protein are not strongly induced. Other markers of arterial identity, including dll4 and notch-4, are also not induced during vein graft adaptation in aged rats. Because VEGF-A is upstream of the EphrinEph pathway, and expression of VEGF-A is induced only at early time points after exposure of the vein to the arterial environment, we inhibited VEGF-A in vein grafts using an siRNA-based approach. Vein grafts treated with siRNA directed against VEGF-A demonstrated a thicker intima-media containing
-actin, consistent with arterialization, but did not contain Eph-B4 or Ephrin-B2.
Conclusions Venous identity is preserved in the veins of aged animals, but is lost during adaptation to the arterial circulation; arterial markers are not induced. Markers of vessel identity are plastic in adults and their selective regulation may mediate vein graft adaptation to the arterial environment in aged animals and humans.
In human and aged rat vein graft adaptation, Eph-B4, a marker of venous identity, is downregulated, whereas markers of arterial identity such as Ephrin-B2 are not induced. These results suggest that markers of vessel identity that are developmentally regulated are plastic in adults.
Key Words: vein graft adaptation venous identity Eph-B4 Ephrin-B2 remodeling smooth muscle cells
| Introduction |
|---|
|
|
|---|
The natural history of normal human vein graft adaptation is incompletely described, as excision of patent vein grafts that have adapted well to the arterial circulation is not ordinarily performed for ethical reasons; furthermore, reported specimens are often taken from abnormal or failing vein grafts.15 In addition, although in vitro and in vivo models of vein graft adaptation to the arterial circulation are well described, the regulation of this complex process by factors unique to aged hosts, which are relevant to elderly patients undergoing bypass surgery, is not well understood. Similarly, many of the in vitro models, noted above, have only examined arterial endothelial responses to shear stress, not venous endothelial responses.
Advances in developmental biology have demonstrated that there are genetic predeterminants of arterial and venous endothelium, and the molecular distinction between arteries and veins is becoming established.16 How genes are regulated during vein graft adaptation is beginning to be explored3,17,18; however, there are little data regarding regulation of genes associated with arterial or venous identity, in postnatal adults and aged animals. The Ephrin ligands and Eph receptors are an important class of signaling molecules that are differentially expressed on arteries and veins.19 Ephrin-B2 is a marker of arterial endothelium and smooth muscle and persists into adult vessels.2022 Conversely, Eph-B4 is a marker of venous cells.22,23 Although it is not currently reported whether Ephrin-B2 or Eph-B4 expression in vessels is regulated during normal or pathological aging, nor during vein graft adaptation, it is likely that altered patterns of Ephrin or Eph expression may play a role in vein graft adaptation.
To establish the pattern of Ephrin-B2 and Eph-B4 gene expression during normal human vein graft adaptation, we report the analysis of several rare specimens of patent human vein grafts. We also describe an in vivo rat model of vein graft adaptation that considers host age and shows a similar pattern of Ephrin-B2 and Eph-B4 expression in remodeled rat and human vein grafts. Because VEGF-A may be an upstream regulator of Ephrin-B2 and Eph-B4,24,25 these results also suggest a mechanistic role for VEGF-A during vein graft adaptation in aged hosts.
| Methods |
|---|
|
|
|---|
Animal Vein Graft Model
Young adult (6-month) and aged (24-month) male Fischer 344 strain rats (380 to 430 gm) were obtained from the National Institute of Aging Rodent Colony (Bethesda, Md).26 Rats were raised in pathogen-free conditions at the NIA and housed locally at least 1 week before surgery. All experiments were approved by the Institutional Animal Care and Use Committee.
Aged and young adult rats underwent autologous jugular vein to carotid artery reverse interposition grafting using intraperitoneal ketamine/xylazine/acepromazine anesthesia. Briefly, the distal right external jugular vein was dissected, and side branches were ligated via a midline neck incision. An 8-mm segment of vein was harvested and sutured into the divided ipsilateral common carotid artery using interrupted 100 nylon suture. After measurement of diameter and flow, the wound was closed. No heparin was used during the procedure.
Vein grafts were harvested at 6 to 72 hours, or 7 or 21 days after surgery using accepted euthanasia technique. After exsanguination under anesthesia, vein grafts were flushed with heparinized saline followed with pressure perfusion fixation with 10% formalin and embedded in paraffin. Tissues harvested for RNA isolation were fresh frozen in liquid nitrogen (LN2).
Hemodynamic Measurement
Because anesthesia using xylazine can produce significant reduction in cardiac output,27 xylazine and acepromazine were avoided for these measurements, and the combination of ketamine (100 mg/kg) and diazepam (10 mg/kg) was used. Mean arterial pressure (MAP) was measured by catheterization of the right femoral artery and recorded continuously; the external zero reference was placed at the level of the heart. Cardiac output (CO) was measured by the thermodilution technique as previously reported.28
Functional Study
Jugular veins, vein grafts, and carotid arteries were carefully exposed and quickly excised. Vessels were mounted in a myograph (Danish Myo Technology) by cannulating both ends and placed in modified Krebs-Ringer solution (pH 7.4, 37°C, 95%O2/5%CO2). Vessel diameters were determined by measuring the external diameters; the pressure at both ends of the vessel was monitored using 2 pressure transducers, placed equidistantly at the vessel ends, and the mean of these pressures is representative of the lumen pressure. Vessels were equilibrated for 30 minutes, and the pressure was increased in step-wise fashion from 0 to 200 mm Hg, both in regular and calcium-free buffer containing EGTA (2 mmol/L). Cross-sectional compliance was calculated as [(
xD12/4)(
xD02/4)]/(P1P0) for each step in pressure.
Immunohistochemistry
Five-micron cross sections were taken from the center of the graft, and staining was performed for Hematoxylin & Eosin, Masson trichrome, and van Gieson elastin, as well as immunohistochemistry for von Willebrand factor (vWF), alpha smooth muscle actin, calponin, sm22 alpha, PCNA, monocyte/macrophage (ED1), and Nogo-B. Antigen retrieval was performed using 10 mmol/L citrate buffer at pH 6.0. Sections were counterstained with Mayers Hematoxylin. Negative control specimens were included for all groups.
Immunofluorescence
Samples were fixed with 4% paraformaldehyde, embedded in OCT, and sections cut at 5 µm thickness. Primary antibodies included Ephrin-B2, Eph-B4, and alpha actin. Alexa Fluor 488 and 568 were used for fluorescence. All samples were treated by autofluorescent eliminator reagent (Chemicon) and counterstained with DAPI. Images were captured with an Axioimager A1 (Carl Zeiss) under identical conditions.
Morphometry
Vessel cross sections were measured for intima, media, and total vessel thickness in at least 8 sections, using NIH ImageJ software. Areas of positive immunostaining were measured using image analysis (MetaMorph software) in blinded fashion. Relative density was graphed in arbitrary units.
RNA Extraction and Real-Time Quantitative Polymerase Chain Reaction
Total RNA was isolated from each vessel with TRIzol Reagent (Invitrogen) and was cleaned with the RNeasy Mini kit (Qiagen). For quantification of total RNA, each sample was measured using the RiboGreen RNA assay kit (Molecular Probes), and RNA quality was confirmed by 1.2% formaldehyde-agarose gel electrophoresis. Reverse transcription was performed using the SuperScript III First-Strand Synthesis Supermix kit (Invitrogen). Primers were used as previously described.29,30 Real-time quantitative polymerase chain reaction (PCR) was performed by using SYBR Green Supermix (BioRad) and amplified with the iQ5 Real-Time PCR Detection System (BioRad). All samples were confirmed by sequence analysis and 2% agarose gel electrophoresis for correct target amplification and exclusion of non-specific amplification. All samples were normalized to GAPDH amplification and graphed in arbitrary units, setting the amount of GAPDH amplification to 1.0.
VEGF siRNA Transfection In Vitro and In Vivo
RNA oligonucleotides were synthesized by Dharmacon using the siRNA sequence for rat VEGF-A AUGUGAAUGCAGACCAAAGAA as previously described.31 The control RNA primer was siCONTROL Nontargeting siRNA #1 (Dharmacon). For in vitro testing, rat aortic smooth muscle cells (SMCs) were isolated from male adult rats using the collagenase technique, seeded at a density of 1x105 cells/mL in complete growth medium on 24-well plates, and were exposed, at
60% confluence, to VEGF siRNA/polyethylenimine (PEI; Polyplus transfection) (100 nmol/L), or nontargeting siRNA/PEI, in the presence of Opti-MEM I reduced serum medium. After overnight transfection, cells were exposed to hypoxia (1.2% O2/94% N2/5% CO2), lipopolysaccharide (LPS; 100 ng/mL), or deferoxamine (50 µmol/L) for 48 hours. The supernatant was taken from control and treated cells and analyzed for VEGF secretion by ELISA.
For in vivo experiments a mixture of 70 µL VEGF siRNA/PEI at N/P ratio of 10 (50 µg of siRNA +10 µL of PEI) was dissolved in 130 µL of 30% pluronic F-127 gel (Invitrogen) in 5% glucose solution. The complex (200 µL) was applied to the surface of the vessel after completion of the jugular vein anastomoses and restoration of flow, or directly on control vessels. The control vein graft groups were treated with either saline, 200 µL pluronic gel, or 200 µL of nontargeting siRNA/PEI/pluronic gel. Control vessels that were transfected in vivo were harvested after 48 hours; vein grafts were harvested after 21 days.
Statistical Analyses
Results are reported as mean±SEM. Groups were compared by analysis of variance. All tests were 2-tailed and probability values
0.05 were considered statistically significant (Statview 5.0, SAS Institute).
| Results |
|---|
|
|
|---|
-actin, SM22
, calponin, or Nogo-B (first column of Figure 1B and supplemental Figure IB). However, patent human vein grafts demonstrate significantly more immunostaining for intimal SMCs, staining strongly positive for
-actin, SM22
, and calponin, compared with the saphenous veins (second column of Figure 1B and supplemental Figure IB). In addition, we examined Nogo-B, a protein that is downregulated in injury-associated neointima,32 in the patent human vein graft; intimal SMCs demonstrated increased immunoreactive Nogo-B (supplemental Figure IB). The increased density of intimal
-actin and Nogo-B is quantified in supplemental Figure IC. CD45+ leukocytes were only sparsely found in the adventitia of the saphenous vein and vein graft, without significant accumulation in the patent vein grafts (data not shown), consistent with lack of ongoing inflammation in patent vein grafts.
|
Because Ephrin-B2 is a marker of arteries and Eph-B4 is a marker of veins that have been described during embryonic and young animal development,1923 we examined whether these markers were present on saphenous veins and patent vein grafts in adult humans. Eph-B4, a venous marker, was expressed in the endothelium of saphenous veins and strongly expressed in the media, and was significantly diminished in vein grafts placed in the arterial circulation; Ephrin-B2, an arterial marker, was weakly detectable in saphenous vein endothelium and media and not induced in patent vein grafts (higher magnifications in Figure 1C); Ephrin-B2 was detectable in human arteries (data not shown). Both Ephrin-B2 and Eph-B4 in these specimens, where detected in the media, colocalized with
-actin+ SMC (yellow color in Figure 1C). These immunostaining changes are quantified in Figure 1D (left panel). To determine whether reduced Eph-B4 immunostaining reflected reduced gene expression, we used quantitative PCR to examine transcripts for Eph-B4 and Ephrin B2; similar to the changes in immunodetectable protein, there was reduced transcript expression of Eph-B4 and no induction of Ephrin-B2 (Figure 1D, right panel). These results are consistent with strongly diminished expression of the venous phenotype marker Eph-B4 and no induction of the arterial phenotype marker Ephrin-B2 during normal human vein graft adaptation.
Vein Graft Adaptation in Aged Rats Mimics Human Vein Graft Adaptation
To establish our in vivo model, the distal jugular vein of aged (22 to 24 months) Fischer 344 rats was placed as an autologous interposition graft into the ipsilateral carotid artery, and explanted and examined after 7 or 21 days (Figure 2). Figure 2A demonstrates early cellular infiltration at 7 days, depicted by H&E staining, and intima-media thickening at both 7 and 21 days after implantation of the vein into the arterial circulation. The intima and media are measured together as the rat jugular vein has no well-defined IEL, only a single "external" elastic lamina (EL) between the media and adventitia, as noted with the yellow arrowheads (supplemental Figure II); the intima-media in this model is analogous to the human thickened intima and media layers in human patent vein grafts (Figure 1A). Figure 2B demonstrates quantitative analysis of remodeling in this model, with increased thickness of the vein graft intima-media at 7 and 21 days. Young adult (6 months) rats were similarly used to place interposition vein grafts in the carotid artery; however, there was less cellular infiltration at 7 days and a thinner intima-media layer at both 7 and 21 days compared with that present in aged rats (supplemental Figure II, bottom panels).
|
The thickened intima-media of aged rats, compared with young adult rats, occurred under identical hemodynamic conditions in the different age animals, with no differences in graft diameter, flow, or shear stress either immediately after implantation or after 21 days of adaptation (Table). In addition, aged and young adult rats had similar heart rates (377±24 bpm versus 376±6 bpm; P=0.96), blood pressure (116±10 mm Hg versus 113±1 mm Hg; P=0.83), and cardiac output (129±11 mL/min versus 110±13 mL/min; P=0.31). Compliance of the vein grafts after 21 days was similar in aged and young adult rats, under both venous (low pressure) and arterial (high pressure) conditions (Table). There was no difference in mean serum values of white blood cell count, hematocrit, or platelets, nor of creatinine, total protein, or albumin, between aged and young adult rats (data not shown).
|
Supplemental Figure III demonstrates the preservation of the endothelial integrity, with immunostaining for vWF, at 7 and 21 days in this model; preservation of the endothelial monolayer demonstrates that intima-media thickening in this model reflects thickening of the media. Also seen are the presence of underlying SMCs at both 7 and 21 days using several SMC markers of the contractile phenotype, including
-actin, SM-22
, and calponin, as well as Nogo-B. At 21 days, the thickened intima-media of the vein graft has several layers of SMCs, consistent with mature SMCs and the process of vein graft adaptation to the arterial environment. In addition, there are rare
-actincontaining cells in the vein graft adventitia after 21 days; vein grafts in young adult rats demonstrated the presence of SMC markers only in the adventitia of the vein grafts (data not shown). Supplemental Figure III (fifth row) also shows that Nogo-B is detectable in the intima-media of vein grafts placed for 7 or 21 days into the arterial circulation. This pattern of vein graft adaptation seen after 21 days in the aged, but not young adult rats, namely a thickened intima-media that has SMC with immunoreactive Nogo-B, mimics the pattern seen in patent human vein grafts (supplemental Figure IB). In addition, macrophages (ED1+) are present at 7 days, but markedly decreased by 21 days, during vein graft adaptation in aged rats (data not shown).
Because human vein graft adaptation is associated with strongly diminished expression of the venous phenotype marker Eph-B4 and no induction of the arterial phenotype marker Ephrin-B2 (Figure 1C and 1D), we used quantitative PCR to examine the expression of Eph-B4 and Ephrin-B2 transcripts during vein graft adaptation in aged rats (Figure 3A). The venous marker Eph-B4 was detectable in higher amounts in the jugular vein compared with the carotid artery, as expected; the vein graft had less detectable Eph-B4 than the jugular vein and similar amounts as expressed in the carotid artery (Figure 3A), suggesting downregulated expression of transcripts for the venous marker Eph-B4 during vein graft adaptation in aged rats. The arterial marker Ephrin-B2 was detectable in higher amounts in the carotid artery compared with the jugular vein; however, no increase in Ephrin-B2 mRNA was detectable in the vein graft compared with jugular vein (Figure 3A). As a control experiment, because expression of Ephrin-B2 is not induced during vein graft adaptation, we confirmed that Ephrin-B2 expression is detectable in cultured rat arterial SMCs. RT-PCR was performed using mRNA isolated from rat arterial SMC; Ephrin-B2, an arterial marker, but not Eph-B4, a venous marker, was detectable in cultured cells (data not shown).
|
To confirm the decrease in Eph-B4 gene expression and lack of stimulation of Ephrin-B2 gene expression during vein graft adaptation in aged rats, we used immunofluorescence to confirm the localization and changes of these markers. Eph-B4, a venous marker, was expressed in aged rat jugular veins (Figure 3B), both in the endothelium and the
-actinpositive medial SMCs (Figure 3C); Eph-B4 was strongly diminished, but not completely eliminated, in the intima-media of vein grafts placed in the arterial circulation (Figure 3B and 3C). Ephrin-B2, an arterial marker, was weakly detectable in the endothelium and medial SMCs of aged rat jugular veins and not strongly induced in vein grafts (Figure 3B); Ephrin-B2 was detectable in both the endothelium and the media of the aged rat carotid artery (Figure 3B). These results, strongly diminished detection of Eph-B4 and little induction of Ephrin-B2 in rat vein grafts, confirm the similar results seen with gene expression (Figure 3A) and are consistent with strongly diminished expression of venous phenotype markers and no induction of arterial phenotype markers during normal human vein graft adaptation (Figure 1C and 1D). During vein graft adaptation in young adult rats, changes in Eph-B4 immunofluorescence were more limited, with less inhibition of Eph-B4 expression and limited to adventitial SMC in vein grafts (data not shown).
Because the expression of Ephrin-B2, a marker of arterial identity, is not induced by 21 days during vein graft adaptation, we determined whether there were changes in expression of other markers of arterial identity, including dll-4, jagged-1 and -2, and notch-1, -3, and -4. There were no significant changes in expression of any of these other markers of arterial identity, compared with expression levels in the preimplantation vein (Figure 3D). These results confirm that expression of markers of arterial identity is not stimulated during vein graft adaptation in aged rats.
VEGF-A Is Required for Diminished Eph-B4 Expression in Vein Grafts
Because VEGF-A can stimulate expression of the Ephrin pathway members,33,34 we determined whether VEGF-A expression was detectable during vein graft adaptation. Although VEGF-A expression was induced during vein graft adaptation by 6 hours of implantation, there was strongest expression of VEGF-A at 24 hours after implantation that was afterward downregulated by 72 hours (Figure 4A); diminished VEGF-A expression at 72 hours was coincident with diminished Eph-B4 expression (Figure 4B). VEGF-A expression remained decreased at 21 days (Figure 4C), coincident with continued diminished Eph-B4 expression at 21 days (Figure 3A); expression of VEGFR2 transcripts was unchanged at 21 days (Figure 4C). These results suggest that VEGF-A gene expression is induced early in vein graft adaptation, but that its expression is downregulated during later phases of vein graft adaptation in aged rats, and that VEGF-A downregulation during later phases may be associated with intima-media thickening.
|
To determine whether VEGF-A plays a mechanistic role during vein graft adaptation in aged rats, we used an siRNA-based approach to reduce VEGF-A expression, and test whether early reduction in VEGF-A levels would change later Eph-B4 expression and the extent of intima-media thickening in vein grafts. The specificity of an siRNA targeting VEGF-A was determined by the ability to reduce VEGF-A secretion in rat aortic SMC under 3 different stimuli that normally induce VEGF-A secretion.35 Rat aortic SMCs were transfected with this siRNA using polyethylenimine, or control noncoding, scrambled siRNA; transfection efficiency was directly counted and found to be approximately 98% (supplemental Figure IVA). VEGF-A secretion was reduced compared with control siRNA for each of these 3 stimuli (supplemental Figure IVB), confirming the specificity and function of the siRNA in vitro. In addition, we confirmed the ability of this siRNA to inhibit VEGF-A expression in vivo; siRNA dissolved in pluronic gel was placed on the adventitia of carotid arteries and found to diminish endogenous expression of VEGF-A by approximately 40% at 48 hours (supplemental Figure IVC).
siRNA directed against VEGF-A, or noncoding control siRNA, was dissolved in pluronic gel and placed on the adventitia of newly surgically placed vein grafts; grafts were harvested 21 days later. Consistent with the hypothesis that Eph-B4 is downstream of VEGF-A, siRNA directed against VEGF-A almost completely prevented detection of what little immunoreactive Eph-B4 was still present after 21 days (higher magnification and exposure, Figure 5A, first row). However, grafts treated with siRNA that inhibits VEGF-A also had greatly increased intima-media thickness compared with grafts treated with pluronic gel alone or control siRNA (Figure 5A, second row); this intima-media stained positively for
-actin (Figure 5A, third row). Quantitative morphometric data are shown in Figure 5B and confirms that VEGF-A knockdown results in increased intima-media thickening. These results suggest that early expression of VEGF-A is a mechanism by which vein grafts downregulate Eph-B4 expression during long-term adaptation to the arterial environment.
|
| Discussion |
|---|
|
|
|---|
-actin, SM-22
, calponin, and Nogo-B. Aged rats and humans express similar changes of Ephrin-B2 and Eph-B4 expression in remodeled rat and human vein grafts, suggesting that loss of venous identity is a crucial mechanism in vein graft adaptation; early expression of VEGF-A may mediate these long-term changes during vein graft adaptation. These findings also suggest that vascular adaptation in elderly humans and animal models may not exactly recapitulate changes in gene expression that occur during embryogenesis, but that selective expression of subsets of vascular determinant genes may be adequate to mediate plasticity in the adult vascular system. Using patent human vein grafts, we determine that human vein graft adaptation is associated with intimal thickening, largely comprised of mature SMCs that spatially localize with decreased Eph-B4 expression, and show little induction of Ephrin-B2 expression (Figure 1C and 1D). These results suggest that vein graft adaptation is largely associated with loss of venous identity, rather than stimulation of arterial identity. Because a shift from venous to arterial identity has been associated with pathological transformation, such as the induction of Ephrin-B2 expression during development of Kaposi sarcoma and hepatocarcinoma, increased expression of arterial determinants may not be consistent with or necessary for normal vein graft adaptation.36,37 Our finding that Ephrin-B2 mRNA is reduced during human vein graft adaptation, whereas the protein is unchanged, may reflect biological variation in our small number of samples or potential differences in time points between specimen collection; however, both rat and human data show that Ephrin-B2 expression is not induced. The consistency of Eph-B4 mRNA and protein downregulation in both human and rat vein graft adaptation suggests the utility of the rat as a model for the human process. As additional markers of arterial and venous identity are described, and these markers have specificity for the rat, they could be used to more completely characterize vein graft adaptation.38 For example, neuropilin-1 has a similar distribution to arteries and Ephrin-B2 in the chick embryo, whereas neuropilin-2 has a similar distribution to veins.39 However, in our rat model, both neuropilin-1 and neuropilin-2 are strongly induced during vein graft adaptation, in both young adult and aged rats (data not shown). Nonetheless, our finding that Eph-B4 is downregulated during vein graft adaptation in humans and aged animals suggests that determinants of vessel identity expressed during embryogenesis may be plastic, even in aged adults.
We demonstrate a difference in vein graft adaptation between young adult and aged rats, with increased intima-media thickening in aged rats compared with young adult rats (Figure 2). In addition, aged rats do not show the adventitial
-actinpositive cells ("adventitial myofibroblasts") that are seen in young adult rats. Because we do not examine late time points, because of the mortality of aged rats, it is possible that young adult rats might develop similar intima-media thickening at later time points. However, our finding that intima-media thickening in aged rats is associated with incomplete induction of several members of the Notch pathway, such as dll-4 and notch-4, and Ephrin-B2 expression (Figure 3A and 3D), compared with strong induction in young adult rats (data not shown), suggests that 21 days is an adequate end point to assess changes in gene expression during vein graft adaptation. Because changes in morphology and gene expression during vein graft adaptation in aged rats appears similar to those seen in human vein graft adaptation, we believe that using aged rats as a model for humans is reasonable, although limited because of rat specificity of many reagents as well as the inability to perform complex genetic manipulations in the rat.
Our finding that VEGF-A expression is induced at 24 hours and downregulated at 21 days is consistent with the data from Westerband et al.6 Strong induction of VEGF-A expression at 24 hours is consistent with the interpretation that early expression of VEGF-A mediates normal vein graft adaptation, and provides rationale to inhibit expression at early time points using an siRNA-based approach. Using this approach we demonstrate that early inhibition of VEGF-A in vivo leads to even further decreased detection of Ephrin-B2 (data not shown) and Eph-B4 (Figure 5A) during long-term vein graft adaptation, which is not surprising as Ephrin-B2 and Eph-B4 are downstream of VEGF-A in other reports. However, we find that intima-media thickening at 21 days is strongly induced by early inhibition of VEGF-A and the concomitant later decrease in Eph-B4. This finding leads us to speculate that long-term changes in Eph-B4 expression may inhibit intima-media thickening, or that Ephrin-B2 may stimulate intima-media thickening; because Ephrin-B2 is not detectable (data not shown), we favor the former explanation. The finding that diminished VEGF-A gene expression during long-term vein graft adaptation (Figure 4C) is associated with intima-media thickening is consistent with previous reports demonstrating that exogenous VEGF-A inhibits intima-media thickening in vein grafts.14
It is possible that the Notch pathway may mediate the changes of VEGF-A on Eph-B4 expression. This is consistent with in vitro data showing that VEGF-A downregulates Eph-B4 expression in HUVECs by the Notch pathway.37 We also find that the Notch pathway is induced in young adult rats, consistent with its downstream stimulation by VEGF-A, but that expression of the Notch ligand dll-4 and the Notch receptor notch-4 are not induced in aged rats (Figure 3D). Age-dependent differences in activation of Notch has been previously described, and our data are consistent with this finding.40,41 Because Ephrin expression can be induced by members of the Notch pathway,37,42 it is possible that the effects of VEGF-A during vein graft adaptation are at least partially mediated by the Notch pathway. In addition, the diminished induction of the Notch pathway in aged rats, compared with the induction in young adult rats, may enhance diminution of Eph-B4 and promote vein adaptation to the arterial environment.34
Acute exposure to increased pressure and shear stress stimulates endothelial cell signal transduction in multiple in vitro and in vivo models.811,43 This work has led to the recognition of the importance of hemodynamic factors in determining endothelial phenotype.44 Kwei et al have reported endothelial expression of E-selectin and vascular cell adhesion molecule (VCAM)-1 as early characteristics of vein graft adaptation to arterial flow.3 Although human data remains elusive, early dog models of vein graft adaptation demonstrate that preservation of a functional endothelial monolayer during vein graft adaptation is a critical determinant of vein graft function.1,2 The importance of the endothelial monolayer to graft patency has been demonstrated by the ability of this monolayer to provide superior patency for prosthetic grafts.45 Because chronic exposure to arterial magnitudes of shear stress increases the ability of endothelial cells lining vascular grafts to adhere to their underlying substratum,46,47 our finding of a preserved endothelial monolayer in our model (supplemental Figure III) suggests that endothelial cells may be the source of early VEGF-A expression in vein grafts (Figure 4). This is also consistent with our finding of a confluent monolayer in patent human vein grafts (supplemental Figure IA), as well as downregulated expression of the VEGF receptor (Figure 4C). The endothelial monolayer may also directly stimulate Eph-B4 downregulation, potentially by a shear stressinduced mechanism directly sensed by endothelial cells; however, it is also possible that smooth muscle cells directly downregulate Eph-B4 by a pressure- or stretch-induced mechanism. Little is known regarding regulation of Eph-B4 expression in adult cells, whereas Ephrin-B2 is expressed during adult angiogenesis, both in endothelial cells as well as in smooth muscle cells.20 Although expression of Ephrin-B2 on aortic endothelial cells is modified by contact with smooth muscle cells,25 we demonstrate that expression of Ephrin-B2 is not induced during vein graft adaptation in spite of accumulation of SMC below the endothelium (Figures 1 and 3
). The relative importance of Eph-B4 in venous adaptation to the arterial environment suggests that selective expression of vascular determinant genes mediates plasticity of the adult vascular system even though these changes do not entirely recapitulate those that occur during embryogenesis. However, definitive genetic determination of whether the endothelium is the source of VEGF-A, and downstream Ephrin signaling, is currently beyond the capability of the rat model.
In conclusion, we demonstrate for the first time that vein graft adaptation results in loss of venous identity, but not in gain of molecular markers of arterial identity. Our work supports the plasticity of vascular markers and demonstrates the modulatory influence of hemodynamic changes on developmentally-determined vascular identity.
| Acknowledgments |
|---|
This work was supported by the Dennis W. Jahnigen Career Development Scholarship Program, which is administered by the American Geriatrics Society through an initiative funded by The John A. Hartford Foundation of New York City and The Atlantic Philanthropies, the Wylie Scholar in Academic Vascular Surgery Award, the Pacific Vascular Research Foundation, the National Institutes of Health, and the American Vascular Association William J. von Liebig Award, as well as with resources and the use of facilities at the VA Connecticut Healthcare System, West Haven, Conn.
Disclosures
None.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Henderson VJ, Cohen RG, Mitchell RS, Kosek JC, Miller DC. Biochemical (functional) adaptation of "arterialized" vein grafts. Ann Surg. 1986; 203: 339345.[Medline] [Order article via Infotrieve]
3. Kwei S, Stavrakis G, Takahas M, Taylor G, Folkman MJ, Gimbrone MA Jr, Garcia-Cardena G. Early adaptive responses of the vascular wall during venous arterialization in mice. Am J Pathol. 2004; 164: 8189.
4. Gibbons GH, Dzau VJ. The emerging concept of vascular remodeling. N Engl J Med. 1994; 330: 14311438.
5. Mavromatis K, Fukai T, Tate M, Chesler N, Ku DN, Galis ZS. Early effects of arterial hemodynamic conditions on human saphenous veins perfused ex vivo. Arterioscler Thromb Vasc Biol. 2000; 20: 18891895.
6. Westerband A, Crouse D, Richter LC, Aguirre ML, Wixon CC, James DC, Mills JL, Hunter GC, Heimark RL. Vein adaptation to arterialization in an experimental model. J Vasc Surg. 2001; 33: 561569.[CrossRef][Medline] [Order article via Infotrieve]
7. Abeles D, Kwei S, Stavrakis G, Zhang Y, Wang ET, Garcia-Cardena G. Gene expression changes evoked in a venous segment exposed to arterial flow. J Vasc Surg. 2006; 44: 863870.[CrossRef][Medline] [Order article via Infotrieve]
8. Jalali S, Li YS, Sotoudeh M, Yuan S, Li S, Chien S, Shyy JY. Shear stress activates p60src-Ras-MAPK signaling pathways in vascular endothelial cells. Arterioscler Thromb Vasc Biol. 1998; 18: 227234.
9. Dimmeler S, Assmus B, Hermann C, Haendeler J, Zeiher AM. Fluid shear stress stimulates phosphorylation of Akt in human endothelial cells. Circ Res. 1998; 83: 334341.
10. Go YM, Boo YC, Park H, Maland MC, Patel R, Pritchard KA Jr, Fujio Y, Walsh K, Darley-Usmar V, Jo H. Protein kinase B/Akt activates c-Jun NH(2)-terminal kinase by increasing NO production in response to shear stress. J Appl Physiol. 2001; 91: 15741581.
11. Abumiya T, Sasaguri T, Taba Y, Miwa Y, Miyagi M. Shear stress induces expression of vascular endothelial growth factor receptor Flk-1/KDR through the CT-rich Sp1 binding site. Arterioscler Thromb Vasc Biol. 2002; 22: 907913.
12. Shay-Salit A, Shushy M, Wolfovitz E, Yahav H, Breviario F, Dejana E, Resnick N. VEGF receptor 2 and the adherens junction as a mechanical transducer in vascular endothelial cells. Proc Natl Acad Sci U S A. 2002; 99: 94629467.
13. Morales-Ruiz M, Fulton D, Sowa G, Languino LR, Fujio Y, Walsh K, Sessa WC. Vascular endothelial growth factor-stimulated actin reorganization and migration of endothelial cells is regulated via the serine/threonine kinase Akt. Circ Res. 2000; 86: 892896.
14. Luo Z, Asahara T, Tsurumi Y, Isner JM, Symes JF. Reduction of vein graft intimal hyperplasia and preservation of endothelium-dependent relaxation by topical vascular endothelial growth factor. J Vasc Surg. 1998; 27: 167173.[CrossRef][Medline] [Order article via Infotrieve]
15. Westerband A, Mills JL, Hunter GC, Gentile AT, Ihnat D, Heimark RL Topography of cell replication in human vein graft stenoses. Circulation. 1998; 98: II325II329;discussion II329II330.
16. Torres-Vazquez J, Kamei M, Weinstein BM. Molecular distinction between arteries and veins. Cell Tissue Res. 2003; 314: 4359.[CrossRef][Medline] [Order article via Infotrieve]
17. Zhang L, Hagen PO, Kisslo J, Peppel K, Freedman NJ. Neointimal hyperplasia rapidly reaches steady state in a novel murine vein graft model. J Vasc Surg. 2002; 36: 824832.[Medline] [Order article via Infotrieve]
18. Zou Y, Dietrich H, Hu Y, Metzler B, Wick G, Xu Q. Mouse model of venous bypass graft arteriosclerosis. Am J Pathol. 1998; 153: 13011310.
19. Adams RH, Wilkinson GA, Weiss C, Diella F, Gale NW, Deutsch U, Risau W, Klein R. Roles of ephrinB ligands and EphB receptors in cardiovascular development: demarcation of arterial/venous domains, vascular morphogenesis, and sprouting angiogenesis. Genes Dev. 1999; 13: 295306.
20. Gale NW, Baluk P, Pan L, Kwan M, Holash J, DeChiara TM, McDonald DM, Yancopoulos GD. Ephrin-B2 selectively marks arterial vessels and neovascularization sites in the adult, with expression in both endothelial and smooth-muscle cells. Dev Biol. 2001; 230: 151160.[CrossRef][Medline] [Order article via Infotrieve]
21. Shin D, Garcia-Cardena G, Hayashi S, Gerety S, Asahara T, Stavrakis G, Isner J, Folkman J, Gimbrone MA Jr, Anderson DJ. Expression of ephrinB2 identifies a stable genetic difference between arterial and venous vascular smooth muscle as well as endothelial cells, and marks subsets of microvessels at sites of adult neovascularization. Dev Biol. 2001; 230: 139150.[CrossRef][Medline] [Order article via Infotrieve]
22. Wang HU, Chen ZF, Anderson DJ. Molecular distinction and angiogenic interaction between embryonic arteries and veins revealed by ephrin-B2 and its receptor Eph-B4. Cell. 1998; 93: 741753.[CrossRef][Medline] [Order article via Infotrieve]
23. Gerety SS, Wang HU, Chen ZF, Anderson DJ. Symmetrical mutant phenotypes of the receptor EphB4 and its specific transmembrane ligand ephrin-B2 in cardiovascular development. Mol Cell. 1999; 4: 403414.[CrossRef][Medline] [Order article via Infotrieve]
24. Kim I, Ryu YS, Kwak HJ, Ahn SY, Oh JL, Yancopoulos GD, Gale NW, Koh GY. EphB ligand, ephrinB2, suppresses the VEGF- and angiopoietin 1-induced Ras/mitogen-activated protein kinase pathway in venous endothelial cells. Faseb J. 2002; 16: 11261128.
25. Korff T, Dandekar G, Pfaff D, Fuller T, Goettsch W, Morawietz H, Schaffner F, Augustin HG. Endothelial ephrinB2 is controlled by microenvironmental determinants and associates context-dependently with CD31. Arterioscler Thromb Vasc Biol. 2006; 26: 468474.
26. Lipman RD, Dallal GE, Bronson RT. Effects of genotype and diet on age-related lesions in ad libitum fed and calorie-restricted F344, BN, and BNF3F1 rats. J Gerontol A Biol Sci Med Sci. 1999; 54: B478B491.[Abstract]
27. Chaves AA, Weinstein DM, Bauer JA. Non-invasive echocardiographic studies in mice: influence of anesthetic regimen. Life Sci. 2001; 69: 213222.[CrossRef][Medline] [Order article via Infotrieve]
28. Abraldes JG, Iwakiri Y, Loureiro-Silva M, Haq O, Sessa WC, Groszmann RJ. Mild increases in portal pressure upregulate vascular endothelial growth factor and endothelial nitric oxide synthase in the intestinal microcirculatory bed, leading to a hyperdynamic state. Am J Physiol Gastrointest Liver Physiol. 2006; 290: G980G987.
29. Ivanov AI, Steiner AA, Scheck AC, Romanovsky AA. Expression of Eph receptors and their ligands, ephrins, during lipopolysaccharide fever in rats. Physiol Genomics. 2005; 21: 152160.
30. Maurer MH, Tripps WK, Feldmann RE Jr, Kuschinsky W. Expression of vascular endothelial growth factor and its receptors in rat neural stem cells. Neurosci Lett. 2003; 344: 165168.[CrossRef][Medline] [Order article via Infotrieve]
31. Filleur S, Courtin A, Ait-Si-Ali S, Guglielmi J, Merle C, Harel-Bellan A, Clezardin P, Cabon F. SiRNA-mediated inhibition of vascular endothelial growth factor severely limits tumor resistance to antiangiogenic thrombospondin-1 and slows tumor vascularization and growth. Cancer Res. 2003; 63: 39193922.
32. Acevedo L, Yu J, Erdjument-Bromage H, Miao RQ, Kim JE, Fulton D, Tempst P, Strittmatter SM, Sessa WC. A new role for Nogo as a regulator of vascular remodeling. Nat Med. 2004; 10: 382388.[CrossRef][Medline] [Order article via Infotrieve]
33. Hayashi S, Asahara T, Masuda H, Isner JM, Losordo DW. Functional ephrin-B2 expression for promotive interaction between arterial and venous vessels in postnatal neovascularization. Circulation. 2005; 111: 22102218.
34. You LR, Lin FJ, Lee CT, DeMayo FJ, Tsai MJ, Tsai SY. Suppression of Notch signalling by the COUP-TFII transcription factor regulates vein identity. Nature. 2005; 435: 98104.[CrossRef][Medline] [Order article via Infotrieve]
35. Ishida A, Murray J, Saito Y, Kanthou C, Benzakour O, Shibuya M, Wijelath ES. Expression of vascular endothelial growth factor receptors in smooth muscle cells. J Cell Physiol. 2001; 188: 359368.[CrossRef][Medline] [Order article via Infotrieve]
36. Masood R, Xia G, Smith DL, Scalia P, Still JG, Tulpule A, Gill PS. Ephrin B2 expression in Kaposi sarcoma is induced by human herpesvirus type 8: phenotype switch from venous to arterial endothelium. Blood. 2005; 105: 13101318.
37. Hainaud P, Contreres JO, Villemain A, Liu LX, Plouet J, Tobelem G, Dupuy E. The Role of the Vascular Endothelial Growth Factor-Delta-like 4 Ligand/Notch4-Ephrin B2 Cascade in Tumor Vessel Remodeling and Endothelial Cell Functions. Cancer Res. 2006; 66: 85018510.
38. Gale NW, Yancopoulos GD. Growth factors acting via endothelial cell-specific receptor tyrosine kinases: VEGFs, angiopoietins, and ephrins in vascular development. Genes Dev. 1999; 13: 10551066.
39. Herzog Y, Kalcheim C, Kahane N, Reshef R, Neufeld G. Differential expression of neuropilin-1 and neuropilin-2 in arteries and veins. Mech Dev. 2001; 109: 115119.[CrossRef][Medline] [Order article via Infotrieve]
40. Ashton KJ, Willems L, Holmgren K, Ferreira L, Headrick JP. Age-associated shifts in cardiac gene transcription and transcriptional responses to ischemic stress. Exp Gerontol. 2006; 41: 189204.[CrossRef][Medline] [Order article via Infotrieve]
41. Conboy IM, Conboy MJ, Wagers AJ, Girma ER, Weissman IL, Rando TA. Rejuvenation of aged progenitor cells by exposure to a young systemic environment. Nature. 2005; 433: 760764.[CrossRef][Medline] [Order article via Infotrieve]
42. Iso T, Maeno T, Oike Y, Yamazaki M, Doi H, Arai M, Kurabayashi M. Dll4-selective Notch signaling induces ephrinB2 gene expression in endothelial cells. Biochem Biophys Res Commun. 2006; 341: 708714.[CrossRef][Medline] [Order article via Infotrieve]
43. Yamashita A, Hanna AK, Hirata S, Dardik A, Sumpio BE. Antisense basic fibroblast growth factor alters the time course of mitogen-activated protein kinase in arterialized vein graft remodeling. J Vasc Surg. 2003; 37: 866873.[CrossRef][Medline] [Order article via Infotrieve]
44. Garcia-Cardena G, Comander J, Anderson KR, Blackman BR, Gimbrone MA, Jr. Biomechanical activation of vascular endothelium as a determinant of its functional phenotype. Proc Natl Acad Sci U S A. 2001; 98: 44784485.
45. Meinhart JG, Deutsch M, Fischlein T, Howanietz N, Froschl A, Zilla P. Clinical autologous in vitro endothelialization of 153 infrainguinal ePTFE grafts. Ann Thorac Surg. 2001; 71: S327S331.
46. Ott MJ, Ballermann BJ. Shear stress-conditioned, endothelial cell-seeded vascular grafts: improved cell adherence in response to in vitro shear stress. Surgery. 1995; 117: 334339.[CrossRef][Medline] [Order article via Infotrieve]
47. Dardik A, Liu A, Ballermann BJ. Chronic in vitro shear stress stimulates endothelial cell retention on prosthetic vascular grafts and reduces subsequent in vivo neointimal thickness. J Vasc Surg. 1999; 29: 157167.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
L. C. G. Campos, A. A. Miyakawa, V. G. Barauna, L. Cardoso, T. F. Borin, L. A. d. O. Dallan, and J. E. Krieger Induction of CRP3/MLP expression during vein arterialization is dependent on stretch rather than shear stress Cardiovasc Res, July 1, 2009; 83(1): 140 - 147. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gessler Dll1 and Dll4: similar, but not the same Blood, May 28, 2009; 113(22): 5375 - 5376. [Full Text] [PDF] |
||||
![]() |
M. R. Swift and B. M. Weinstein Arterial-Venous Specification During Development Circ. Res., March 13, 2009; 104(5): 576 - 588. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Nguyen, N. Hevelone, S. O. Rogers, D. F. Bandyk, A. W. Clowes, G. L. Moneta, S. Lipsitz, and M. S. Conte Disparity in Outcomes of Surgical Revascularization for Limb Salvage: Race and Gender Are Synergistic Determinants of Vein Graft Failure and Limb Loss Circulation, January 6, 2009; 119(1): 123 - 130. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Aitsebaomo, A. L. Portbury, J. C. Schisler, and C. Patterson Brothers and Sisters: Molecular Insights Into Arterial-Venous Heterogeneity Circ. Res., October 24, 2008; 103(9): 929 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Ho, C. D. Owens, T. Longo, X. X. Sui, C. Ifantides, and M. S. Conte C-reactive protein and vein graft disease: evidence for a direct effect on smooth muscle cell phenotype via modulation of PDGF receptor-{beta} Am J Physiol Heart Circ Physiol, September 1, 2008; 295(3): H1132 - H1140. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. le Noble, C. Klein, A. Tintu, A. Pries, and I. Buschmann Neural guidance molecules, tip cells, and mechanical factors in vascular development Cardiovasc Res, May 1, 2008; 78(2): 232 - 241. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2007 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |