Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2007;27:190-196
Published online before print October 12, 2006, doi: 10.1161/01.ATV.0000249721.96666.e5
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
27/1/190    most recent
01.ATV.0000249721.96666.e5v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, R.
Right arrow Articles by Jiang, X.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, R.
Right arrow Articles by Jiang, X.-C.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2007;27:190.)
© 2007 American Heart Association, Inc.


Atherosclerosis and Lipoproteins

Macrophage Phospholipid Transfer Protein Deficiency and ApoE Secretion

Impact on Mouse Plasma Cholesterol Levels and Atherosclerosis

Ruijie Liu; Mohammad R. Hojjati; Cecilia M. Devlin; Inge H. Hansen; Xian-Cheng Jiang

From the Department of Anatomy and Cell Biology (R.L., M.R.H., X.C.J.), SUNY Downstate Medical Center, Brooklyn, and the Department of Medicine (C.M.D., I.H.H.), Columbia University, New York.

Correspondence to Dr Xian-Cheng Jiang, Department of Anatomy and Cell Biology, SUNY Downstate Medical Center, 450 Clarkson Ave, Box 5, Brooklyn, NY 11203. E-mail xjiang{at}downstate.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Objective— PLTP and apoE play important roles in lipoprotein metabolism and atherosclerosis. It is known that formation of macrophage-derived foam cells (which highly express PLTP and apoE) is the critical step in the process of atherosclerosis. We investigated the relationship between PLTP and apoE in macrophages and the atherogenic relevance in a mouse model.

Methods and Results— We transplanted PLTP-deficient mouse bone marrow into apoE-deficient mice (PLTP–/–->apoE–/–), creating a mouse model with PLTP deficiency and apoE expression exclusively in the macrophages. We found that PLTP–/–->apoE–/– mice have significantly lower PLTP activity, compared with controls (WT->apoE–/–; 20%, P<0.01). On a Western diet, PLTP–/–->apoE–/– mice have significantly lower plasma apoE than that of WT->apoE–/– mice (63%, P<0.001), and PLTP-deficient macrophages secrete significantly less apoE than WT macrophages (44%, P<0.01). Moreover, PLTP–/–->apoE–/– mice have significantly higher plasma cholesterol (98%, P<0.001) and phospholipid (107%, P<0.001) than that of WT->apoE–/– mice, thus increasing atherosclerotic lesions in the aortic arch and root (403%, P<0.001), as well as the entire aorta (298%, P<0.001).

Conclusions— Macrophage PLTP deficiency causes a significant reduction of apoE secretion from the cells, and this in turn promotes the accumulation of cholesterol in the circulation and accelerates the development of atherosclerosis.

Macrophage PLTP deficiency causes a significant reduction of apoE secretion from the cells, and this in turn promotes the accumulation of cholesterol in the circulation and accelerates the development of atherosclerosis.


Key Words: phospholipid transfer protein • apoE • bone marrow transplantation • macrophage • lipoprotein • atherosclerosis


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Plasma PLTP is known to be an independent risk factor for coronary artery disease,1 and is significantly increased in obesity, as well as in diabetes.2,3 Moreover, PLTP deficiency decreases,4 and PLTP overexpression increases,5,6 atherosclerosis in mouse models, so that it is considered a potential target for pharmacological or gene therapy. However, research toward this goal is hampered by the fact that the mechanism of the atherogenicity of PLTP is not completely understood. This is a multifunctional protein that is expressed in a variety of tissues, with some of its effects considered proatherogenic,7,8 and others antiatherogenic.9–11

ApoE is a multifunctional protein that is synthesized by the liver and several peripheral tissues and cell types.12,13 ApoE serves as a ligand for receptor-mediated uptake of lipoproteins through the LDL receptor, the LDL receptor-related protein, and heparan sulfate proteoglycans.14 ApoE also plays a key role in intracellular lipid metabolism, influencing processes such as the assembly and secretion of lipoproteins15,16 and cholesterol efflux to HDL.17

The relationship between PLTP and apoE is mostly unknown. In type 2 diabetes, PLTP activity was positively correlated with plasma apoE levels.18 Of the circulating PLTP mass only a minor portion is in the active form in normolipidemic subjects.19 It has been reported that active PLTP in plasma is associated with apoE but not with apoA-I,20 and apoE proteoliposomes can convert inactive PLTP into active one.21 There is a hypothesis that transfer of active PLTP from apoE-containing lipoproteins to apoA-I–containing ones results in the conversion of active PLTP to inactive PLTP.20 However, this is not confirmed by a recent report, indicating that active plasma PLTP is associated primarily with apoA-I but not apoE-containing lipoproteins.22

The formation of foam cells from lipid-accumulated macrophages is a critical step in atherogenesis. Both macrophages and macrophage-derived foam cells express PLTP.23 It has recently been shown that PLTP is highly expressed in macrophages from atherosclerotic lesions.24,25 Macrophages synthesize and secrete apoE, which makes contribution to the apoE pool in the blood circulation and associates with plasma lipoproteins and accelerates their clearance in vivo.26,27 Macrophage-derived apoE can also act as a cholesterol acceptor to remove it from cholesterol-loaded cells.28,29 The effect of macrophage-derived apoE on cholesterol metabolism may be critical in protecting the artery wall from atherosclerotic lesion formation.26,27 The relationship between PLTP and apoE in macrophages is unknown. However, it has been reported that PLTP is associated with apoE in human cerebrospinal fluid, and that exogenous addition of recombinant PLTP to primary human astrocytes significantly increases apoE secretion to the conditioned medium.30 It has been also reported that PLTP secreted from HepG2 cells is associated with apoE but not apoA-I.31 These phenomena may also exist in macrophages, thus playing a role in cholesterol metabolism and the process of atherosclerosis.

To evaluate the specific relationship between PLTP and apoE in macrophages, we transplanted PLTP-deficient mouse bone marrow into apoE-deficient mice (PLTP–/–->apoE–/–), creating a model with PLTP deficiency and apoE expression exclusively in the macrophages. We investigated plasma apoE, cholesterol, and phospholipid levels, as well as atherosclerosis development in these animals.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Mice and Diets
ApoE-deficient (apoE–/–) mice (8-week-old females) of the C57BL/6 background and wild-type (WT) C57BL/6 mice were purchased from Jackson Laboratory (Bar Harbor, Me). PLTP-deficient (PLTP–/–) animals with C57BL/6 background were available in our laboratory.37 All were fed a chow diet (Research Diets, Inc). Three months after bone marrow transplantation, all mice were switched to a Western diet (0.15% cholesterol, 20% saturated fat) for 7 months. Experiments involving animals were conducted with the approval of SUNY Downstate Medical Center IACUC.

Bone Marrow Transplantation To Replace Peripheral Macrophages
Bone marrow cells were harvested from the tibias of donor mice (PLTP–/– and WT), as previously described.26,27 Twenty apoE–/– mice were lethally irradiated with 1000 rads (10Gy). Ten of these animals were transplanted with PLTP–/– mouse bone marrow cells (5x106 cells), and the other 10 with WT mouse ones, via the femoral vein within 3 hours of irradiation. We monitored the process of cell replacement by polymerase chain reaction (PCR), using genomic DNA from mouse white blood cells as a template. The genotype of PLTP and apoE were determined with PCR. PLTP primer sequences: (1) TGGTCATGCATCTAGAAC GGAGT; (2) AAAGGCTGCTGGACCCGCG; 3) GCAGCGCATCGCCTTCTATC. ApoE primer sequences: (1) GCCTAGCCGAGGGAGGACCG; (2) TGTGACTTGGGAGCTCTGCAGC; (3) GCCGCCCCGACTGCATCT.

PLTP Activity Assay
PLTP activity was measured with an assay kit (Cardiovascular Target, Inc) as reported previously.32

Lipid and Lipoprotein Assays
The total cholesterol and phospholipid in plasma were assayed by enzymatic methods (Wako Pure Chemical Industries, Ltd). Lipoprotein profiles were obtained by fast protein liquid chromatography (FPLC), using a Sepharose 6B columns.37

SDS PAGE Analysis of Apolipoprotein
After 12 weeks of bone marrow transplantation, mice were fed with a Western diet for 4 weeks. Plasma was collected. The density of the plasma was adjusted to 1.21 g/mL with NaBr. Plasma lipoprotein were separated by preparative ultracentrifugation as described.37 The gel was scanned and the intensity of each band was measured by Image-Pro Plus version 4.5 software (Media Cybernetics, Inc).

Western Blot for Mouse ApoE
SDS PAGE was performed on a 4% to 20% SDS-polyacrylamide gradient gel, using 3 µL of mouse plasma or isolated lipoprotein solutions (1.006<d<1.063 g/mL and 1.063<d<1.21 g/mL, 200 µg protein), and the separated proteins were transferred to nitrocellulose membrane. Western blot analysis for mouse apoE was performed, using a polyclonal antimouse apoE antibody (Santa Cruz Biotechnology, Inc). Horseradish peroxidase–conjugated rabbit polyclonal antibody to mouse IgG (Novus Biologicals) was used as a secondary antibody. The SuperSignal West detection kit (Pierce) was used for the detection step. The maximum intensity of each band was measured by Image-Pro Plus version 4.5 software (Media Cybernetics, Inc), and used for analysis.

Peritoneal Macrophage Collection, Culture, and Medium ApoE Detection
Thioglycollate-elicited peritoneal macrophages were collected by peritoneal lavage. Half million cells were suspended in Opti-Mum medium (Gibco 31985-070) and plated in a well of 24-well plate. Cells were cultured overnight and then incubated in methionine-free DMEM (Gibco 21013-024) for 20 minutes. After that the cells were incubated with 35S-methionine (40uCi/mL, Amersham Biosciences) for 6 hours. ApoE in the medium was collected by immunoprecipitation with an anti-mouse apoE antibody (Santa Cruz) and protein A/G beads (Santa Cruz), and the radioactivity was counted as described.33

Mouse Atherosclerotic Lesion Measurement
The aorta was dissected and the arch photographed, as previously reported.34 Aortic root and en face assays were performed as described previously.34

Statistical Analysis
Each experiment was conducted at least 3 times. Data are typically expressed as mean±SD. Differences between groups were tested by Mann–Whitney U test (nonparametric test) and among multiple groups by ANOVA followed by the post-hoc test.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Macrophage PLTP Makes a Contribution to PLTP Activity in the Circulation
Twenty apoE–/– mice were lethally irradiated. After 3 hours, half the animals were transplanted with PLTP–/– mouse bone marrow cells (PLTP–/–->apoE–/–), and the other half with WT ones (WT->apoE–/–). We monitored the process of cell replacement by PCR, using genomic DNA from the mouse white blood cells as a template. In PLTP–/–->apoE–/– group, by 8 weeks after transplantation, the peripheral cells had been replaced by donor cells with a PLTP deficiency and an apoE expression genotype (Figure 1). In WT->apoE–/– group, the replaced peripheral cells had both a PLTP and an apoE expression genotype (Figure 1).


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
Figure 1. Genotype determination of mouse peripheral cells. Genomic DNA was extracted from white blood cells of the same mouse, before and after irradiation. The genotype of PLTP and apoE were determined with PCR, as described in Methods. Pre, pretransplantation; Post, 8 week after transplantation.

After 10 weeks of bone marrow transplantation, we measured plasma PLTP activity in both group of animals before and after bone marrow transplantation. We found that PLTP–/–->apoE–/– mice had 20% less plasma PLTP activity than did WT->apoE–/– animals, suggesting that macrophages make about a 20% contribution to PLTP activity in the circulation. Moreover, based on the results obtained from WT->apoE–/–mice, we can conclude that irradiation and bone marrow transplantation did not influence plasma PLTP activity.

Plasma Lipoprotein Analysis
It is known that through replacement of apoE–/– peripheral cells with WT ones, the hyperlipidemia of these animals can be corrected, owing to the ability of macrophage-derived apoE to associate with circulating lipoproteins and promote their clearance.26,27 On chow diet, we confirmed this observation (data not shown). However, we did not find lipid changes in PLTP–/–->apoE–/– mice compared with WT->apoE–/– animals (data not shown). We next sought to determine whether a high fat high cholesterol diet could alter the lipid metabolism in those mice. After 12 weeks of bone marrow transplantation, we fed the mice with a Western diet for 4 weeks. We then determined the plasma PLTP activity and lipid levels. PLTP–/–->apoE–/– mice has 22% lower PLTP activity than that of WT ->apoE–/– ones. Moreover, PLTP–/–->apoE–/– mice have significantly higher plasma cholesterol and phospholipid levels, compared with WT->apoE–/– mice (98% and 107%, P<0.001, respectively; Table). The FPLC of pooled plasma samples revealed that both non-HDL and HDL cholesterol and phospholipid were higher in PLTP–/–->apoE–/– mice than in WT ->apoE–/– ones (Figure 2A and 2B). Because non-HDL lipoproteins are the major ones in the mice, the accumulated cholesterol and phospholipid are mainly located on those particles (Figure 2A and 2B). As controls, we also measured cholesterol and phospholipid distributions in WT and apoE–/– mice. Four weeks after a Western diet, WT mice accumulate cholesterol and phospholipid, most of them were on HDL fractions (Figure 2A and 2B), whereas apoE–/– mice on non-HDL fractions (Figure 2A and 2B). Assessment of apolipoprotein composition of centrifugally isolated lipoproteins by reducing SDS-PAGE revealed an increase of apoB (apoB48 + apoB100) (95%, P<0.01) and an increase of apoA-I levels (88%, P<0.01; Figure 2C through 2E). Moreover, WT->apoE–/– mice are different from WT mice, in terms of their apoB levels. ApoB48 is the major apoB in WT->apoE–/– mice (Figure 2C), whereas apoB100 is the major apoB in WT mice.37 All these results indicate that, on a Western diet, macrophage PLTP deficiency has a significant contribution to the plasma lipid and lipoprotein metabolisms.


View this table:
[in this window]
[in a new window]

 
Plasma and Lipoprotein Lipid Analysis in Mice on a Western Type Diet


Figure 2
View larger version (28K):
[in this window]
[in a new window]

 
Figure 2. Mouse plasma lipoprotein analyses. WT->apoE–/–, PLTP–/–->apoE–/–, WT, and apoE–/– mice were on Western diet for 4 weeks. Lipoprotein and apolipoprotein levels were determined. A and B, Plasma lipoproteins were analyzed by FPLC. A 200-µL aliquot of pooled plasma (from 5 to 10 animals) was loaded onto a Sepharose 6B column and eluted with 50 mmol/L Tris, 0.15 mol/L NaCl (pH 7.5). An aliquot of each fraction was used for the determination of cholesterol and phospholipid. C, SDS-PAGE analysis of apolipoproteins. Individual mouse plasma (150 µL) lipoproteins (density=1.006 to 1.21 g/mL) were separated by preparative ultracentrifugation as described.37 SDS-PAGE was performed on 4% to 20% SDS–polyacrylamide gradient gel, and the apolipoproteins were stained by Coomassie brilliant blue as described in Methods. D and E, Quantitative display of apoB (apoB48 + apoB100) and apoA-I, respectively. Values are mean ± SD, n=4. Data were analyzed with Mann–Whitney U test (nonparametric test), *P<0.01.

We then sought to determine whether macrophage PLTP deficiency has an impact on apoE levels in the circulation, thus influencing the lipoprotein metabolism. We used Western blot to measure apoE in the plasma, finding that PLTP–/–->apoE–/– mice have significantly less apoE in the circulation than WT->apoE–/– (63%, P<0.01; Figure 3A and 3C). We also isolated non-HDL (1.006<d<1.063 g/mL) and HDL particles (1.063<d<1.21 g/mL) and performed the Western blot on them. We found that apoE is mainly located on non-HDL portion, and PLTP–/–->apoE–/– mouse non-HDL particles carry significant less apoE than that of WT->apoE–/– mouse (70%, P<0.01; Figure 3B and 3D). There is detectable apoE on HDL portion in both PLTP–/–->apoE–/– and WT->apoE–/– mice (Figure 3B and 3E), and PLTP–/–->apoE–/– mouse HDL particles carry significant less apoE than that of WT->apoE–/– mouse (58%, P<0.01). To further evaluate the effect of PLTP deficiency on apoE in macrophage, we isolated peritoneal macrophages from both WT and PLTP–/– mice on chow or a Western diet. The macrophages were culture overnight and then pulsed with 35S-methionine for 6 hours. The radiolabeled apoE in the medium was immunoprecipitated and measured. We found that, on a Western type diet, PLTP–/– macrophage secreted significant less apoE than WT macrophages (44%, P<0.01; Figure 3F), whereas, on chow diet, the difference did not reach statistical significance. All these results revealed that on a Western type diet PLTP deficiency in the macrophages significantly decreases apoE secretion from the cells.


Figure 3
View larger version (21K):
[in this window]
[in a new window]

 
Figure 3. ApoE analysis. WT->apoE–/– and PLTP–/–->apoE–/– mice were fed a Western diet for 4 weeks. ApoE in plasma and lipoprotein fractions was measured by Western blot. A and B, SDS-PAGE was performed on a 4% to 20% SDS–polyacrylamide gradient gel, using 3 µL of mouse plasma, or isolated lipoprotein fractions (1.006<d<1.063 g/mL, and 1.063<d<1.21 g/mL, 200 µg protein) from individual mouse plasma (150 µL). The separated proteins were transferred to nitrocellulose membrane. Western blot analysis for mouse apoE was performed as described in Methods. C, Quantitative display of apoE in plasma. D and E, Quantitative display of apoE in non-HDL and HDL fractions, respectively. F, ApoE measurement in peritoneal macrophage culture medium. Twelve-week-old WT and PLTP–/– mice (n=4) were fed with chow diet or a Western type diet for 2 weeks. Thioglycollate-elicited peritoneal macrophages were collected by peritoneal lavage. The procedure for measuring apoE in the medium was described in Methods. Values are mean±SD, n=4. Data were analyzed with Mann–Whitney U test (nonparametric test), *P<0.01.

Evaluation of Atherosclerosis
To evaluate the impact of macrophage PLTP deficiency on atherogenesis, we dissected mouse aortas and photographed them. We also measured proximal and whole aortic lesion areas. After 7 months on a Western diet, we found that all 10 PLTP–/–->apoE–/– mice (10/10) had very obvious lesions in the aortic arch, whereas only 2 of the 10 WT ->apoE–/– animals (2/10) had observable lesions there (Figure 4A). We also found that PLTP–/–->apoE–/– mice had a 4-fold (P<0.0001) larger lesion area in the proximal aorta, and a 3-fold (P<0.0001) larger lesion area in the whole aorta, compared with WT->apoE–/– mice (Figure 4B and 4C). These results indicate that macrophage PLTP deficiency causes a significant reduction of apoE secretion from the cells, and this in turn promotes the accumulation of cholesterol in the circulation and accelerates the development of atherosclerosis.


Figure 4
View larger version (45K):
[in this window]
[in a new window]

 
Figure 4. Mouse atherosclerotic lesion determination. A, Mice were euthanized and the aortas dissected and photographed. This set of pictures is representative of 10 sets. Atherosclerotic lesions were indicated by arrows. B and C, Quantification of atherosclerotic lesions in the proximal aorta by root assay and whole aorta by en face assay in mice fed a Western type diet for 7 months. The procedures for root assay and en face assay were performed as described.34 Values are mean±SD. Data were analyzed with Mann–Whitney U test (nonparametric test), *P<0.001; n=10.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
In this study, we found that macrophage PLTP deficiency significantly: (1) decreased PLTP activity in the circulation; (2) increased plasma cholesterol and phospholipid levels, mainly on non-HDL lipoproteins, on a Western diet; (3) decreased plasma apoE contents which are mainly located on non-HDL lipoproteins; (4) decreased apoE secretion from peritoneal macrophages; and (5) increased atherosclerotic lesions in the aortic arch, root, and the entire aorta.

It has been reported that macrophages express PLTP,23–25 but the contribution of that PLTP to the plasma PLTP has been uncertain, for other tissues including the liver, adipose tissue, lung, and small intestine, all express PLTP mRNA.35,36 Because our results show that macrophage PLTP deficiency decreases plasma PLTP activity, we know that mouse macrophage PLTP can be secreted into the circulation, making about a 20% contribution to plasma PLTP activity. However, we do not believe that 20% difference of PLTP activity in the circulation could induce such a significant lipoprotein changes (Table) and therefore atherosclerosis (Figure 4), because we know that heterozygous of PLTP deficiency (PLTP activity is decreased {approx}50%) does not change lipoprotein metabolism in mice.37

Because no evidence to show peripheral cells other than monocytes/macrophages express both PLTP and apoE, the phenomena observed in this study were coming from the PLTP-deficient and apoE-expressed monocytes/macrophages. Our results indicate that, on chow diet, there was no obvious difference between PLTP–/–->apoE–/– and WT->apoE–/– mice, in terms of lipid levels (data not shown), suggesting that the apoE in the circulation is sufficient enough for the lipid clearance. It has been reported that apoE levels, which are only 12.5% of those in normal mice, are sufficient to achieve normalization of plasma cholesterol in apoE–/– mice after WT bone marrow transplantation.26 However, when the animals were challenged with a Western diet, the PLTP–/–->apoE–/– mice cannot properly catabolize the dietary lipids owing to the defect of apoE secretion from the macrophage, thus cholesterol (mainly non-HDL cholesterol) was accumulated in the circulation (Table; Figure 2A).

The mechanism by which PLTP deficiency decreases apoE secretion from the macrophages is not yet clear. One possibility is that apoE secretion from macrophage needs PLTP assistance. It was reported that {alpha}-helix–containing apolipoproteins (apoA-I, apoA-II, apoA-IV, apoE2, apoE3, apoE4) stimulate apoE secretion, implying a positive feedback autocrine loop for apoE secretion.38 PLTP also is {alpha}-helix–containing protein39 and is involved in lipoprotein metabolism, and it is conceivable that PLTP may also be needed for proper apoE secretion from cells. Indeed, PLTP secreted from HepG2 cells is associated with apoE but not apoA-I.31 PLTP in the circulation19,20 or in human cerebrospinal fluid is associated with apoE.30 Exogenous addition of PLTP to primary human astrocytes significantly increases apoE secretion.30 However, in this study, PLTP from other origin does not seem to interfere with macrophage apoE secretion, indicating that PLTP in the circulation does not but macrophage derived PLTP does directly influence apoE secretion from macrophages, although the mechanism is still unknown. Because PLTP deficiency also decreases apoB secretion from hepatocytes,4 there may be a PLTP-mediated mechanism for both apolipoproteins in the secreting pathway. This phenomenon deserves further investigation.

It has been reported that the increase in mouse atherosclerotic lesion area is correlated with decreased cholesterol efflux from apoE-deficient macrophages.27 Previous reports also indicated replacement of apoE–/– peripheral cells with WT ones, the hyperlipidemia of these animals can be corrected and atherosclerosis can be dramatically diminished, owing to apoE secretion into the circulation from macrophages.26,27 Macrophage-derived apoE per se has an antiatherogenic property. Our results revealed that macrophage PLTP deficiency blocks cellular apoE secretion and reduces apoE-mediated cholesterol clearance from the circulation, thus promoting atherosclerosis (Figure 4). In regard of apoE secretion, macrophage PLTP deficiency has a proatherogenic property.

A most recent bone marrow transplantation study indicated that PLTP–/–->LDLR–/– mice had significant more atherosclerotic lesions than WT->LDLR–/– mice.40 However, the proatherogenic properties of macrophage PLTP deficiency were not observable in the presence of elevated plasma concentrations of apoAI.40 ApoE levels were not measured in the study. It seems that a mechanism, other than prevention of apoE secretion, also make contribution to the proatherogenic properties of macrophage PLTP deficiency in mice.

It seems contradictory that macrophage-specific PLTP deficiency is proatherogenic, whereas a general PLTP deficiency is antiatherogenic.4 PLTP is a multifunctional protein that is expressed in a variety of tissues. Some of its effects are considered proatherogenic, and others antiatherogenic. The final atherosclerotic lesion formation is the consequence of this combination. Recent data indicate that PLTP deficiency in mice is associated with a decrease in atherosclerotic susceptibility, despite concomitant decreases in plasma HDL levels.4 Complementary metabolic studies have revealed that at least 3 distinct molecular mechanisms could account for the reduction of atherosclerosis in PLTP deficient animals. They include: (1) the reduction in liver production and plasma levels of potentially atherogenic apoB-containing lipoproteins,4 (2) the rise in the antioxidative potential of apoB-containing lipoproteins attributable to the accumulation of vitamin E,41 and (3) improvements in the antiinflammatory properties of HDL in mice, which reduce the ability of LDL to induce monocyte chemotactic activity.42,43 Published reports have also indicated that PLTP overexpression in mice increases atherosclerotic lesions,5,6 despite the increase of preß-HDL,10 a known factor involved in reverse cholesterol transport.28


*    Acknowledgments
 
Source of Funding

This work was supported by NIH HL-69817.

Disclosures

None.


*    Footnotes
 
Original received April 14, 2006; final version accepted September 20, 2006.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Schlitt A, Bickel C, Thumma P, Blankenberg S, Rupprecht HJ, Meyer J, Jiang XC. High plasma phospholipid transfer protein levels as a risk factor for coronary artery disease. Arterioscler Thromb Vasc Biol. 2003; 23: 1857–1862.[Abstract/Free Full Text]

2. Colhoun HM, Taskinen MR, Otvos JD, Van Den Berg P, O’Connor J, Van Tol A. Relationship of phospholipid transfer protein activity to HDL and apolipoprotein B-containing lipoproteins in subjects with and without type 1 diabetes. Diabetes. 2002; 51: 3300–3305.[Abstract/Free Full Text]

3. de Vries R, Dallinga-Thie GM, Smit AJ, Wolffenbuttel BH, van Tol A, Dullaart RP. Elevated plasma phospholipid transfer protein activity is a determinant of carotid intima-media thickness in type 2 diabetes mellitus. Diabetologia. 2006; 49: 398–404.[CrossRef][Medline] [Order article via Infotrieve]

4. Jiang XC, Qin S, Qiao C, Kawano K, Lin M, Skold A, Xiao X, Tall AR. Apolipoprotein B secretion and atherosclerosis are decreased in mice with phospholipid-transfer protein deficiency. Nat Med. 2001; 7: 847–852.[CrossRef][Medline] [Order article via Infotrieve]

5. van Haperen R, van Tol A, van Gent T, Scheek L, Visser P, van der Kamp A, Grosveld F, de Crom R. Increased risk of atherosclerosis by elevated plasma levels of phospholipid transfer protein. J Biol Chem. 2002; 277: 48938–48943.[Abstract/Free Full Text]

6. Lie J, de Crom R, van Gent T, van Haperen R, Scheek L, Sadeghi-Niaraki F, van Tol A. Elevation of plasma phospholipid transfer protein increases the risk of atherosclerosis despite lower apolipoprotein B-containing lipoproteins. J Lipid Res. 2004; 45: 805–811.[Abstract/Free Full Text]

7. Lie J, de Crom R, van Gent T, van Haperen R, Scheek L, Lankhuizen I, van Tol A. Elevation of plasma phospholipid transfer protein in transgenic mice increases VLDL secretion. J Lipid Res. 2002; 43: 1875–1880.[Abstract/Free Full Text]

8. Foger B, Santamarina-Fojo S, Shamburek RD, Parrot CL, Talley GD, Brewer HB Jr. Plasma phospholipid transfer protein. Adenovirus-mediated overexpression in mice leads to decreased plasma high density lipoprotein (HDL) and enhanced hepatic uptake of phospholipids and cholesteryl esters from HDL. J Biol Chem. 1997; 272: 27393–27400.[Abstract/Free Full Text]

9. Jiang X, Francone OL, Bruce C, Milne R, Mar J, Walsh A, Breslow JL, Tall AR. Increased prebeta-high density lipoprotein, apolipoprotein AI, and phospholipid in mice expressing the human phospholipid transfer protein and human apolipoprotein AI transgenes. J Clin Invest. 1996; 98: 2373–2380.[Medline] [Order article via Infotrieve]

10. van Haperen R, van Tol A, Vermeulen P, Jauhiainen M, van Gent T, van den Berg P, Ehnholm S, Grosveld F, van der Kamp A, de Crom R. Human plasma phospholipid transfer protein increases the antiatherogenic potential of high density lipoproteins in transgenic mice. Arterioscler Thromb Vasc Biol. 2000; 20: 1082–1088.[Abstract/Free Full Text]

11. Post SM, de Crom R, van Haperen R, van Tol A, Princen HM. Increased fecal bile acid excretion in transgenic mice with elevated expression of human phospholipid transfer protein. Arterioscler Thromb Vasc Biol. 2003; 23: 892–897.[Abstract/Free Full Text]

12. Elshourbagy NA, Liao WS, Mahley RW, Taylor JM. Apolipoprotein E mRNA is abundant in the brain and adrenals, as well as in the liver, and is present in other peripheral tissues of rats and marmosets. Proc Natl Acad Sci U S A. 1985; 82: 203–207.[Abstract/Free Full Text]

13. Newman TC, Dawson PA, Rudel LL, Williams DL. Quantitation of apolipoprotein E mRNA in the liver and peripheral tissues of nonhuman primates. J Biol Chem. 1985; 260: 2452–2457.[Abstract/Free Full Text]

14. Mahley RW, Ji ZS. Remnant lipoprotein metabolism: key pathways involving cell-surface heparan sulfate proteoglycans and apolipoprotein E. J Lipid Res. 1999; 40: 1–16.[Abstract/Free Full Text]

15. Huang Y, Ji ZS, Brecht WJ, Rall SC Jr, Taylor JM, Mahley RW. Overexpression of apolipoprotein E3 in transgenic rabbits causes combined hyperlipidemia by stimulating hepatic VLDL production and impairing VLDL lipolysis. Arterioscler Thromb Vasc Biol. 1999; 19: 2952–2959.[Abstract/Free Full Text]

16. Mensenkamp AR, Jong MC, van Goor H, van Luyn MJ, Bloks V, Havinga R, Voshol PJ, Hofker MH, van Dijk KW, Havekes LM, Kuipers F. Apolipoprotein E participates in the regulation of very low density lipoprotein-triglyceride secretion by the liver. J Biol Chem. 1999; 274: 35711–35718.[Abstract/Free Full Text]

17. Ji ZS, Dichek HL, Miranda RD, Mahley RW. Heparan sulfate proteoglycans participate in hepatic lipaseand apolipoprotein E-mediated binding and uptake of plasma lipoproteins, including high density lipoproteins. J Biol Chem. 1997; 272: 31285–31292.[Abstract/Free Full Text]

18. Dallinga-Thie GM, van Tol A, Hattori H, Rensen PC, Sijbrands EJ. Plasma phospholipid transfer protein activity is decreased in type 2 diabetes during treatment with atorvastatin: a role for apolipoprotein E? Diabetes. 2006; 55: 1491–1496.[Abstract/Free Full Text]

19. Oka T, Kujiraoka T, Ito M, Egashira T, Takahashi S, Nanjee MN, Miller NE, Metso J, Olkkonen VM, Ehnholm C, Jauhiainen M, Hattori H. Distribution of phospholipid transfer protein in human plasma: presence of two forms of phospholipid transfer protein, one catalytically active and the other inactive. J Lipid Res. 2000; 41: 1651–1657.[Abstract/Free Full Text]

20. Karkkainen M, Oka T, Olkkonen VM, Metso J, Hattori H, Jauhiainen M, Ehnholm C. Isolation and partial characterization of the inactive and active forms of human plasma phospholipid transfer protein (PLTP). J Biol Chem. 2002; 277: 15413–15418.[Abstract/Free Full Text]

21. Janis MT, Metso J, Lankinen H, Strandin T, Olkkonen VM, Rye KA, Jauhiainen M, Ehnholm C. Apolipoprotein E activates the low-activity form of human phospholipid transfer protein. Biochem Biophys Res Commun. 2005; 331: 333–340.[CrossRef][Medline] [Order article via Infotrieve]

22. Cheung MC, Albers JJ. Active plasma phospholipid transfer protein is associated withApo AI- but not Apo E-containing lipoproteins. J Lipid Res. 2006; 47: 1315–1321.[Abstract/Free Full Text]

23. Laffitte BA, Joseph SB, Chen M, Castrillo A, Repa J, Wilpitz D, Mangelsdorf D, Tontonoz P. The phospholipid transfer protein gene is a liver X receptor target expressed by macrophages in atherosclerotic lesions. Mol Cell Biol. 2003; 23: 2182–2191.[Abstract/Free Full Text]

24. Desrumaux CM, Mak PA, Boisvert WA, Masson D, Stupack D, Jauhiainen M, Ehnholm C, Curtiss LK. Phospholipid transfer protein is present in human atherosclerotic lesions and is expressed by macrophages and foam cells. J Lipid Res. 2003; 44: 1453–1461.[Abstract/Free Full Text]

25. O’Brien KD, Vuletic S, McDonald TO, Wolfbauer G, Lewis K, Tu AY, Marcovina S, Wight TN, Chait A, Albers JJ. Cell-associated and extracellular phospholipid transfer protein in human coronary atherosclerosis. Circulation. 2003; 108: 270–274.[Abstract/Free Full Text]

26. Linton MF, Atkinson JB, Fazio S. Prevention of atherosclerosis in apolipoprotein E-deficient mice by bone marrow transplantation. Science. 1995; 267: 1034–1037.[Abstract/Free Full Text]

27. Van Eck M, Herijgers N, Vidgeon-Hart M, Pearce NJ, Hoogerbrugge PM, Groot PH, Van Berkel TJ. Accelerated atherosclerosis in C57Bl/6 mice transplanted with ApoE-deficient bone marrow. Atherosclerosis. 2000; 150: 71–80.[CrossRef][Medline] [Order article via Infotrieve]

28. Hara H, Yokoyama S. Role of apolipoproteins in cholesterol efflux from macrophages to lipid microemulsion: proposal of a putative model for the pre-beta high-density lipoprotein pathway. Biochemistry. 1992; 31: 2040–2046.[CrossRef][Medline] [Order article via Infotrieve]

29. Smith JD, Miyata M, Ginsberg M, Grigaux C, Shmookler E, Plump AS. Cyclic AMP induces apolipoprotein E binding activity and promotes cholesterol efflux from a macrophage cell line to apolipoprotein acceptors. J Biol Chem. 1996; 271: 30647–30655.[Abstract/Free Full Text]

30. Vuletic S, Peskind ER, Marcovina SM, Quinn JF, Cheung MC, Kennedy H, Kaye JA, Jin LW, Albers JJ. Reduced CSF PLTP activity in Alzheimer’s disease and other neurologic diseases; PLTP induces ApoE secretion in primary human astrocytes in vitro. J Neurosci Res. 2005; 80: 406–413.[CrossRef][Medline] [Order article via Infotrieve]

31. Siggins S, Jauhiainen M, Olkkonen VM, Tenhunen J, Ehnholm C. PLTP secreted by HepG2 cells resembles the high-activity PLTP form in human plasma. J Lipid Res. 2003; 44: 1698–1704.[Abstract/Free Full Text]

32. Yang XP, Yan D, Qiao C, Liu RJ, Chen JG, Li J, Schneider M, Lagrost L, Xiao X, Jiang XC. Increased atherosclerotic lesions in apoE mice with plasma phospholipid transfer protein overexpression. Arterioscler Thromb Vasc Biol. 2003; 23: 1601–1607.[Abstract/Free Full Text]

33. Deng J, Rudick V, Rudick M, Dory L. Investigation of plasma membrane-associated apolipoprotein E in primary macrophages. J Lipid Res. 1997; 38: 217–227.[Abstract]

34. Hojjati MR, Li Z, Zhou H, Tang S, Huan C, Ooi E, Lu S, Jiang XC. Effect of myriocin on plasma sphingolipid metabolism and atherosclerosis in apoE-deficient mice. J Biol Chem. 2005; 280: 10284–10289.[Abstract/Free Full Text]

35. Jiang XC, Bruce C. Regulation of murine plasma phospholipid transfer protein activity and mRNA levels by lipopolysaccharide and high cholesterol diet. J Biol Chem. 1995; 270: 17133–17138.[Abstract/Free Full Text]

36. Day JR, Albers JJ, Lofton-Day CE, Gilbert TL, Ching AF, Grant FJ, O’Hara PJ, Marcovina SM, Adolphson JL. Complete cDNA encoding human phospholipid transfer protein from human endothelial cells. J Biol Chem. 1994; 269: 9388–9391.[Abstract/Free Full Text]

37. Jiang XC, Bruce C, Mar J, Lin M, Ji Y, Francone OL, Tall AR. Targeted mutation of plasma phospholipid transfer protein gene markedly reduces high-density lipoprotein levels. J Clin Invest. 1999; 103: 907–914.[Medline] [Order article via Infotrieve]

38. Kockx M, Rye KA, Gaus K, Quinn CM, Wright J, Sloane T, Sviridov D, Fu Y, Sullivan D, Burnett JR, Rust S, Assmann G, Anantharamaiah GM, Palgunachari MN, Katz SL, Phillips MC, Dean RT, Jessup W, Kritharides L. Apolipoprotein A-I-stimulated apolipoprotein E secretion from human macrophages is independent of cholesterol efflux. J Biol Chem. 2004; 279: 25966–25977.[Abstract/Free Full Text]

39. Huuskonen J, Wohlfahrt G, Jauhiainen M, Ehnholm C, Teleman O, Olkkonen VM. Structure and phospholipid transfer activity of human PLTP: analysis by molecular modeling and site-directed mutagenesis. J Lipid Res. 1999; 40: 1123–1130.[Abstract/Free Full Text]

40. Valenta DT, Ogier N, Bradshaw G, Black AS, Bonnet DJ, Lagrost L, Curtiss LK, Desrumaux CM. Atheroprotective potential of macrophage-derived phospholipid transfer protein in low-density lipoprotein receptor-deficient mice is overcome by apolipoprotein AI overexpression. Arterioscler Thromb Vasc Biol. 2006; 26: 1572–1578.[Abstract/Free Full Text]

41. Jiang XC, Tall AR, Qin S, Lin M, Schneider M, Lalanne F, Deckert V, Desrumaux C, Athias A, Witztum JL, Lagrost L. Phospholipid transfer protein deficiency protects circulating lipoproteins from oxidation due to the enhanced accumulation of vitamin E. J Biol Chem. 2002; 277: 31850–31856.[Abstract/Free Full Text]

42. Yan D, Navab M, Bruce C, Fogelman AM, Jiang XC. PLTP deficiency improves the anti-inflammatory properties of HDL and reduces the ability of LDL to induce monocyte chemotactic activity. J Lipid Res. 2004; 45: 1852–1858.[Abstract/Free Full Text]

43. Schlitt A, Liu J, Yan D, Mondragon-Escorpizo M, Norin AJ, Jiang XC. Anti-inflammatory effects of phospholipid transfer protein (PLTP) deficiency in mice. Biochim Biophys Acta. 2005; 1733: 187–191.[Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
J. Lipid Res.Home page
S. Nandi, L. Ma, M. Denis, J. Karwatsky, Z. Li, X.-C. Jiang, and X. Zha
ABCA1-mediated cholesterol efflux generates microparticles in addition to HDL through processes governed by membrane rigidity
J. Lipid Res., March 1, 2009; 50(3): 456 - 466.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
H. Samyn, M. Moerland, T. van Gent, R. van Haperen, J. Metso, F. Grosveld, M. Jauhiainen, A. van Tol, and R. de Crom
Plasma phospholipid transfer activity is essential for increased atherogenesis in PLTP transgenic mice: a mutation-inactivation study
J. Lipid Res., December 1, 2008; 49(12): 2504 - 2512.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. F. Oram, G. Wolfbauer, C. Tang, W. S. Davidson, and J. J. Albers
An Amphipathic Helical Region of the N-terminal Barrel of Phospholipid Transfer Protein Is Critical for ABCA1-dependent Cholesterol Efflux
J. Biol. Chem., April 25, 2008; 283(17): 11541 - 11549.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
L. Shelly, L. Royer, T. Sand, H. Jensen, and Y. Luo
Phospholipid transfer protein deficiency ameliorates diet-induced hypercholesterolemia and inflammation in mice
J. Lipid Res., April 1, 2008; 49(4): 773 - 781.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
N. Ogier, A. Klein, V. Deckert, A. Athias, G. Bessede, N. Le Guern, L. Lagrost, and C. Desrumaux
Cholesterol Accumulation Is Increased in Macrophages of Phospholipid Transfer Protein-Deficient Mice: Normalization by Dietary Alpha-Tocopherol Supplementation
Arterioscler. Thromb. Vasc. Biol., November 1, 2007; 27(11): 2407 - 2412.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. Yan, M. Jauhiainen, R. B. Hildebrand, K. Willems van Dijk, T. J.C. Van Berkel, C. Ehnholm, M. Van Eck, and V. M. Olkkonen
Expression of Human OSBP-Related Protein 1L in Macrophages Enhances Atherosclerotic Lesion Development in LDL Receptor-Deficient Mice
Arterioscler. Thromb. Vasc. Biol., July 1, 2007; 27(7): 1618 - 1624.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. G. Yancey, H. Yu, M. F. Linton, and S. Fazio
A Pathway-Dependent on ApoE, ApoAI, and ABCA1 Determines Formation of Buoyant High-Density Lipoprotein by Macrophage Foam Cells
Arterioscler. Thromb. Vasc. Biol., May 1, 2007; 27(5): 1123 - 1131.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Wehinger, I. Tancevski, W. Schgoer, P. Eller, K. Hochegger, M. Morak, A. Hermetter, A. Ritsch, J. R. Patsch, and B. Foeger
Phospholipid Transfer Protein Augments Apoptosis in THP-1-Derived Macrophages Induced by Lipolyzed Hypertriglyceridemic Plasma
Arterioscler. Thromb. Vasc. Biol., April 1, 2007; 27(4): 908 - 915.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
27/1/190    most recent
01.ATV.0000249721.96666.e5v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, R.
Right arrow Articles by Jiang, X.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, R.
Right arrow Articles by Jiang, X.-C.