Atherosclerosis and Lipoproteins |
From the Departments of Human Genetics (S.S.W., L.V., S.G., M.T.W., A.J.L.), Medicine (W.S., X.W., A.J.L.), and Pathology and Laboratory Medicine (X.W., T.A.D.), University of California at Los Angeles. Present address for W.S.: Department of Radiology, University of Virginia, Charlottesville.
Correspondence to Aldons J. Lusis, UCLA School of Medicine, Dept. of Human Genetics, Box 95167, University of California at Los Angeles, Los Angeles, CA 90095-1679. E-mail jlusis{at}mednet.ucla.edu
| Abstract |
|---|
|
|
|---|
Methods and Results— Whereas a previous cross in mice fed a Western diet for 16 weeks revealed a very complex inheritance pattern with many significant lesion QTLs, the present cross, on a chow diet, revealed a single major locus on chromosome 9 (lod=5.0, Ath29*), and a suggestive locus on chromosome 4 (lod=2.6, Ath8). QTLs for plasma HDL, total cholesterol, and triglyceride levels were found on chromosome 1 over the ApoA2 gene. Neither of the lesion QTLs were associated with differences in plasma lipid levels or other systemic risk factors, consistent with the concept that genetic factors affecting cellular functions of the vessel wall are important determinants of atherosclerosis susceptibility. We generated a congenic strain for Ath29 and confirmed its contribution to lesion development. Toll-like receptor 4 (Tlr4), the lipopolysaccharide (LPS) receptor, is located in the Ath8 region and is known to be defective in C3H/HeJ mice. We constructed a congenic strain carrying a normal Tlr4 gene on the C3H Apoe-null background and found that the defective Tlr4 does not contribute significantly to lesion resistance during early lesion development.
Conclusions— We identified one major QTL on chromosome 9, Ath29, for early lesion development in the BXH ApoE–/– cross fed on a chow diet and confirmed its contribution in congenic mice. We have also determined that Tlr4 on the C3H ApoE–/– background does not contribute to early lesion development. *Ath29 is referred to as Ath22 in Su et al 2006.
An F2 intercross between C57BL/6J and C3H/HeJ on the ApoE–/– background, fed on a chow diet and euthanized at 12 weeks exhibited one significant QTL on chromosome 9, Ath29 and a suggestive QTL on chromosome 4, Ath8. Congenics for Ath29 confirmed the contribution of the locus to lesion development.
Key Words: atherosclerosis quantitative trait locus C3H/HeJ
| Introduction |
|---|
|
|
|---|
We now report the mapping of chromosomal loci contributing to atherosclerosis resistance in C3H mice on an Apoe–/– background. We studied 12-week-old mice maintained on a chow diet to assess genetic contributions to early lesion development. As in a previous study of mice maintained on a high-fat, high-cholesterol diet, the major locus identified in our study was on chromosome 9.8 C3H/HeJ mice carry a defective allele of Toll-like receptor 4 (Tlr4), a gene that has been implicated in resistance to atherosclerosis in human studies9 as well as mice.10 Using a congenic mouse strain, we show that the Tlr4 gene does not have a significant impact on early atherosclerosis on the C3H background. We have also isolated the major locus contributing to atherosclerosis susceptibility on chromosome 9 as a congenic strain and characterized its effect on atherosclerosis. This strain should make fine mapping of the gene feasible.
| Materials and Methods |
|---|
|
|
|---|
Tlr4 Congenic Studies
To produce C3H.Apoe–/– Tlr4lps–n (normal response to lipopolysaccharade [LPS]) congenic mice, C3H Apoe–/–, which are Tlr4lps–d (defective LPS response) because of a spontaneous mutation, were intercrossed with C3H/DiSnA Apoe+/+ Tlr4lps–n mice11 and C3H Apoe–/– Tlr4lps–n F2 offspring were selected. Genotyping for Apoe and Tlr4 was done by polymerase chain reaction (PCR). PCR for Apoe was performed as previously described.12 The Tlr4 primer sequences are as follows: F 5'tcagaatgaggactgggtga3' R 5'tcaaagatacaccaacggctc3'. The Tlr4 PCR product was digested with NlaIII (CATG); the Tlr4lps–d allele contains a unique restriction enzyme site yielding a 98-bp product. The progeny of the F1 heterozygotes gave rise to approximately a 1:2:1 ratio of Tlr4lps–n, Tlr4lps–n/d, and Tlr4lps–d respectively. C3H/DiSnA mice were obtained from Dr Peter Demant, Department of Molecular Biology, Roswell Park Memorial Institute, Buffalo, NY, who had bred the substrain in his laboratory. The Tlr4lps–d allele arose on the C3H/HeJ strain after the separation of the two colonies.
Histological Analyses
The aorta was sectioned and lesions were quantified as previously described.13 After the mice were euthanized, the heart and proximal aorta were excised and washed in PBS. The apex and lower half of the ventricles were cut off. The remaining specimen was embedded in Tissue-Tek (Miles), frozen on dry ice, and stored at –80C until sectioning. Serial cryosections were prepared through the ventricle until the aortic valves appeared. From then on, every fifth 10-µm section was collected on poly-D-lysine-coated slides until the aortic sinus was completely sectioned. Sections were stained with hematoxylin and oil red O, which specifically stains lipids. Slides were examined by light microscopy. The average fatty streak lesion area was quantified throughout the aortic sinus using an ocular with a grid. Forty sections per mouse were quantified and averaged to yield a score that was used for QTL analysis.
Lipid Measurements
Plasma triglycerides, total cholesterol, HDL, and free fatty acids were assayed as previously described.13
Genome Scan
A 10 cM genome scan was performed using microsatellite markers. DNA (concentration 15 ng/µL) was isolated using a standard phenol-chloroform extraction protocol and amplified by touchdown PCR using fluorescently labeled primers from Research Genetics (Huntsville, Ala). PCR products then underwent capillary electrophoresis (Applied Biosystems), and genotypes were determined using Genotyper (Applied Biosystems). The list of microsatellites are as follows: D1mit64, D1mit278, D1mit322, D1mit216, D1mit386, D1mit217, D1mit101, D1mit33, D1mit268, D1mit540, D1mit150, D1mit362, D1mit512, D2mit1, D2mit92, D2mit41, D2mit487, D2mit396, D2mit412, D2mit286, D2mit200, D3mit328, D3mit203, D3mit169, D3mit184, D3mit292, D3mit128, D3mit19, D4mit101, D4mit111, D4mit327, D4mit31, D4mit71, D4mit42, D4mit344, D5mit193, D5mit13, D5mit55, D5mit394, D5mit396, D5mit25, D5mit95, D5mit98, D6mit50, D6mit74, D6mit384, D6mit284, D6mit37, D6mit340, D7mit316, D7mit321, D7mit66, D7mit291, D8mit29, D8mit244, D8mit56, D9mit297, D9mit25, D9mit301, D9mit141, D9mit259, D9mit156, D9mit239, D9mit33, D9mit136, D9mit16, D9mit151, D10mit168, D10mit31, D10mit42, D10mit10, D10mit145, D11mit306, D11mit206, D11mit155, D11mit31, D11mit39, D12mit12, D12mit34, D12mit17, D13mit198, D13mit63, D13mit113, D13mit314, D13mit287, D13mit260, D13mit35, D14mit174, D14mit157, D14mit68, D14mit199, D14mit136, D15mit199, D15mit204, D15mit167, D15mit3, D15mit31, D15mit43, D16mit55, D16mit4, D16mit76, D16mit86, D17mit171, D17mit101, D17mit178, D17mit183, D17mit155, D18mit19, D18mit120, D18mit58, D18mit123, D18mit161, D18mit33, D18mit49, D18mit4, D18mit144, D19mit59, D19mit42, D19mit96, D19mit40, D19mit13, D19mit90, Dxmit89, Dxmit166, Dxmit1, Dxmit10, Dxmit222.
Linkage and Data Analysis
Genotype and phenotype data were imported into Windows QTL Cartographer version 2.014 and a linkage map was created according to the marker location specified in the Mouse Genome Informatics website (www.informatics.jax.org) following the procedures outlined in the accompanying manual. The marker map was consistent with an empirically generated map and was scanned for double recombinants. Interval mapping was performed using model H3:H0, which accounts for both additive and dominant effects. Phenotypic traits were transformed as needed to normalize the residuals. This involved taking the ln of some of the trait values. Outliers (>3 SD) were omitted. Significance was assessed based on permuting the data 1000 times using the Zmapqtl function (model 6) for a genome-wide P<0.05. The corresponding lod score was 3.5 for all traits.
Analysis of variance (ANOVA) between markers and traits was calculated using Statview v5.0 (SAS Institute Inc). Correlation between traits was calculated using the Spearman rank correlation. Data were then graphed in Sigma Plot (SPSS Inc).
| Results |
|---|
|
|
|---|
|
Plasma lipid levels were measured to determine whether any correlation existed between lesion size and lipid levels. QTL analysis was also performed on lipid levels to identify loci that regulate lipids and to determine whether any lipid QTLs colocalized with the lesion QTLs. Using the Spearman rank correlation, the correlation coefficient (
) was calculated between lesion size and LDL/very low-density lipoprotein, high-density lipoprotein, total cholesterol, triglycerides, and free fatty acids. No significant correlations were found between any of the lipid traits and lesions (supplemental Table I). Significant QTLs on chromosome 1 at 92 cM were found for HDL (lod=7.1) and triglycerides (lod=4.4; Figure 2). A suggestive QTL for total cholesterol (lod=3.0) was also identified at the same locus. A suggestive QTL for HDL (lod=3.8) and triglycerides (lod=2.5) was found on chromosome 10 at 14 cM. Hence, no QTL overlaps were found between lesions and lipids (supplemental Figure IIa and IIb).
|
Confirmation and Characterization of the Chromosome 9 Locus
We constructed mice congenic for the chromosome 9 locus by introgressing that region of C3H onto a B6 Apoe–/– background by backcrossing for 8 generations. As determined by genotyping, the congenic region extended from 15 to 61 cM between markers D9mit297 and D9mit16. Female congenics had a mean lesion size of 9094±1871 µm2 per section and B6 Apoe–/– littermate controls had a mean size of 36319±4518 µm2 per section. Thus, the lesions in the female congenics were about 25% the size of the controls (P<0.0001). Male congenics had a mean lesion size of 11375±1649 µm2 per section and control B6 Apoe–/– had a size of 20896±3481 µm2 per section. Thus, the congenic lesions of the males were about 54% the size of the controls (P=0.013). These results confirm the contribution of this locus to atherosclerosis (Figure 3). The majority of studies of atherosclerosis in mice are consistent with our sex-biased results; female mice almost always develop larger lesions than male mice, and the reasons underlying this sex bias are not known. The congenic mice resemble C3H Apoe–/– mice in their lesion development. Male and female C3H Apoe–/– mice exhibit extremely small lesions that are statistically not different in size, likewise for our congenics. We speculate that the chromosome 9 region harbors an allele that may act more strongly in females compared with males.
|
Tlr4 on the C3H Background Does Not Significantly Influence Lesion Development
Tlr4, located on chromosome 4 at 33 cM, was just distal to the suggestive chromosome 4 peak. Because Tlr4 has been associated with atherosclerosis in humans9 and mice10 and is known to be defective in C3H/HeJ,15 we investigated the role of Tlr4 in atherosclerosis in C3H/HeJ mice. We generated C3H Apoe–/– mice that carry the functional Tlr4lps–n gene from C3H/DisNA by intercrossing the strains. The mean lesion size for C3H Apoe–/– Tlr4lps–n was 384±127 µm2/section, that of C3H Apoe–/– Tlr4lps–d was 221±105 µm2 per section, and that of B6 Apoe–/– Tlr4lps–n was 15580±1220 µm2/section. Thus, the congenic C3H Apoe–/– Tlr4lps–n showed no significant difference in lesion size compared with C3H Apoe–/– Tlr4lps–d, though both of these groups were significantly different from B6 Apoe–/– Tlr4lps–n (P<0.0001) (Figure 4). These data suggest that Tlr4 does not contribute significantly to the extreme resistance of C3H mice to early lesion development, and that Tlr4 is not a cause of the difference in lesion initiation between C3H and B6.
|
| Discussion |
|---|
|
|
|---|
Ath1 was the first locus identified for atherosclerosis susceptibility in mice in BXH and B6XBALB/c recombinant inbred strains.16 It was determined to be the major locus located on chromosome 1 at 90 cM contributing to differences in diet-induced atherosclerosis in female mice. Recent studies suggest that variations in Tnfsf4 underlie Ath1.17 The reason for our failure to replicate the Ath1 locus is unclear. It is possible that QTLs found on the high fat cholic acid diet are different from those found in Apoe–/– mice fed chow diet, or we may not have been sufficiently powered to detect it. Studies of BXH recombinant inbred strains maintained on a cholic acid diet performed in our laboratory were not consistent with a chromosome 1 location for a major atherosclerosis susceptibility gene.6 It is noteworthy that the early study treated atherosclerosis as a nominal rather than quantitative trait.16 Another BXH Apoe–/– F2 intercross fed on a 12-week Western diet also failed to replicate the locus.8 The major locus contributing to atherosclerosis in this hyperlipidemic cross was on chromosome 9, which is designated Ath29. More recently, we performed a second cross with those strains maintained on a Western diet for 16 weeks and observed a number of additional loci contributing to lesion development.18 The chromosome 9 locus in the present study likely replicates the Ath29 QTL previously found in both BXH Apoe–/– F2 crosses fed the Western diet.
There are many notable genes within the 95% confidence interval for Ath29 (17 to 33 cM). Of the 529 genes in the interval, more than 100 of them are olfactory receptors. A short list of candidate genes can be found in the Table. Although lipid metabolism genes are not likely to be causal for atherosclerosis in this cross, we note that the Apoa1, Apoa4, Apoc3, Apoa5 cluster, which has been associated with familial combined hypercholesterolemia,19 falls in the region. Another gene, Sortilin-related Receptor, Sorl1, has structural homology with the Ldlr family,20 and has been shown to bind both apolipoprotein E and lipoprotein lipase (Lpl) and is expressed in the lesions of Apoe null mice.21 Nicotinamide n-methyltransferase (Nnmt) is involved in the metabolism of homocysteine, whose levels in the plasma are an independent risk factor for CAD. Plasma homocysteine levels were linked to the locus containing Nnmt in Spanish families.22 Lysyl oxidase like 1 (Loxl1) is involved in the deposition and maintenance of elastin fibers. The Loxl1 null mouse has vascular abnormalities, among other defects.23 Loxl1 serves as a crosslinking enzyme and an element of the scaffold to ensure spatially defined deposition of elastin.
|
Cultured B6 aortic endothelial cells are highly responsive to oxidized LDL, exhibiting induction of chemokines and adhesion molecules, whereas C3H endothelial cells are relatively unresponsive.7 In addition, reciprocal bone marrow transplants between B6 Apoe–/– and C3H Apoe–/– mice did not alter lesion size in the recipient mice, indicating that variations in monocyte function were not involved. Evidence supporting the arterial wall involvement was also found when B6 Apoe–/– and C3H Apoe–/– aortic segments were transplanted into F1 mice and the donor aortic segments of B6 mice developed significantly larger lesions than those of C3H mice.24 A number of inflammatory genes are located at the Ath29 locus, including: IL 10 receptor alpha (Il10ra), IL 18 (Il18), TIR domain-containing adaptor protein (Tirap), and platelet-activating factor acetylhydrolase 1b2 Pafah1b2. Among these, only Il18 has previously been associated with atherosclerosis. Il18 is expressed in human lesions, particularly in unstable plaques.25 Serum concentrations of IL18 were significantly higher in patients who had a fatal cardiac event compared with patients with CAD who did not have a fatal event during the 3.9 year follow-up period.26 Haplotypes of Il18 have also been associated with CAD mortality.27
A suggestive QTL for lesions was found on chromosome 4, located at 27.8 cM, replicating Ath8.28 Tlr4, at 33 cM, was at the distal end of the peak and is known to be the LPS receptor, an inflammatory response gene.29 A polymorphism of Tlr4 has been associated with atherosclerosis in human studies,9 and knock out mouse models have implicated it in lesion formation.10 Tlr4 has also been implicated as the receptor for oxidized products of 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine, which play a role in the induction of Il-8.30 The C3H/HeJ strain is resistant to atherosclerosis and has a nonfunctional Tlr4 allele, and thus Tlr4 is a candidate for the resistance of the C3H/HeJ strain to atherosclerosis. To test this possibility, we constructed a congenic C3H Apoe–/– strain with the functional Tlr4lps–n allele donated by the C3H/DisNA mouse and found that these mice were also highly resistant to atherosclerosis. Lesion size was not significantly different from that of Tlr4lps–d mice. From this we can conclude that Tlr4 does not appear to play a significant role in early lesion development in C3H/HeJ mice. Another gene under the chromosome 4 peak is Angptl3, which is a candidate gene for atherosclerosis in the SM/J x NZB/B1NJ cross.31 An Angptl3 null mouse exhibited decreased lesions by 3-fold in KK san mice32 and SNPs in the promoter region of ANGPTL3 have been associated with atherosclerosis in humans.31
Apoa2 is a candidate gene underlying the total cholesterol, triglyceride, and HDL QTLs on chromosome 1. Apoa2 is polymorphic between B6 and C3H and variation in sequence confers higher translational efficiency to the C3H allele,33 resulting in approximately 30% more plasma APOA2 in C3H. Transgenic Apoa2 mice have increased plasma HDL and total cholesterol levels as well as increased atherosclerosis.34 No association with atherosclerosis was observed between Apoa2 alleles and atherosclerosis in this cross, perhaps because of the hyperlipidemic Apoe–/– background. Sterol O-acyltransferase (Soat1) is another candidate for the lipid QTLs on chromosome 1. Also known as acyl coenzyme A (CoA): cholesterol acyltransferase, it is an endoplasmic reticulum protein that forms cholesterol esters from cholesterol. It is also involved in adrenocortical lipid depletion in AKR/J mice.35
In conclusion, the mapping and genetic isolation of the chromosome 9 locus conferring atherosclerosis resistance of C3H mice should allow fine mapping of the region and the identification of the underlying gene. This task should be aided by the recent development of an expression quantitative trait locus database for C3H X B6 mice.36
| Acknowledgments |
|---|
Sources of Funding
This work was supported by NIH grants HL30568 and HL28481.
Disclosures
None.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Allayee H, Ghazalpour A, Lusis AJ. Using mice to dissect genetic factors in atherosclerosis. Arterioscler Thromb Vasc Biol. 2003; 23: 1501–1509.
3. Paigen B, Morrow A, Holmes PA, Mitchell D, Williams RA. Quantitative assessment of atherosclerotic lesions in mice. Atherosclerosis. 1987; 68: 231–240.[CrossRef][Medline] [Order article via Infotrieve]
4. Plump AS, Smith JD, Hayek T, Aalto-Setala K, Walsh A, Verstuyft JG, Rubin EM, Breslow JL. Severe hypercholesterolemia and atherosclerosis in apolipoprotein E-deficient mice created by homologous recombination in ES cells. Cell. 1992; 71: 343–353.[CrossRef][Medline] [Order article via Infotrieve]
5. Shi W, Wang NJ, Shih DM, Sun VZ, Wang X, Lusis AJ. Determinants of atherosclerosis susceptibility in the C3H and C57BL/6 mouse model: evidence for involvement of endothelial cells but not blood cells or cholesterol metabolism. Circ Res. 2000; 86: 1078–1084.
6. Liao F, Andalibi A, Qiao JH, Allayee H, Fogelman AM, Lusis AJ. Genetic evidence for a common pathway mediating oxidative stress, inflammatory gene induction, and aortic fatty streak formation in mice. J Clin Invest. 1994; 94: 877–884.[Medline] [Order article via Infotrieve]
7. Shi W, Haberland ME, Jien ML, Shih DM, Lusis AJ. Endothelial responses to oxidized lipoproteins determine genetic susceptibility to atherosclerosis in mice. Circulation. 2000; 102: 75–81.
8. Su Z, Li Y, James JC, McDuffie M, Matsumoto AH, Helm GA, Weber JL, Lusis AJ, Shi W. Quantitative trait locus analysis of atherosclerosis in an intercross between C57BL/6 and C3H mice carrying the mutant apolipoprotein E gene. Genetics. 2006; 172: 1799–1807.
9. Kiechl S, Lorenz E, Reindl M, Wiedermann CJ, Oberhollenzer F, Bonora E, Willeit J, Schwartz DA. Toll-like receptor 4 polymorphisms and atherogenesis. N Engl J Med. 2002; 347: 185–192.
10. Michelsen KS, Doherty TM, Shah PK, Arditi M. Role of Toll-like receptors in atherosclerosis. Circ Res. 2004; 95: e96–e97.
11. Demant P. Genetic resolution of susceptibility to cancer–new perspectives. Semin Cancer Biol. 1992; 3: 159–166.[Medline] [Order article via Infotrieve]
12. Piedrahita JA, Zhang SH, Hagaman JR, Oliver PM, Maeda N. Generation of mice carrying a mutant apolipoprotein E gene inactivated by gene targeting in embryonic stem cells. Proc Natl Acad Sci U S A. 1992; 89: 4471–4475.
13. Mehrabian M, Qiao JH, Hyman R, Ruddle D, Laughton C, Lusis AJ. Influence of the apoA-II gene locus on HDL levels and fatty streak development in mice. Arterioscler Thromb. 1993; 13: 1–10.
14. Wang S CJB, and Z.-B.Zeng. Windows QTL Cartographer 2.5. Raleigh, NC: Department of Statistics, North Carolina State University; 2006.
15. Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C, Du X, Birdwell D, Alejos E, Silva M, Galanos C, Freudenberg M, Ricciardi-Castagnoli P, Layton B, Beutler B. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 1998; 282: 2085–2088.
16. Paigen B, Mitchell D, Reue K, Morrow A, Lusis AJ, LeBoeuf RC. Ath-1, a gene determining atherosclerosis susceptibility and high density lipoprotein levels in mice. Proc Natl Acad Sci U S A. 1987; 84: 3763–3767.
17. Wang X, Ria M, Kelmenson PM, Eriksson P, Higgins DC, Samnegard A, Petros C, Rollins J, Bennet AM, Wiman B, de Faire U, Wennberg C, Olsson PG, Ishii N, Sugamura K, Hamsten A, Forsman-Semb K, Lagercrantz J, Paigen B. Positional identification of TNFSF4, encoding OX40 ligand, as a gene that influences atherosclerosis susceptibility. Nat Genet. 2005; 37: 365–372.[CrossRef][Medline] [Order article via Infotrieve]
18. Wang SS, Schadt EE, Wang H, Wang X, Ingram-Drake L, Shi W, Drake TA, Lusis AJ. Identification of pathways for atherosclerosis in mice integration of quantitative trait locus analysis and global gene expression data. Circ Res. 2007.
19. Mar R, Pajukanta P, Allayee H, Groenendijk M, Dallinga-Thie G, Krauss RM, Sinsheimer JS, Cantor RM, de Bruin TW, Lusis AJ. Association of the APOLIPOPROTEIN A1/C3/A4/A5 gene cluster with triglyceride levels and LDL particle size in familial combined hyperlipidemia. Circ Res. 2004; 94: 993–999.
20. Jacobsen L, Madsen P, Jacobsen C, Nielsen MS, Gliemann J, Petersen CM. Activation and functional characterization of the mosaic receptor SorLA/LR11. J Biol Chem. 2001; 276: 22788–22796.
21. Zhu Y, Bujo H, Yamazaki H, Ohwaki K, Jiang M, Hirayama S, Kanaki T, Shibasaki M, Takahashi K, Schneider WJ, Saito Y. LR11, an LDL receptor gene family member, is a novel regulator of smooth muscle cell migration. Circ Res. 2004; 94: 752–758.
22. Souto JC, Blanco-Vaca F, Soria JM, Buil A, Almasy L, Ordonez-Llanos J, Martin-Campos JM, Lathrop M, Stone W, Blangero J, Fontcuberta J. A genomewide exploration suggests a new candidate gene at chromosome 11q23 as the major determinant of plasma homocysteine levels: results from the GAIT project. Am J Hum Genet. 2005; 76: 925–933.[CrossRef][Medline] [Order article via Infotrieve]
23. Liu X, Zhao Y, Gao J, Pawlyk B, Starcher B, Spencer JA, Yanagisawa H, Zuo J, Li T. Elastic fiber homeostasis requires lysyl oxidase-like 1 protein. Nat Genet. 2004; 36: 178–182.[CrossRef][Medline] [Order article via Infotrieve]
24. Pei H, Wang Y, Miyoshi T, Zhang Z, Matsumoto AH, Helm GA, Tellides G, Shi W. Direct evidence for a crucial role of the arterial wall in control of atherosclerosis susceptibility. Circulation. 2006; 114: 2382–2389.
25. Mallat Z, Corbaz A, Scoazec A, Besnard S, Leseche G, Chvatchko Y, Tedgui A. Expression of interleukin-18 in human atherosclerotic plaques and relation to plaque instability. Circulation. 2001; 104: 1598–1603.
26. Blankenberg S, Tiret L, Bickel C, Peetz D, Cambien F, Meyer J, Rupprecht HJ. Interleukin-18 is a strong predictor of cardiovascular death in stable and unstable angina. Circulation. 2002; 106: 24–30.
27. Tiret L, Godefroy T, Lubos E, Nicaud V, Tregouet DA, Barbaux S, Schnabel R, Bickel C, Espinola-Klein C, Poirier O, Perret C, Munzel T, Rupprecht HJ, Lackner K, Cambien F, Blankenberg S. Genetic analysis of the interleukin-18 system highlights the role of the interleukin-18 gene in cardiovascular disease. Circulation. 2005; 112: 643–650.
28. Purcell-Huynh DA, Weinreb A, Castellani LW, Mehrabian M, Doolittle MH, Lusis AJ. Genetic factors in lipoprotein metabolism. Analysis of a genetic cross between inbred mouse strains NZB/BINJ and SM/J using a complete linkage map approach. J Clin Invest. 1995; 96: 1845–1858.[Medline] [Order article via Infotrieve]
29. Poltorak A, Smirnova I, He X, Liu MY, Van Huffel C, McNally O, Birdwell D, Alejos E, Silva M, Du X, Thompson P, Chan EK, Ledesma J, Roe B, Clifton S, Vogel SN, Beutler B. Genetic and physical mapping of the Lps locus: identification of the toll-4 receptor as a candidate gene in the critical region. Blood Cells Mol Dis. 1998; 24: 340–355.[CrossRef][Medline] [Order article via Infotrieve]
30. Walton KA, Hsieh X, Gharavi N, Wang S, Wang G, Yeh M, Cole AL, Berliner JA. Receptors involved in the oxidized 1-palmitoyl-2-arachidonoyl-sn-glycero-3-phosphorylcholine-mediated synthesis of interleukin-8. A role for Toll-like receptor 4 and a glycosylphosphatidylinositol-anchored protein. J Biol Chem. 2003; 278: 29661–29666.
31. Korstanje R, Eriksson P, Samnegard A, Olsson PG, Forsman-Semb K, Sen S, Churchill GA, Rollins J, Harris S, Hamsten A, Paigen B. Locating Ath8, a locus for murine atherosclerosis susceptibility and testing several of its candidate genes in mice and humans. Atherosclerosis. 2004; 177: 443–450.[CrossRef][Medline] [Order article via Infotrieve]
32. Ando Y, Shimizugawa T, Takeshita S, Ono M, Shimamura M, Koishi R, Furukawa H. A decreased expression of angiopoietin-like 3 is protective against atherosclerosis in apoE-deficient mice. J Lipid Res. 2003; 44: 1216–1223.
33. Doolittle MH, LeBoeuf RC, Warden CH, Bee LM, Lusis AJ. A polymorphism affecting apolipoprotein A-II translational efficiency determines high density lipoprotein size and composition. J Biol Chem. 1990; 265: 16380–16388.
34. Hedrick CC, Castellani LW, Warden CH, Puppione DL, Lusis AJ. Influence of mouse apolipoprotein A-II on plasma lipoproteins in transgenic mice. J Biol Chem. 1993; 268: 20676–20682.
35. Meiner VL, Welch CL, Cases S, Myers HM, Sande E, Lusis AJ, Farese RV, Jr. Adrenocortical lipid depletion gene (ald) in AKR mice is associated with an acyl-CoA:cholesterol acyltransferase (ACAT) mutation. J Biol Chem. 1998; 273: 1064–1069.
36. Wang S, Yehya N, Schadt EE, Wang H, Drake TA, Lusis AJ. Genetic and genomic analysis of a fat mass trait with complex inheritance reveals marked sex specificity. PLoS Genet. 2006; 2: e15.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
Z. Yuan, H. Pei, D. J. Roberts, Z. Zhang, J. S. Rowlan, A. H. Matsumoto, and W. Shi Quantitative Trait Locus Analysis of Neointimal Formation in an Intercross Between C57BL/6 and C3H/HeJ Apolipoprotein E-Deficient Mice Circ Cardiovasc Genet, June 1, 2009; 2(3): 220 - 228. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Plump and P. Y. Lum Genomics and cardiovascular drug development. J. Am. Coll. Cardiol., March 31, 2009; 53(13): 1089 - 1100. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Juan, M. M. Veniant, J. Helmering, P. Babij, D. M. Baker, M. A. Damore, M. B. Bass, T. Gyuris, M. Chhoa, C.-M. Li, et al. Identification of three loci affecting HDL-cholesterol levels in a screen for chemically induced recessive mutations in mice J. Lipid Res., March 1, 2009; 50(3): 534 - 545. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Bennett, S. S. Wang, X. Wang, X. Wu, and A. J. Lusis Genetic Regulation of Atherosclerotic Plaque Size and Morphology in the Innominate Artery of Hyperlipidemic Mice Arterioscler. Thromb. Vasc. Biol., March 1, 2009; 29(3): 348 - 355. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2007 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |