| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Biology |
From the Stanford University School of Medicine (M.E.K., E.I.C., G.C.G.), Childrens Surgical Research Program, Stanford, Calif; and New York University School of Medicine (M.R.G., S.S.C., K.M.B., D.J.C., O.M.T.), Institute of Reconstructive Plastic Surgery, New York.
Correspondence to Geoffrey C. Gurtner, MD, Stanford University, Department of Surgery, PSRL, GK-201, 257 Campus Drive West, Stanford, CA, 94305-5148. E-mail ggurtner{at}stanford.edu
| Abstract |
|---|
|
|
|---|
. Mobilization of EPCs is enhanced by VEGF-A, matrix metalloproteinase (MMP)-9, and estrogen, whereas homing is secondary to localized expression of stromal cell-derived factor-1
(SDF-1
). We examined whether these mediators of EPC trafficking are upregulated during the proliferation of infantile hemangioma.
Methods and Results— Surgical specimens and blood samples were obtained from children with proliferating hemangioma and age-matched controls (n=10, each group). VEGF-A and MMP-9 levels were measured in blood, and tissue sections were analyzed for SDF-1
, MMP-9, VEGF-A, and HIF-1
. The role of estrogen as a modulator of hemangioma endothelial cell growth was also investigated. We found that all these mediators of EPC trafficking are elevated in blood and specimens from children with proliferating infantile hemangioma. In vitro, the combination of hypoxia and estrogen demonstrated a synergistic effect on hemangioma endothelial cell proliferation.
Conclusions— These findings demonstrate that proliferating hemangiomas express known mediators of vasculogenesis and suggest that this process may play a role in the initiation or progression of this disease.
The pathophysiology of infantile hemangioma is unknown, yet there is evidence to suggest that stem/progenitor cells may contribute to their rapid proliferation. We investigated the mediators of progenitor cell mobilization and recruitment in children with hemangioma and demonstrate that growth may be linked to hypoxia and activation of vasculogenic pathways.
Key Words: hemangioma hypoxia vasculogenesis endothelial progenitor cells chemokines
| Introduction |
|---|
|
|
|---|
The majority of hemangioma research has focused on the mechanisms of angiogenesis as underlying the new blood vessel growth. However, a second pathway for neovascularization, that of adult vasculogenesis, is increasingly being invoked in a variety of states characterized by vascular growth. Postnatal vasculogenesis differs from angiogenesis in that new blood vessels arise from circulating bone marrow-derived endothelial progenitor cells (EPCs) rather than from the local endothelial cells.7 Although the initiating mechanism during the pathogenesis of infantile hemangioma has yet to be discovered, there is recent evidence that postnatal stem/progenitor cells may contribute to their explosive growth. Children with proliferating infantile hemangioma harbor increased levels of mobilized EPCs,8 and surgical specimens are positive for the coexpression of progenitor specific markers such as CD34, AC133, and vascular endothelial growth factor (VEGF) receptor-2.9,10 In this article, we address the possible mechanisms by which EPCs may be released into the circulation and recruited to sites of hemangioma growth.
The cellular pathways of EPC mobilization and trafficking are becoming clear. During tissue ischemia, the increased expression and stabilization of the transcription factor, hypoxia inducible factor-1
(HIF-1
), promotes the local production of stromal cell-derived factor-1
(SDF-1
) and vascular endothelial growth factor-A (VEGF-A) by hypoxic endothelial cells.11,12 These mediators are capable of enhancing the mobilization and recruitment of EPCs to ischemic tissue during postnatal vasculogenesis.12–16 In the bone marrow, MMP-9, which is also hypoxia responsive,17 may lead to the release of EPCs by cleavage of membrane bound kit ligand.18,19 Interestingly, children with proliferating hemangioma have increased urinary MMP-9,20 a finding which warrants further investigation of the role of this important mediator of stem/progenitor cell trafficking in hemangioma growth.
Another putative modulator of EPC trafficking and vascular remodeling is estrogen.21 Endothelial cells possess estrogen receptors (ERs), and the addition of estradiol is known to be protective for hypoxia-induced apoptosis.22–24 A distinct mechanism for estrogen-mediated mobilization of EPCs was identified downstream of nitric oxide synthase.25 Additionally, SDF-1
expression is enhanced by estrogen which may lead to increased stem/progenitor cell recruitment and proliferation in peripheral tissues.26,27 The possibility that estrogen regulation is involved in the growth of infantile hemangioma is suggested by the increased incidence in females, evidence of ER positivity in proliferating tumors, and elevated levels of circulating 17-β estradiol in affected children.28 A possible link between estrogen and hypoxia mediated neovascularization in the pathogenesis of infantile hemangioma has not been previously examined.
This study aims to determine whether HIF-1
and the hypoxia-regulated mediators of EPC trafficking are increased during human hemangioma growth in vivo. A second arm of the investigation examines the effects of hypoxia and estrogen on human endothelial cell proliferation in vitro. We demonstrate that HIF-1
and critical downstream targets are increased during hemangioma proliferation suggesting a new mechanism for the rapid progression of this tumor of infancy.
| Materials and Methods |
|---|
|
|
|---|
Immunohistochemistry Analysis
Tissue was harvested either from freshly excised proliferating or involuting focal hemangioma, and confirmed to be infantile hemangioma from clinical examination, pathology consultation, and immunofluorescence for GLUT1 (n=10, each group). Samples were fixed within 5 minutes of excision in 10% neutral buffered formalin and embedded in paraffin blocks. After deparaffinization and rehydration, slides were treated with target retrieval solution (DAKO) at 95°C for 10 minutes following the manufacturers instructions. Sections were incubated with 4 primary antibodies: mouse anti-human SDF-1
(R&D Systems) at a dilution of 1:200, mouse anti-human MMP-9 (R&D Systems) at a dilution of 1:200, rabbit anti-human VEGF-A (Santa Cruz Biotechnology) at a dilution of 1:200, and mouse anti-human HIF-1
(Novus Biologicals) at a dilution of 1:1000 in PBS with 1% BSA. Primary antibodies were detected using biotinylated secondary antibodies (Vector Labs) and the ABC immunoperoxidase method (Vector Labs). Control slides included isotype-matched host-specific antibodies at a dilution of 1:100, 10% primary antibody host-serum, and single (no primary antibody) and double (no primary or secondary antibody) negative controls. For analysis of HIF-1
positivity, 2 blinded investigators evaluated slides and quantified HIF-1
nuclear staining from 5 nonconsecutive tissue sections at 40x magnification in 10 random fields. These counts were averaged, normalized to total nuclei, and expressed as a percentage of HIF-1
-positive nuclei per high-power field (HPF). ER staining of surgical specimens was completed during routine tissue processing in the NYU Department of Pathology.
Cell Culture
Normal human microvascular endothelial cells (HMECs) were isolated from foreskin, and hemangioma endothelial cells (HemECs) were isolated from proliferating surgical specimens using methods previously described (n=3).29,30 Briefly, under sterile conditions, 3 2- to 3-mm wedges from different areas of the tissue were minced and digested with Liberase 3 enzyme (Roche). CD31 labeled magnetic beads (Dynal Biotech) were used to isolate endothelial cells followed by culture in EGM-2MV (Cambrex) on gelatin coated plates at a density of 5000/cm2.
[3H]Thymidine Incorporation Assay
Early passage (P2 or P3) HemEC and HMEC cultures (n=3) with similar population doubling times of 2 to 3 days, as calculated with a hemocytometer at cell seeding and harvest, were used to control for population doublings and biological age of the primary cell isolates. The cultures were subsequently incubated for 24 hours with endothelial basal medium-2 (Cambrex) and 1% fetal bovine serum to induce quiescence. Using methods previously described,31 DNA synthesis was reinitiated 6 hours before harvest by the addition of fully supplemented media, EGM-2MV, in the presence of 0.5 µCi/mL [3H]thymidine. Experimental cell cultures were treated with 10–8 mol/L estradiol (Sigma Aldrich) and exposed to normoxia (21% O2) or hypoxia (1% O2). Another set of HMEC cultures (n=3) was pretreated with 10–8 mol/L estradiol for 72 hours before initiation of the assay. After 24 hours, the cells were lysed for measurement of radioactivity in triplicate by liquid scintillation spectrometry (Beckman LS 1801).
RNA Extraction and Real-Time Quantitative RT-PCR
After 12 hours in normoxia hypoxia and with or without estradiol, total RNA was extracted from HMEC cultures using the Totally RNA extraction protocol (Ambion). Complimentary DNA libraries were reverse transcribed using the RNA PCR Core Kit (Applied Biosystems) and quantitative real-time PCR (Roche Light Cycler 1.2) with SYBR Green (Applied Biosystems) was performed using the following primers:
Human β-actin F: CTCCTTAATGTCACGCACGAT, Human β-actin R: CATGTACGTTGCTATCCAGGC, Human MMP-9 F: CACCTTCACTCGCGTGTACA, Human MMP-9 R: GACGCC-CATTTCGACGATGA.
All PCR products were analyzed by agarose gel electrophoresis and confirmed by DNA sequencing.
Statistical Analysis
Statistical analyses on data were performed by a Student t test or analysis of variance (ANOVA) with a posthoc Tukey test. All values are reported as mean±SEM. Statistical significance was determined by a probability value of P<0.05.
| Results |
|---|
|
|
|---|
|
Mediators of Progenitor Cell Trafficking Are Expressed in Proliferating Infantile Hemangioma
To further investigate hypoxia-induced mediators of progenitor cell trafficking in hemangiomagenesis, we analyzed tissue sections from involuting and proliferating specimens for SDF-1
, MMP-9, and VEGF-A. Involuting tissue sections demonstrated weak staining for all proteins (Figure 2). SDF-1
staining in proliferating hemangioma was highly positive with signal heavily concentrated around capillaries and perivascular cells (Figure 2). This finding is similar to previous studies demonstrating SDF-1
staining in tissues undergoing neovascularization.34 Sections of proliferating hemangioma specimens also exhibited abundant staining for MMP-9 and VEGF-A which was most intense in endothelial and interstitial cells (Figure 2). These findings are supported by previous evidence of increased VEGF-A and type IV collagenase in proliferating hemangioma.35–37
|
HIF-1
Stabilization Is Increased in Proliferating Infantile Hemangioma
Hypoxia directly leads to the stabilization of HIF-1
, a transcription factor that controls many genes involved in vasculogenesis including VEGF-A and SDF-1
. HIF-1
dysregulation has been implicated in the pathophysiology of other tumors, and we sought to determine whether it is involved in the proliferation of infantile hemangioma by evaluating tissues from involuting and proliferating hemangioma specimens for HIF-1
protein using methods in immunohistochemistry.
Tissue sections of involuting hemangioma demonstrated weak signal in the perinuclear cytoplasm (Figure 3A). In contrast, HIF-1
-positive nuclei in proliferating hemangioma sections were evident in numerous endothelial and interstitial cells (Figure 3B). Quantitative analyses demonstrated that the percentage of HIF-1
-positive nuclei was significantly increased in proliferating hemangioma compared with involuting tissues (95.6%±4.1 and 14.5%±6.8, respectively; *P<0.001, Figure 3C).
|
MMP-9 Induction in Response to Estradiol and Hypoxia in Human Endothelial Cells In Vitro
A major goal of this study was to investigate whether hypoxia and estrogen could act as a switch for normal microvascular endothelial cells to start the hemangioma growth process. From studies which demonstrated strong binding of estradiol in proliferating hemangioma tissue, it was hypothesized that estrogen may be an important mediator in infantile hemangioma growth.28 In support of this data, we found increased ER staining in proliferating human hemangioma specimens (Figure 2).
In experiments to evaluate MMP-9 transcriptional regulation in endothelial cells in response to hypoxia and estrogen, we chose to use the well described HMECs rather than the less clearly understood HemECs. With estradiol in normoxia, MMP-9 expression in HMECs was downregulated compared with controls (61.6%±3.1, CD.001, Figure 4). Untreated HMEC cultures placed in hypoxia revealed an increase in MMP-9 mRNA copies (51.3%±5.8, P<0.05), whereas supplementation with estradiol to hypoxic HMEC cultures markedly elevated MMP-9 expression (163.6%±3.8, P<0.001). These results suggest that estradiol and hypoxia may act in combination to enhance MMP-9 transcription in endothelial cells.
|
The Effects of Hypoxia and Estradiol on Hemangioma and Normal Endothelial Cell Proliferation
To further study the effects of hypoxia and estrogen on endothelial cell proliferation, [3H]thymidine uptake in stimulated HemEC and HMEC cultures was investigated. In these experiments, fully supplemented media, EGM-2MV, was used to expose the cultures to a microenvironment comparable to that found in infantile hemangioma. When measuring the proliferation of the cell cultures in hypoxia (1% O2), we found a significant increase over normoxia in both HemECs and HMECs (39.0%±8.6, P<0.001 and 15.4%±7.2, P<0.05, respectively; Figure 5).
|
In evaluating the potential for estrogen to further stimulate the proliferative phase of infantile hemangioma, we exposed normoxic and hypoxic HemEC and HMEC cultures to estradiol. In normoxic HemEC cultures, estradiol supplementation alone increased proliferation nearly as much as hypoxia (32.0%±4.5, P<0.001; Figure 5) whereas HMECs did not significantly proliferate with estradiol treatment in normoxia or hypoxia compared with controls (0.4%±10.9, P=0.48, 7.8%±5.2, P<0.05, respectively). After estradiol was added to HemEC cultures in hypoxia, a dramatic increase in proliferation was observed when compared with unstimulated cultures in normoxia (99.6%±12.2, P<0.001).
Based on analyses performed in this study and others,28,38 ERs are believed to be abundant on proliferating HemECs. Furthermore, preexposure of human endothelial cells to estradiol leads to significantly increased ER expression23,39; therefore, we preexposed HMECs to estradiol for 72 hours followed by treatment with a combination of estradiol and hypoxia. These cultures demonstrated enhanced proliferation compared with HMEC cultures that were not pretreated (42.9%±5.9, P<0.001, Figure 5). It was also found that in hypoxia without further estradiol supplementation, preexposed HMECs exhibited increased proliferation compared with untreated HMECs (40.4%±9.3, P<0.001). The data suggest that the mechanism of enhanced HemEC proliferation may be attributable to the convergence of ER signaling and hypoxia driven pathways.
| Discussion |
|---|
|
|
|---|
and its downstream effectors are upregulated in infantile hemangioma during the proliferative phase. Moreover, we reveal a synergistic interaction between estrogen stimulation and hypoxia signaling in endothelial cells that might explain the rapid growth of hemangioma in the perinatal period.
These data demonstrate that hypoxia-induced factors important for postnatal vasculogenesis (SDF-1
, MMP-9, VEGF-A, HIF-1
) are upregulated in children with proliferating hemangiomas. Other genes known to be expressed in hemangioma such as IGF-2 and GLUT-1 are also expressed in response to hypoxia and HIF-1
.43,44 Although HIF-1
protein is normally stabilized in the presence of decreased oxygen levels, overexpression in normoxic tissues can occur in some forms of cancer.45 Either mechanism of HIF-1
upregulation could potentially be responsible for the increased HIF-1
in proliferating hemangioma; however, the fact that later involuting specimens do not demonstrate increased HIF-1
suggests that physiological mechanisms are active and these lesions are truly hypoxic.
In the event that HIF-1
is stabilized by physiological mechanisms, infantile hemangioma may occur more frequently in ischemic tissues. There is data to suggest that hypoxia may be the initial stimulus for chorangioma, a tumor of the placenta that is histologically similar to hemangiomas.46 Infantile hemangioma also has a predilection for the head and neck region exhibiting a distribution that overlaps with embryonic fusion lines.3 It may be that these areas are more prone to ischemia because they are located in "watershed" vascular territories. Furthermore, environmental factors during fetal development may lead to insufficient vascularization of soft-tissues resulting in ischemia.47 Measurement of oxygen tension within the promontory mark would serve to confirm or refute whether these lesions are truly hypoxic, but these data are extremely difficult to obtain.
Previous studies have also suggested a role for estrogen in vasculogenesis21,25; therefore, we examined the effects of hypoxia and estrogen on hemangioma endothelial cells. Circulating levels of estradiol are often significantly elevated in the neonatal period when the tumor first begins to grow. At parturition, circulating levels of estradiol in the maternal plasma can reach as high as 50 000 pg/mL, over 500 times the normal value.48 This estrogen is free to cross the placenta into the fetal circulation,49 but, once transferred, its activity is suppressed by serum proteins including
-fetal protein50,51 and sex-hormone binding globulin (SHBG).52 After transition to the postnatal environment,
-fetal protein expression drops precipitously,53 and estradiol binding to SHBG is diminished.54 These physiological changes may result in an abrupt increase in free estrogen in the perinatal period which may stimulate areas of hypoxic endothelium to induce hemangioma formation.
In this article, we demonstrate the presence of hypoxia-induced mediators of progenitor/stem cell trafficking in proliferating infantile hemangioma specimens and reveal that the combination of hypoxia and estradiol results in a synergistic effect on the upregulation of MMP-9 in endothelial cells in vitro, a key factor in EPC mobilization. The transcription factor HIF1-
was also observed to be stabilized in proliferating hemangioma specimens, providing evidence that these lesions may be hypoxic and that the vasculogenic response could contribute to their progression. Moreover, estrogen, which is ubiquitously present when these lesions arise, may potentiate these effects by acting synergistically with hypoxia on ER+ endothelial cells to induce mitosis as shown by increased proliferation rates in HemEC- and ER-induced HMEC cultures in the presence of these 2 stimuli. Taken together, these data suggest a significant interplay between hypoxia and estrogen-mediated pathways of endothelial cell growth which may lead to new targets for the treatment of infantile hemangioma.
| Acknowledgments |
|---|
None.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
2. Mulliken JB, Zetter BR, Folkman J. In vitro characteristics of endothelium from hemangiomas and vascular malformations. Surgery. 1982; 92: 348–353.[Medline] [Order article via Infotrieve]
3. Waner M, North PE, Scherer KA, Frieden IJ, Waner A, Mihm MC Jr. The nonrandom distribution of facial hemangiomas. Arch Dermatol. 2003; 139: 869–875.
4. Margileth AM, Museles M. Cutaneous hemangiomas in children. Diagnosis and conservative management. JAMA. 1965; 194: 523–526.
5. Enjolras O, Gelbert F. Superficial hemangiomas: associations and management. Pediatr Dermatol. 1997; 14: 173–179.[Medline] [Order article via Infotrieve]
6. Mulliken JB, and Young AE. Vascular Birthmarks: Hemangiomas and Malformations. Philadelphia: Saunders; 1988.
7. Asahara T, Murohara T, Sullivan A, Silver M, van der Zee R, Li T, Witzenbichler B, Schatteman G, Isner JM. Isolation of putative progenitor endothelial cells for angiogenesis. Science. 1997; 275: 964–967.
8. Kleinman ME, Tepper OM, Capla JM, Bhatt KA, Ceradini DJ, Galiano RD, Blei F, Levine JP, Gurtner GC. Increased circulating AC133+ CD34+ endothelial progenitor cells in children with hemangioma. Lymphat Res Biol. 2003; 1: 301–307.[CrossRef][Medline] [Order article via Infotrieve]
9. Yu Y, Flint AF, Mulliken JB, Wu JK, Bischoff J. Endothelial progenitor cells in infantile hemangioma. Blood. 2004; 103: 1373–1375.
10. Peichev M, Naiyer AJ, Pereira D, Zhu Z, Lane WJ, Williams M, Oz MC, Hicklin DJ, Witte L, Moore MA, Rafii S. Expression of VEGFR-2 and AC133 by circulating human CD34(+) cells identifies a population of functional endothelial precursors. Blood. 2000; 95: 952–958.
11. Iyer NV, Kotch LE, Agani F, Leung SW, Laughner E, Wenger RH, Gassmann M, Gearhart JD, Lawler AM, Yu AY, Semenza GL. Cellular and developmental control of O2 homeostasis by hypoxia-inducible factor 1 alpha. Genes Dev. 1998; 12: 149–162.
12. Ceradini DJ, Kulkarni AR, Callaghan MJ, Tepper OM, Bastidas N, Kleinman ME, Capla JM, Galiano RD, Levine JP, Gurtner GC. Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1. Nat Med. 2004; 10: 858–864.[CrossRef][Medline] [Order article via Infotrieve]
13. Rafii S, Avecilla S, Shmelkov S, Shido K, Tejada R, Moore MA, Heissig B, Hattori K. Angiogenic factors reconstitute hematopoiesis by recruiting stem cells from bone marrow microenvironment. Ann N Y Acad Sci. 2003; 996: 49–60.[CrossRef][Medline] [Order article via Infotrieve]
14. Kalka C, Tehrani H, Laudenberg B, Vale PR, Isner JM, Asahara T, Symes JF. VEGF gene transfer mobilizes endothelial progenitor cells in patients with inoperable coronary disease. Ann Thorac Surg. 2000; 70: 829–834.
15. Park S, Tepper OM, Galiano RD, Capla JM, Baharestani S, Kleinman ME, Pelo CR, Levine JP, Gurtner GC. Selective recruitment of endothelial progenitor cells to ischemic tissues with increased neovascularization. Plast Reconstr Surg. 2004; 113: 284–293.[CrossRef][Medline] [Order article via Infotrieve]
16. Forsythe JA, Jiang BH, Iyer NV, Agani F, Leung SW, Koos RD, Semenza GL. Activation of vascular endothelial growth factor gene transcription by hypoxia-inducible factor 1. Mol Cell Biol. 1996; 16: 4604–4613.[Abstract]
17. Himelstein BP, Koch CJ. Studies of type IV collagenase regulation by hypoxia. Cancer Lett. 1998; 124: 127–133.[CrossRef][Medline] [Order article via Infotrieve]
18. Janowska-Wieczorek A, Marquez LA, Nabholtz JM, Cabuhat ML, Montano J, Chang H, Rozmus J, Russell JA, Edwards DR, Turner AR. Growth factors and cytokines upregulate gelatinase expression in bone marrow CD34(+) cells and their transmigration through reconstituted basement membrane. Blood. 1999; 93: 3379–3390.
19. Heissig B, Hattori K, Dias S, Friedrich M, Ferris B, Hackett NR, Crystal RG, Besmer P, Lyden D, Moore MA, Werb Z, Rafii S. Recruitment of stem and progenitor cells from the bone marrow niche requires MMP-9 mediated release of kit-ligand. Cell. 2002; 109: 625–637.[CrossRef][Medline] [Order article via Infotrieve]
20. Marler JJ, Fishman SJ, Kilroy SM, Fang J, Upton J, Mulliken JB, Burrows PE, Zurakowski D, Folkman J, Moses MA. Increased expression of urinary matrix metalloproteinases parallels the extent and activity of vascular anomalies. Pediatrics. 2005; 116: 38–45.
21. Strehlow K, Werner N, Berweiler J, Link A, Dirnagl U, Priller J, Laufs K, Ghaeni L, Milosevic M, Bohm M, Nickenig G. Estrogen increases bone marrow-derived endothelial progenitor cell production and diminishes neointima formation. Circulation. 2003; 107: 3059–3065.
22. Razandi M, Pedram A, Levin ER. Estrogen signals to the preservation of endothelial cell form and function. J Biol Chem. 2000; 275: 38540–38546.
23. Venkov CD, Rankin AB, Vaughan DE. Identification of authentic estrogen receptor in cultured endothelial cells. A potential mechanism for steroid hormone regulation of endothelial function. Circulation. 1996; 94: 727–733.
24. Spyridopoulos I, Sullivan AB, Kearney M, Isner JM, Losordo DW. Estrogen-receptor-mediated inhibition of human endothelial cell apoptosis. Estradiol as a survival factor. Circulation. 1997; 95: 1505–1514.
25. Iwakura A, Luedemann C, Shastry S, Hanley A, Kearney M, Aikawa R, Isner JM, Asahara T, Losordo DW. Estrogen-mediated, endothelial nitric oxide synthase-dependent mobilization of bone marrow-derived endothelial progenitor cells contributes to reendothelialization after arterial injury. Circulation. 2003; 108: 3115–3121.
26. DeNardo DG, Kim HT, Hilsenbeck S, Cuba V, Tsimelzon A, Brown PH. Global gene expression analysis of estrogen receptor transcription factor cross talk in breast cancer: identification of estrogen-induced/activator protein-1-dependent genes. Mol Endocrinol. 2005; 19: 362–378.
27. Hall JM, Korach KS. Stromal cell-derived factor 1, a novel target of estrogen receptor action, mediates the mitogenic effects of estradiol in ovarian and breast cancer cells. Mol Endocrinol. 2003; 17: 792–803.
28. Sasaki GH, Pang CY, Wittliff JL. Pathogenesis and treatment of infant skin strawberry hemangiomas: clinical and in vitro studies of hormonal effects. Plast Reconstr Surg. 1984; 73: 359–370.[Medline] [Order article via Infotrieve]
29. Kraling BM, Bischoff J. A simplified method for growth of human microvascular endothelial cells results in decreased senescence and continued responsiveness to cytokines and growth factors. In Vitro Cell Dev Biol Anim. 1998; 34: 308–315.[Medline] [Order article via Infotrieve]
30. Boye E, Yu Y, Paranya G, Mulliken JB, Olsen BR, Bischoff J. Clonality and altered behavior of endothelial cells from hemangiomas. J Clin Invest. 2001; 107: 745–752.[Medline] [Order article via Infotrieve]
31. Tepper OM, Capla JM, Galiano RD, Ceradini DJ, Callaghan MJ, Kleinman ME, Gurtner GC. Adult vasculogenesis occurs through in situ recruitment, proliferation, and tubulization of circulating bone marrow-derived cells. Blood. 2005; 105: 1068–1077.
32. Terai M, Yasukawa K, Narumoto S, Tateno S, Oana S, Kohno Y. Vascular endothelial growth factor in acute Kawasaki disease. Am J Cardiol. 1999; 83: 337–339.[CrossRef][Medline] [Order article via Infotrieve]
33. Takeshita S, Tokutomi T, Kawase H, Nakatani K, Tsujimoto H, Kawamura Y, Sekine I. Elevated serum levels of matrix metalloproteinase-9 (MMP-9) in Kawasaki disease. Clin Exp Immunol. 2001; 125: 340–344.[CrossRef][Medline] [Order article via Infotrieve]
34. Salvucci O, Yao L, Villalba S, Sajewicz A, Pittaluga S, Tosato G. Regulation of endothelial cell branching morphogenesis by endogenous chemokine stromal-derived factor-1. Blood. 2002; 99: 2703–2711.
35. Frischer JS, Huang J, Serur A, Kadenhe A, Yamashiro DJ, Kandel JJ. Biomolecular markers and involution of hemangiomas. J Pediatr Surg. 2004; 39: 400–404.[CrossRef][Medline] [Order article via Infotrieve]
36. Takahashi K, Mulliken JB, Kozakewich HP, Rogers RA, Folkman J, Ezekowitz RA. Cellular markers that distinguish the phases of hemangioma during infancy and childhood. J Clin Invest. 1994; 93: 2357–2364.[Medline] [Order article via Infotrieve]
37. Chang J, Most D, Bresnick S, Mehrara B, Steinbrech DS, Reinisch J, Longaker MT, Turk AE. Proliferative hemangiomas: analysis of cytokine gene expression and angiogenesis. Plast Reconstr Surg. 103: 1–9, 1999; discussion 10.[CrossRef]
38. Xiao X, Liu J, Sheng M. Synergistic effect of estrogen and VEGF on the proliferation of hemangioma vascular endothelial cells. J Pediatr Surg. 2004; 39: 1107–1110.[CrossRef][Medline] [Order article via Infotrieve]
39. Ihionkhan CE, Chambliss KL, Gibson LL, Hahner LD, Mendelsohn ME, Shaul PW. Estrogen Causes Dynamic Alterations in Endothelial Estrogen Receptor Expression. Circ Res. 2002; 91: 814–820.
40. Al Buainian H, Verhaeghe E, Dierckxsens L, Naeyaert JM. Early treatment of hemangiomas with lasers. A review. Dermatology. 2003; 206: 370–373.[CrossRef][Medline] [Order article via Infotrieve]
41. Hamlat A, Adn M, Pasqualini E, Brassier G, Askar B. Pathophysiology of capillary haemangioma growth after birth. Med Hypotheses. 2005; 64: 1093–1096.[CrossRef][Medline] [Order article via Infotrieve]
42. Ritter MR, Reinisch J, Friedlander SF, Friedlander M. Myeloid cells in infantile hemangioma. Am J Pathol. 2006; 168: 621–628.
43. Feldser D, Agani F, Iyer NV, Pak B, Ferreira G, Semenza GL. Reciprocal positive regulation of hypoxia-inducible factor 1alpha and insulin-like growth factor 2. Cancer Res. 1999; 59: 3915–3918.
44. Gleadle JM, Ratcliffe PJ. Induction of hypoxia-inducible factor-1, erythropoietin, vascular endothelial growth factor, and glucose transporter-1 by hypoxia: evidence against a regulatory role for Src kinase. Blood. 1997; 89: 503–509.
45. Zhong H, De Marzo AM, Laughner E, Lim M, Hilton DA, Zagzag D, Buechler P, Isaacs WB, Semenza GL, Simons JW. Overexpression of hypoxia-inducible factor 1alpha in common human cancers and their metastases. Cancer Res. 1999; 59: 5830–5835.
46. Ogino S, Redline RW. Villous capillary lesions of the placenta: distinctions between chorangioma, chorangiomatosis, and chorangiosis. Hum Pathol. 2000; 31: 945–954.[CrossRef][Medline] [Order article via Infotrieve]
47. Steegers-Theunissen RP, Steegers EA. Nutrient-gene interactions in early pregnancy: a vascular hypothesis. Eur J Obstet Gynecol Reprod Biol. 2003; 106: 115–117.[CrossRef][Medline] [Order article via Infotrieve]
48. Walsh SW, Stanczyk FZ, Novy MJ. Daily hormonal changes in the maternal, fetal, and amniotic fluid compartments before parturition in a primate species. J Clin Endocrinol Metab. 1984; 58: 629–639.
49. Hagerman DD, Villee CA. Transport functions of the placenta. Physiol Rev. 1960; 40: 313–330.
50. Vakharia D, Mizejewski GJ. Human alpha-fetoprotein peptides bind estrogen receptor and estradiol, and suppress breast cancer. Breast Cancer Res Treat. 2000; 63: 41–52.[CrossRef][Medline] [Order article via Infotrieve]
51. Mizejewski G, Smith G, Butterstein G. Review and proposed action of alpha-fetoprotein growth inhibitory peptides as estrogen and cytoskeleton-associated factors. Cell Biol Int. 2004; 28: 913–933.[CrossRef][Medline] [Order article via Infotrieve]
52. Khosla S. Sex Hormone Binding Globulin: Inhibitor or Facilitator (or Both) of Sex Steroid Action? J Clin Endocrinol Metab. 2006; 91: 4764–4766.
53. Wu JT, Book L, Sudar K. Serum alpha fetoprotein (AFP) levels in normal infants. Pediatr Res. 1981; 15: 50–52.[Medline] [Order article via Infotrieve]
54. Philip A, Murphy BE. Does sex hormone-binding globulin play a role in the transport of estradiol in vivo? Am J Obstet Gynecol. 1984; 148: 643–648.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
V. Sans, E. D. de la Roque, J. Berge, N. Grenier, F. Boralevi, J. Mazereeuw-Hautier, D. Lipsker, E. Dupuis, K. Ezzedine, P. Vergnes, et al. Propranolol for Severe Infantile Hemangiomas: Follow-Up Report Pediatrics, September 1, 2009; 124(3): e423 - e431. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Praveen, R. Vidavalur, T. S. Rosenkrantz, and N. Hussain Infantile Hemangiomas and Retinopathy of Prematurity: Possible Association Pediatrics, March 1, 2009; 123(3): e484 - e489. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Garzon, B. A. Drolet, E. Baselga, S. L. Chamlin, A. N. Haggstrom, K. Horii, A. W. Lucky, A. J. Mancini, D. W. Metry, B. Newell, et al. Comparison of Infantile Hemangiomas in Preterm and Term Infants: A Prospective Study Arch Dermatol, September 1, 2008; 144(9): 1231 - 1232. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2007 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |