Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2006;26:2063-2069
Published online before print July 6, 2006, doi: 10.1161/01.ATV.0000235694.69719.e2
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
26/9/2063    most recent
01.ATV.0000235694.69719.e2v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schepers, A.
Right arrow Articles by Quax, P.H.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schepers, A.
Right arrow Articles by Quax, P.H.A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
Medline Plus Health Information
*Cholesterol
*Genes and Gene Therapy
Related Collections
Right arrow Restenosis
Right arrow Animal models of human disease
Right arrow Growth factors/cytokines
Right arrow Peripheral vascular disease
Right arrow Coagulation inhibitors
Right arrow Gene therapy
Right arrow Mechanism of atherosclerosis/growth factors
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2006;26:2063.)
© 2006 American Heart Association, Inc.


Vascular Biology

Anti–MCP-1 Gene Therapy Inhibits Vascular Smooth Muscle Cells Proliferation and Attenuates Vein Graft Thickening Both In Vitro and In Vivo

A. Schepers; D. Eefting; P.I. Bonta; J.M. Grimbergen; M.R. de Vries; V. van Weel; C.J. de Vries; K. Egashira; J.H. van Bockel; P.H.A. Quax

From the Gaubius Laboratory TNO-Quality of Life (A.S., D.E., J.M.G., M.R.d.V., V.v.W., P.H.A.Q.), Leiden; the Department of Vascular Surgery (A.S., D.E., V.v.W., J.H.v.B., P.H.A.Q.), Leiden University Medical Centre, Leiden; and the Department of Medical Biochemistry (P.I.B., C.J.d.V.), Academic Medical Center, Amsterdam, The Netherlands; and the Graduate School of Medical Sciences (K.E.), Kyushu University, Fukuoka, Japan.

Correspondence to P.H.A. Quax, PhD, Gaubius Laboratory, TNO-Quality of Life, Department of Biomedical Research, Zernikedreef 9, 2301 CE, Leiden, The Netherlands. E-mail pha.quax{at}pg.tno.nl


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Objective— Because late vein graft failure is caused by intimal hyperplasia (IH) and accelerated atherosclerosis, and these processes are thought to be inflammation driven, influx of monocytes is one of the first phenomena seen in IH, we would like to provide direct evidence for a role of the MCP-1 pathway in the development of vein graft disease.

Methods and Results— MCP-1 expression is demonstrated in various stages of vein graft disease in a murine model in which venous interpositions are placed in the carotid arteries of hypercholesterolemic ApoE3Leiden mice and in cultured human saphenous vein (HSV) segments in which IH occurs. The functional involvement of MCP-1 in vein graft remodeling is demonstrated by blocking the MCP-1 receptor CCR-2 using 7ND-MCP-1. 7ND-MCP1 gene transfer resulted in 51% reduction in IH in the mouse model, when compared with controls. In HSV cultures neointima formation was inhibited by 53%. In addition, we demonstrate a direct inhibitory effect of 7ND-MCP-1 on the proliferation of smooth muscle cell (SMC) in HSV cultures and in SMC cell cultures.

Conclusion— These data, for the first time, prove that MCP-1 has a pivotal role in vein graft thickening due to intimal hyperplasia and accelerated atherosclerosis.

Involvement of MCP-1 in vein graft intimal hyperplasia (IH) was studied. MCP-1 was detected by immunohistochemistry in murine vein grafts and cultured human saphenous veins. Functional involvement of MCP-1 was assessed by exposure to a MCP-1-antagonist. This reduced IH in both models and inhibited smooth muscle cell proliferation in vitro.


Key Words: vein graft disease • intimal hyperplasia • MCP-1 • smooth muscle cells • inflammation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Venous bypass grafting is a common treatment for occlusive atherosclerotic vascular disease and establishes revascularization of ischemic tissue. Unfortunately, although primarily successful, it is accompanied by a high incidence of late graft failure (up to 40% after 10 years1), leading to a high morbidity and mortality attributable to re-interventions.

Graft failure is mainly attributable to vein graft thickening caused by intimal hyperplasia (IH) and accelerated atherosclerosis. It occurs as a response to altered shear and circumferential stress and loss of endothelial integrity caused by surgery.2 The process starts with monocyte adhesion and extravasation into the vessel wall, followed by smooth muscle cell (SMC) migration and proliferation, and macrophage accumulation in the intima.3 Subsequently, lipids accumulate in macrophages resulting in foam cell formation. Because of the high resemblance with atherosclerotic plaques, this is called accelerated atherosclerosis of the vein graft.1,4,5

Several animal models have been developed to study vein graft thickening, including a venous interposition model in the mouse carotid artery.6 Here, this venous interposition model was used in ApoE3Leiden mice. ApoE3Leiden mice contain the mutant human ApoE3Leiden gene, which leads to a defective clearance of ApoE by the LDL receptor, and therefore these mice develop a diet-dependent hyperlipidemia and diet-induced atherosclerosis.7 When a venous interposition is placed in the carotid artery of these mice, venous thickening with signs of accelerated atherosclerosis develops within 4 weeks,6,8 highly resembling the morphology of the diseased human vein grafts.

Although the exact mechanism of vein graft thickening is unknown, accumulating evidence suggests that it is an inflammation-driven process.9,10 Monocyte chemoattractant protein-1 (MCP-1) and its receptor CCR2 are key mediators in vascular inflammation, acting as one of the most potent chemotactic agents to monocytes.11,12 MCP-1 has been shown to play a pivotal role in spontaneous atherosclerosis and post-angioplasty restenosis. Recently it has been described that blocking of the MCP-1/CCR2 pathway results in reduced atherosclerosis and restenosis by inhibition of monocyte adhesion to the vascular wall and to reduced macrophage content in the atherosclerotic lesion.13–16 Because of the similarities between restenosis and vein graft disease, we hypothesize that MCP-1 may play a pivotal role in development of vein graft disease.

To prove this hypothesis we use 7ND-MCP-1, a competitive receptor antagonist of the CCR2 receptor. It is created by the deletion of amino acids 2 to 8 at the N terminus of human MCP-117 and has the potential to block the MCP-1/CCR-2 pathway in vivo. Recently, 7ND-MCP-1 has been shown to attenuate various disorders both vascular13,16,18 and nonvascular of nature19,20 by blocking MCP-1–mediated monocyte chemotaxis.

In the present study, the role of MCP-1 in vein graft remodeling was assessed. Therefore, the expression of MCP-1 in time was studied in both murine vein grafts and cultured human saphenous veins and the effect of blocking the MCP-1/CCR2 pathway in both models was investigated using 7ND-MCP-1. Furthermore, a direct inhibitory effect of 7ND-MCP-1 on SMC proliferation was studied. These data, for the first time, prove that the proinflammatory cytokine MCP-1 has a pivotal role in vein graft thickening.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Mice
Animal experiments were approved by the TNO-animal welfare committee. For all experiments male C57B/6-ApoE3Leiden mice were used. Animals were fed a cholesterol-enriched high-fat diet, containing 1% cholesterol and 0.05% cholate (AB Systems), starting 4 weeks before surgery. All mice received water and food ad libitum.

Cholesterol levels in serum were determined 1 week before surgery and at sacrifice. Mice were anesthetized by using Midazolam (5 mg/kg; Roche), Medetomide (0.5 mg/kg; Orion), and Fentanyl (0.05 mg/kg; Janssen).

Vein Graft Surgery
A venous interposition was placed in the carotid artery as described previously.6 Grafts, being caval veins of donor mice, were harvested and preserved in 0.9%NaCl containing 100 IU of heparin. In the recipient, the right carotid artery was dissected from its surroundings and cut in the middle. A polyethylene cuff was placed at both ends of the artery. At both ends, the artery was everted around the cuff and ligated. Then, the graft was sleeved over the cuffs and ligated. Pulsations and turbulent blood flow within the graft confirmed successful engraftment.

At time of sacrifice, vein grafts were harvested after 5 minutes in vivo perfusion-fixation with formaldehyde (4%), fixated overnight, and embedded in paraffin.

7ND-MCP-1 Expression Vector
Human MCP-1 was modified into 7ND-MCP-1 by deletion of amino acids 2 to 8 and the 7ND-MCP-1 gene was cloned into the BamH1 (5') and NotI (3') sites of a plasmid pcDNA3.1 expression vector (Invitrogen), as described before.16 A pcDNA3.1 plasmid without an insert (pcDNA3.1-empty) was used as the control vector.

Gene-Transfer by Electroporation
Gene-transfer of 7ND-MCP-1 was performed one day before vein graft surgery by injecting 75 µg of plasmid, either pcDNA3–7ND-MCP-1or pcDNA3.1-empty, into the calf muscles of both legs, followed by electroporation (8 pulses of 10 ms, field strength of 200 V/cm [Sq Wave Electroporator ECM 830, BTX] using Caliper Electrodes). Calf muscles were primed with an intramuscular injection containing 30 µL of hyaluronidase (0.45U/µL, Sigma) one hour before electroporation.21 Electroporation was called successful when the 7ND protein was detectable in serum using a human MCP-1 ELISA kit (Biosource). Protein expression was determined 1 day, 1 week, 2 weeks, and 4 weeks after surgery.

Analysis of Intimal Hyperplasia Formation
Serial perpendicular cross-sections of embedded vessels were made through the entire specimen. All samples were routinely stained with hematoxilline-phloxine-saffron (HPS).

Quantification of vein graft thickening was performed using image analysis software (Qwin, Leica). The thickened vessel wall surface was defined as the total vessel surface subtracted by the luminal surface. For each mouse 6 equally spaced cross-sections were used to determine vein graft thickening.

The composition of both murine vein grafts and human saphenous veins was visualized by immunohistochemistry. In the murine grafts, the amount of SMC (anti-SM {alpha}-actin, 1:1600, Roche) and macrophages (AIA31240, 1:3000, Accurate Chemical) was determined as the SM {alpha}-actin-positive and AIA-positive area in cross-sections, as a percentage of the total IH surface and quantified using image analysis software (Qwin, Leica). MCP-1 expression was determined using an anti-mouse JE/MCP-1 antibody (1:20, BD Biosciences).

Production of 7ND-MCP-1 Containing Conditioned Medium
Human HER 911 were transfected with pcDNA3.1 to 7ND-MCP-1 or pcDNA3.1-empty by Lipofectamin as described by the manufacturer. Conditioned medium was collected every day and pooled. The 7ND-MCP-1 concentration produced was measured using a human MCP-1 ELISA kit (Biosource). Conditioned medium was diluted with culture medium (DMEM) until a final concentration of 7ND-MCP-1 was reached of 10 ng/mL (&1:100). Medium from the pcDNA3.1-empty transfected HER 911’s was collected and diluted in DMEM culture medium in a 1:100 ratio.

Production of Purified 7ND-MCP-1 Protein
Recombinant 7ND-MCP-1 was purified from serum-free conditioned medium from stably transfected CHO-cells. Medium diluted 1:1 with 0.02 mol/L Phosphate-buffer (pH 7.4) was circulated over a SP Sephadex column (Pharmacia) overnight, followed by elution using a NaCl gradient in 0.02 mol/L Phosphate-buffer (pH 7.4). Recombinant 7ND-MCP-1 containing fractions, as determined by ELISA, were pooled to a final concentration of 28 µg/mL.

Human Saphenous Vein Organ Culture
Segments of saphenous veins were obtained from patients undergoing saphenous vein stripping (kindly provided by Dr H. Stigter, Deaconess Hospital, Leiden, The Netherlands). Healthy looking segments of the stripped veins were put into culture as previously described.22,23 Segments (n=12 per group) were either exposed to conditioned medium containing 10 ng/mL 7ND-MCP-1 or control conditioned medium. After 4 weeks, segments were harvested, fixed overnight in formaldehyde (4%), and embedded in paraffin. All segments were routinely stained by HPS and neointimal surface was assessed on multiple sections (n=9) per vein segment and quantified using Qwin Image analysis software (Leica).

For detection of proliferating cells by BrdU incorporation, the medium was supplemented with bromo-deoxiuridine (BrdU; 40mmol/L, Sigma) 7 days before harvesting of the vessels. Number of proliferating cells was quantified as the absolute number of BrdU-positive cells per microscopic view (magnification 100x). MCP-1 was visualized using a monoclonal anti-human MCP-1 (1:65; R&D Systems).

SMC Culture and 3H-Thymidine Incorporation Proliferation Assay
Human SMCs, explanted from saphenous veins, were subsequently cultured, characterized, and proliferation was measured as described previously.24 Briefly, SMCs were electroporated with plasmids encoding for 7ND-MCP-1, MCP-1 and/or an empty plasmid by Nucleofector Technology (Amaxa Biosystems) according to manufacturer’s protocol. After electroporation, cells were seeded at a density of at least 2x104 cells per 24 well. Next, cells were made quiescent for 48 hours. Methyl-3H-thymidine incorporation (Amersham, 0.25µCu per well) for 16 hours was measured by liquid-scintillation counting. In case purified, recombinant 7ND-MCP-1 and/or recombinant hMCP-1 (R&D) were used, after quiescence, 7ND-MCP-1 was given 30 minutes before stimulation with MCP-1. Sixteen hours after stimulation methyl-3H-thymidine was added and incorporation was measured. All experiments were done in triplicate and repeated at least twice.

RNA Isolation and Polymerase Chain Reaction Procedure
Confluent monolayers of human SMCs were grown in DMEM and synchronized for 24 hours. To stimulate SMCs, DMEM was supplemented with 0.1%FCS, 10% FCS, and/or 10% FCS plus tumor necrosis factor (TNF)-{alpha} (5 ng/mL). After 40 hours cells were lysed with Tryzol (Invitrogen), and total RNA was extracted using the manufacturer’s protocol. Synthesis of cDNA of all samples was performed using Ready-To-Go Beads (Amersham Biosciences). RT-PCR was performed, with gene specific primers for CCR2 (sense 5'CCAACTCCTGCCTCCGCTCTA, antisense 5'CCGCCAAAATAACCGATGTGATAC) on the cDNA samples of the 3 distinctly stimulated SMCs. Amplification conditions were: 5 minutes at 94°C, 35 cycles of 1 minute at 94°C, 1 minute at 55°C, and 2 minutes at 72°C. PCR products were run on a 1.2% agarose gel and visualized by ethidium bromide.

Statistical Analysis
All data are presented as mean±SEM. Statistical significance was calculated in SPSS 11.5 for Windows. In both the murine experiments and the SMC proliferation experiments, overall comparisons between groups were performed with the one way ANOVA. If a significant difference was found, groups were compared with their controls using the Student t test. Regarding the HSV experiments, 7ND-treated and untreated segments of an individual patient were compared using the paired t test. Probability values <0.05 were regarded significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Expression of MCP-1 in Murine Vein Grafts and Human Saphenous Vein Organ Cultures
To demonstrate the expression of MCP-1 in murine vein grafts in time, bypass surgery was performed in ApoE3Leiden mice (mean cholesterol levels: 13.1±1.3mmol/L), and animals were euthanized at various time points after surgery (6 and 24 hours, 7, 14, and 28 days; n=3 per time point).

In the first days after engraftment, MCP-1 was mainly expressed by the remaining endothelial cells. Furthermore, a massive expression of MCP-1 could be detected in the adhering leukocytes. After 7 days, MCP-1–positive cells were detectable in the developing IH, colocalizing mainly with AIA-positive cells, suggesting that this MCP-1 is predominantly expressed by infiltrating macrophages. After 2 weeks the expression in the IH decreased, and it was scarcely detected after 4 weeks (Figure 1A).


Figure 1
View larger version (66K):
[in this window]
[in a new window]
 
Figure 1. A, Representative cross-sections of murine vein grafts harvested after several time points. MCP-1 expression in vein grafts identified by immunohistochemistry was seen mainly in endothelial cells, adhering monocytes, and in the infiltrating cells of the developing IH. Inserts indicate adhering monocytes expressing MCP-1 (6 hours and 24 hours) and MCP-1 expression in the developing IH (14 days). B, The immunohistochemical detection of MCP-1 in cultured human saphenous veins. MCP-1 is abundantly present in the media at early time points and predominantly in IH at later time points after 14 and 28 days. Inserts indicate MCP-1 expressing endothelium and SMCs (directly after excision and 24 hours) and MCP-1 expression in IH (28 days). Magnification of all images 150 to 600x.

In addition, MCP-1 expression was analyzed by immunohistochemistry in human saphenous vein organ cultures. From 4 HSV cultures, vessel wall specimens were collected at several time points (directly after excision, after 1, 7, and 28 days in organ culture). Hardly any MCP-1 could be detected in HSV directly after excision. In the cultured HSV, increased MCP-1 expression was detectable. In the early time points, it was present mainly in the circular SMC layer of the media. Besides expression in the media, profound MCP-1 expression was detectable in the developing IH from day 14 on. (Figure 1B).

Inhibition of Endogenous MCP-1 Receptor by 7ND-MCP-1 Inhibits Vein Graft Thickening
To study the effect of 7ND-MCP-1 on vein graft thickening, vein graft surgery was performed in ApoE3Leiden mice (n=6 per group). Twelve mice were electroporated 1 day before surgery with either the 7ND-MCP-1 plasmid or the empty plasmid, whereas 6 other were not electroporated. Electroporation of the calf muscle (n=6) with 75 µg of pcDNA3.1 to 7ND-MCP-1 led to a prolonged expression of 7ND-MCP-1, which was detected in serum. Peak expression (250±79 pg/mL) was reached after 3 to 7 days and remained high even after 4 weeks (68±21 pg/mL). No 7ND-MCP-1 could be detected in the control (pcDNA3.1-empty) group. Electroporation did not have an effect on the cholesterol levels or body weights of the mice (data not shown).

A significant 51% reduction of vein graft thickening in the 7ND-MCP-1– treated group as compared with the control group and the empty plasmid group (control: 0.63±0.11 mm2, empty: 0.51±0.05 mm2, 7ND-MCP-1: 0.31±0.07 mm2; P=0.041; Figure 2A) was observed. Furthermore, the 7ND treated animals showed an increased luminal area when compared with both control groups (control: 0.36±0.06 mm2, empty 0.37±0.03 mm2, 7ND-MCP-1 0.47±0.06 mm2). However, this difference was not significant (P=0.46).


Figure 2
View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. Effect of 7ND-MCP-1 gene transfer on development of IH in murine vein grafts. A, Significantly reduced IH surface is seen in the 7ND-MCP-1-treated group (n=6 per group, P<0.05). B, Immunohistochemical staining for macrophages and smooth muscle cells. No differences in cellular composition of the lesions were observed.

To study the possible effect of 7ND-MCP-1 on the cellular composition of IH of the vein grafts, immunohistochemical analysis for macrophages and SMCs was performed. Although vein graft thickening was reduced in the 7ND-MCP-1–treated group, no significant differences were seen in macrophage content in the 7ND-MCP-1–treated vessels (expressed as positive stained area as a percentage of the total area) when compared with the control group (control 22±4%, 7ND-MCP-1 16±4%, P=0.43). Also, no difference was seen in the SM {alpha}-actin–positive area of the thickened vessel wall (control 39±7%, 7ND-MCP-1 27±9%, P=0.16).

7ND-MCP-1 Inhibits Neointima Formation in HSV Organ Cultures
The observation that both SMC and macrophage content of the murine lesions was reduced prompted us to study the effects of 7ND-MCP-1 on the formation of SMC-rich lesions in HSV organ cultures. Segments of HSV (n=12 per group, from 4 separate patients) were cultured for 4 weeks. Segments exposed to conditioned medium with or without 7ND-MCP-1 (10 ng/mL) were compared.

In all samples a neointima formed within 4 weeks of culturing. However, quantification revealed reduced neointima formation in HSV exposed to conditioned medium containing 7ND-MCP-1, as compared with the control counterparts (7ND-MCP-1: 0.42±0.11 mm2 versus control: 0.89±0.16 mm2, P=0.012, Figure 3).


Figure 3
View larger version (34K):
[in this window]
[in a new window]
 
Figure 3. Effect of 7ND-MCP-1 on IH in HSV 28 days in culture. A, Reduction in IH (n=12 per group) when exposed to conditioned medium containing 7ND-MCP-1 (P<0.05). B, Representative cross section of HSV, strong reduction in both IH surface and BrdU-positive cells can be detected.

Influx of macrophages in the human ex vivo model does not occur. Therefore 7ND-MCP-1 most likely may have a direct effect on SMCs and not via the effect on monocyte chemotaxis. Therefore the effect of 7ND-MCP-1 on proliferation of SMCs in the HSV organ cultures was assessed by BrdU staining. In the control vessels 26±2 proliferating cells per microscopic field were detected in the neointima. A significantly lowered number of neointimal proliferating cells was seen in the 7ND-MCP-1 treated vessels (16±2 cells per microscopic field, magnification 100x, P=0.005).

7ND-MCP-1 Reduces SMC Proliferation
Because 7ND-MCP-1 treatment also seemed to have an effect on SMC proliferation in the HSV tissue culture, the direct inhibitory effect of 7ND-MCP-1 on SMC proliferation was studied.

First, the presence of the receptor for MCP-1, CCR2, on the human saphenous vein SMCs was studied by means of mRNA analysis. CCR2 mRNA expression was detectable by PCR in 3 distinctly stimulated cell cultures (Figure 4).


Figure 4
View larger version (43K):
[in this window]
[in a new window]
 
Figure 4. RT-PCR of total mRNA of cultured human SMCs for expression of CCR2 mRNA under various culture conditions. Expression is seen under all conditions; however, no difference in expression was seen between the various conditions. A, SMC/CCR2; B, SMC/ß-actin.

Then, the effect of MCP-1 and 7ND-MCP-1 on SMC proliferation was studied in a human venous SMC cell culture. SMCs were either transfected with an empty plasmid and/or plasmids encoding for MCP-1 or 7ND-MCP-1. Overexpression of MCP-1 resulted in increased DNA synthesis when compared with mock-transfected SMCs, as determined by 3H-Thymidine incorporation (Empty 37x103±0.84x103 counts per minute (cpm), MCP-1 45x103±0.25x103 cpm, P=0.035). In addition, when SMC overexpressed 7ND-MCP-1, as expected, DNA synthesis was attenuated (22x103±0.14x103cpm, P<0.001), in comparison to mock-transfected cells. When a cotransfection with both MCP-1 and 7ND-MCP-1 plasmids was performed, a similar reduction was observed (20x103±0.71x103cpm, P<0.001; Figure 5A).


Figure 5
View larger version (15K):
[in this window]
[in a new window]
 
Figure 5. Effect of MCP-1 or 7ND-MCP-1 on SMC proliferation (n=3 per condition). A, SMC proliferation is increased on transfection with MCP-1-encoding plasmids. Cotransfection with 7ND-MCP-1–encoding plasmids diminishes this MCP-1–induced proliferation. Transfection with 7ND-MCP-1 alone resulted decreased SMC proliferation (for all differences between the groups; P<0.05). B, Dose-dependent inhibition of SMC proliferation when cells are exposed to increasing concentrations of 7ND-MCP-1 purified protein (n=3 per condition, SMCs of all conditions stimulated with a fixed concentration of 10 ng/mL recombinant MCP-1).

Next, SMCs were exposed to either MCP-1 recombinant protein and/or 7ND-MCP-1 protein purified from CHO cells expressing the recombinant 7ND-MCP-1 protein. Exposure to increasing doses of MCP-1 recombinant protein resulted in a dose-dependent increase of DNA synthesis (data not shown).

When SMCs were exposed to a fixed concentration of MCP-1 (10 ng/mL) in combination with increasing concentrations of 7ND-MCP-1, a dose-dependent decrease of DNA synthesis was observed in the 3H-Thymidine assay. The relative reduction in SMC proliferation (expressed as percentage of control in which no 7ND-MCP-1 was added [0.3 ng/mL 7ND-MCP-1 added: 76±9%, P=0.07; 1 ng/mL 7ND-MCP-1: 59±3%, P=0.007; 3.3 ng/mL 7ND-MCP-1: 44±7%, P=0.006; 10 ng/mL 7ND-MCP-1: 59±1, P=0.006]) is illustrated in Figure 5B.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
In the present study, the expression and causal involvement of MCP-1 in the development of IH in a mouse in vivo or a human ex vivo model of vein graft disease is demonstrated. MCP-1 expression was shown to be present in the murine vein graft and was also detectable in a HSV organ culture. Blocking the CCR2/MCP-1 pathway, using the receptor antagonist 7ND-MCP-1, resulted in a reduced vein graft thickening in both the murine vein graft and in HSV segments. Furthermore, we demonstrate that reduced vein graft thickening, besides the effect on monocyte chemotaxis, is caused by a direct antiproliferative effect of 7ND-MCP-1 on vascular SMCs.

Vein graft thickening attributable to development of IH and accelerated atherosclerosis is the major limitation in the long-term survival of patent vein grafts. The mechanism of vein graft thickening development is largely unknown, but it is assumed that it is caused by an inflammatory response to damage of the graft.9,10

MCP-1 is a well-known proinflammatory cytokine and one of the most potent chemoattractant agents for monocytes. Here, we show that MCP-1 is expressed in vein grafts in an in vivo murine model, early after engraftment and expressed mainly by the endothelium and adhering and infiltrating inflammatory cells. Furthermore, in HSV organ cultures, MCP-1 is predominantly expressed by SMCs. These data are in line with a report of Stark et al, who showed an enhanced expression of MCP-1 in the healing vein graft which was accompanied by the influx of monocytes.25 However, this study was performed in normocholesterolemic rats without foam cell formation in the vein grafts. In the current study, we applied ApoE3Leiden mice on a high-cholesterol diet. These mice have a human-like lipid profile, and foam cell accumulation in the vein grafts does take place. Therefore vein graft morphology in these mice highly resembles what is seen in human vein grafts.

In the processes of spontaneous atherosclerosis and post-angioplasty restenosis, two other disorders characterized by vascular inflammation, the role of MCP-1 is well known. Several clinical studies in humans describe the relation between circulating MCP-1 levels and the risk to develop in-stent restenosis,26,27 and intervention in the MCP-1/CCR2 route results in a reduction of atherosclerosis and post-angioplasty restenosis in several animal models.13,14,28–30 Furthermore, in a mouse model of transplantation-induced graft vasculopathy after heterologous heart transplantation, 7ND MCP-1 overexpression significantly reduced accelerated atherosclerosis in the graft tissue.31 However, the functional role of MCP-1 in the process of vein graft thickening, by intervening in the MCP-1/CCR2 pathway, was never studied. The data provided in this study demonstrate, to our knowledge for the first time, evidence for a pivotal, prorestenotic role of MCP-1 in vein graft disease. Inhibition of the MCP-1/CCR2 pathway by 7ND-MCP-1 resulted in a significant reduction of vein graft thickening in murine vein grafts.

Because no difference was seen in the cellular composition of treated and untreated grafts, we hypothesized that besides chemotaxis of monocytes also proliferation of SMCs is diminished by 7ND-MCP-1 exposure. This hypothesis is in line with several reports demonstrating that MCP-1 is a potent mitogenic agent for SMCs32,33 in vitro. Therefore, the effect of 7ND-MCP-1 was studied in human saphenous vein organ cultures. IH in these veins consist mainly of SMCs and endothelial cells and lacks macrophages.34 7ND-MCP-1 reduced IH in HSV organ cultures and BrdU staining revealed a significant reduction in proliferating SMCs in the 7ND-MCP-1–treated vein grafts.

To further asses the direct inhibitory effect of 7ND-MCP-1 on SMC proliferation, cultured SMCs were exposed to MCP-1 and 7ND-MCP-1. MCP-1 exposure resulted in an increased proliferation of SMCs. Oppositely, SMC proliferation was inhibited by exposure to 7ND-MCP-1. These data prove that, indeed, 7ND-MCP-1 directly inhibits SMC proliferation, in addition to its known effects on other (inflammatory) cell types present in the vascular lesion.

In conclusion, the present study establishes the important role of the MCP-1/CCR2 pathway in the development of vein graft thickening. Blocking this route (eg, by 7ND-MCP-1) may be an interesting potential target for therapy to overcome the problems of vein graft failure in patients.


*    Acknowledgments
 
Kees van Leuven (TNO-QoL, Leiden, The Netherlands) is acknowledged for his technical assistance.

Source of Funding

Financial support for this study was provided by The Netherlands Heart Foundation (Molecular Cardiology Program, Grant M93.001 and Grant M93.007).

Disclosures

None.


*    Footnotes
 
*A.S. and D.E. contributed equally to this study

Original received July 4, 2005; final version accepted June 2, 2006.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 
1. Motwani JG, Topol EJ. Aortocoronary saphenous vein graft disease: pathogenesis, predisposition, and prevention. Circulation. 1998; 97: 916–931.[Abstract/Free Full Text]

2. Meng X, Mavromatis K, Galis ZS. Mechanical stretching of human saphenous vein grafts induces expression and activation of matrix-degrading enzymes associated with vascular tissue injury and repair. Exp Mol Pathol. 1999; 66: 227–237.[CrossRef][Medline] [Order article via Infotrieve]

3. Hilker M, Tellmann G, Buerke M, Gloger K, Moersig W, Oelert H, Hake U, Lehr HA. Proliferative activity in stenotic human aortocoronary bypass grafts. Cardiovasc Pathol. 2002; 11: 284–290.[CrossRef][Medline] [Order article via Infotrieve]

4. Bourassa MG, Campeau L, Lesperance J, Grondin CM. Changes in grafts and coronary arteries after saphenous vein aortocoronary bypass surgery: results at repeat angiography. Circulation. 1982; 65: 90–97.[Abstract]

5. Campeau L, Enjalbert M, Lesperance J, Bourassa MG, Kwiterovich P Jr, Wacholder S, Sniderman A. The relation of risk factors to the development of atherosclerosis in saphenous-vein bypass grafts and the progression of disease in the native circulation. A study 10 years after aortocoronary bypass surgery. N Engl J Med. 1984; 311: 1329–1332.[Abstract]

6. Zou Y, Dietrich H, Hu Y, Metzler B, Wick G, Xu Q. Mouse model of venous bypass graft arteriosclerosis. Am J Pathol. 1998; 153: 1301–1310.[Abstract/Free Full Text]

7. van den Maagdenberg AM, Hofker MH, Krimpenfort PJ, de B, I, van Vlijmen B, van der BH, Havekes LM, Frants RR. Transgenic mice carrying the apolipoprotein E3-Leiden gene exhibit hyperlipoproteinemia. J Biol Chem. 1993; 268: 10540–10545.[Abstract/Free Full Text]

8. Lardenoye JH, de Vries MR, Lowik CW, Xu Q, Dhore CR, Cleutjens JP, van Hinsbergh VW, van Bockel JH, Quax PH. Accelerated atherosclerosis and calcification in vein grafts: a study in APOE*3 Leiden transgenic mice. Circ Res. 2002; 91: 577–584.[Abstract/Free Full Text]

9. Christiansen JF, Hartwig D, Bechtel JF, Kluter H, Sievers H, Schonbeck U, Bartels C. Diseased vein grafts express elevated inflammatory cytokine levels compared with atherosclerotic coronary arteries. Ann Thorac Surg. 2004; 77: 1575–1579.[Abstract/Free Full Text]

10. Hoch JR, Stark VK, Hullett DA, Turnipseed WD. Vein graft intimal hyperplasia: leukocytes and cytokine gene expression. Surgery. 1994; 116: 463–470.[Medline] [Order article via Infotrieve]

11. Leonard EJ, Skeel A, Yoshimura T. Biological aspects of monocyte chemoattractant protein-1 (MCP-1). Adv Exp Med Biol. 1991; 305: 57–64.[Medline] [Order article via Infotrieve]

12. Yoshimura T, Leonard EJ. Human monocyte chemoattractant protein-1: structure and function. Cytokines. 1992; 4: 131–152.[Medline] [Order article via Infotrieve]

13. Egashira K, Zhao Q, Kataoka C, Ohtani K, Usui M, Charo IF, Nishida K, Inoue S, Katoh M, Ichiki T, Takeshita A. Importance of monocyte chemoattractant protein-1 pathway in neointimal hyperplasia after periarterial injury in mice and monkeys. Circ Res. 2002; 90: 1167–1172.[Abstract/Free Full Text]

14. Inoue S, Egashira K, Ni W, Kitamoto S, Usui M, Otani K, Ishibashi M, Hiasa K, Nishida K, Takeshita A. Anti-monocyte chemoattractant protein-1 gene therapy limits progression and destabilization of established atherosclerosis in apolipoprotein E-knockout mice. Circulation. 2002; 106: 2700–2706.[Abstract/Free Full Text]

15. Mori E, Komori K, Yamaoka T, Tanii M, Kataoka C, Takeshita A, Usui M, Egashira K, Sugimachi K. Essential role of monocyte chemoattractant protein-1 in development of restenotic changes (neointimal hyperplasia and constrictive remodeling) after balloon angioplasty in hypercholesterolemic rabbits. Circulation. 2002; 105: 2905–2910.[Abstract/Free Full Text]

16. Ni W, Egashira K, Kitamoto S, Kataoka C, Koyanagi M, Inoue S, Imaizumi K, Akiyama C, Nishida KK, Takeshita A. New anti-monocyte chemoattractant protein-1 gene therapy attenuates atherosclerosis in apolipoprotein E-knockout mice. Circulation. 2001; 103: 2096–2101.[Abstract/Free Full Text]

17. Zhang YJ, Rutledge BJ, Rollins BJ. Structure/activity analysis of human monocyte chemoattractant protein-1 (MCP-1) by mutagenesis. Identification of a mutated protein that inhibits MCP-1-mediated monocyte chemotaxis. J Biol Chem. 1994; 269: 15918–15924.[Abstract/Free Full Text]

18. Niiyama H, Kai H, Yamamoto T, Shimada T, Sasaki K, Murohara T, Egashira K, Imaizumi T. Roles of endogenous monocyte chemoattractant protein-1 in ischemia-induced neovascularization. J Am Coll Cardiol. 2004; 44: 661–666.[Abstract/Free Full Text]

19. Kumai Y, Ooboshi H, Takada J, Kamouchi M, Kitazono T, Egashira K, Ibayashi S, Iida M. Anti-monocyte chemoattractant protein-1 gene therapy protects against focal brain ischemia in hypertensive rats. J Cereb Blood Flow Metab. 2004; 24: 1359–1368.[CrossRef][Medline] [Order article via Infotrieve]

20. Tsuruta S, Nakamuta M, Enjoji M, Kotoh K, Hiasa K, Egashira K, Nawata H. Anti-monocyte chemoattractant protein-1 gene therapy prevents dimethylnitrosamine-induced hepatic fibrosis in rats. Int J Mol Med. 2004; 14: 837–842.[Medline] [Order article via Infotrieve]

21. McMahon JM, Signori E, Wells KE, Fazio VM, Wells DJ. Optimisation of electrotransfer of plasmid into skeletal muscle by pretreatment with hyaluronidase—increased expression with reduced muscle damage. Gene Ther. 2001; 8: 1264–1270.[CrossRef][Medline] [Order article via Infotrieve]

22. Slomp J, Gittenberger-deGroot AC, van Munsteren JC, Huysmans HA, van Bockel JH, van Hinsbergh VW, Poelmann RE. Nature and origin of the neointima in whole vessel wall organ culture of the human saphenous vein. Virchows Arch. 1996; 428: 59–67.[Medline] [Order article via Infotrieve]

23. Soyombo AA, Angelini GD, Bryan AJ, Jasani B, Newby AC. Intimal proliferation in an organ culture of human saphenous vein. Am J Pathol. 1990; 137: 1401–1410.[Abstract]

24. Arkenbout EK, de Waard V, van Bragt M, van Achterberg TA, Grimbergen JM, Pichon B, Pannekoek H, De Vries CJ. Protective function of transcription factor TR3 orphan receptor in atherogenesis: decreased lesion formation in carotid artery ligation model in TR3 transgenic mice. Circulation. 2002; 106: 1530–1535.[Abstract/Free Full Text]

25. Stark VK, Hoch JR, Warner TF, Hullett DA. Monocyte chemotactic protein-1 expression is associated with the development of vein graft intimal hyperplasia. Arterioscler Thromb Vasc Biol. 1997; 17: 1614–1621.[Abstract/Free Full Text]

26. Cipollone F, Marini M, Fazia M, Pini B, Iezzi A, Reale M, Paloscia L, Materazzo G, D’Annunzio E, Conti P, Chiarelli F, Cuccurullo F, Mezzetti A. Elevated circulating levels of monocyte chemoattractant protein-1 in patients with restenosis after coronary angioplasty. Arterioscler Thromb Vasc Biol. 2001; 21: 327–334.[Abstract/Free Full Text]

27. Hokimoto S, Oike Y, Saito T, Kitaoka M, Oshima S, Noda K, Moriyama Y, Ishibashi F, Ogawa H. Increased expression of monocyte chemoattractant protein-1 in atherectomy specimens from patients with restenosis after percutaneous transluminal coronary angioplasty. Circ J. 2002; 66: 114–116.[CrossRef][Medline] [Order article via Infotrieve]

28. Aiello RJ, Bourassa PA, Lindsey S, Weng W, Natoli E, Rollins BJ, Milos PM. Monocyte chemoattractant protein-1 accelerates atherosclerosis in apolipoprotein E-deficient mice. Arterioscler Thromb Vasc Biol. 1999; 19: 1518–1525.[Abstract/Free Full Text]

29. Furukawa Y, Matsumori A, Ohashi N, Shioi T, Ono K, Harada A, Matsushima K, Sasayama S. Anti-monocyte chemoattractant protein-1/monocyte chemotactic and activating factor antibody inhibits neointimal hyperplasia in injured rat carotid arteries. Circ Res. 1999; 84: 306–314.[Abstract/Free Full Text]

30. Horvath C, Welt FG, Nedelman M, Rao P, Rogers C. Targeting CCR2 or CD18 inhibits experimental in-stent restenosis in primates: inhibitory potential depends on type of injury and leukocytes targeted. Circ Res. 2002; 90: 488–494.[Abstract/Free Full Text]

31. Saiura A, Sata M, Hiasa K, Kitamoto S, Washida M, Egashira K, Nagai R, Makuuchi M. Antimonocyte chemoattractant protein-1 gene therapy attenuates graft vasculopathy. Arterioscler Thromb Vasc Biol. 2004; 24: 1886–1890.[Abstract/Free Full Text]

32. Selzman CH, Miller SA, Zimmerman MA, Gamboni-Robertson F, Harken AH, Banerjee A. Monocyte chemotactic protein-1 directly induces human vascular smooth muscle proliferation. Am J Physiol Heart Circ Physiol. 2002; 283: H1455–H1461.[Abstract/Free Full Text]

33. Viedt C, Vogel J, Athanasiou T, Shen W, Orth SR, Kubler W, Kreuzer J. Monocyte chemoattractant protein-1 induces proliferation and interleukin-6 production in human smooth muscle cells by differential activation of nuclear factor-{kappa}B and activator protein-1. Arterioscler Thromb Vasc Biol. 2002; 22: 914–920.[Abstract/Free Full Text]

34. Lamfers ML, Aalders MC, Grimbergen JM, de Vries MR, Kockx MM, van Hinsbergh VW, Quax PH. Adenoviral delivery of a constitutively active retinoblastoma mutant inhibits neointima formation in a human explant model for vein graft disease. Vascul Pharmacol. 2002; 39: 293–301.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
J. Immunol.Home page
D. Strassheim, S. R. Riddle, D. L. Burke, M. W. Geraci, and K. R. Stenmark
Prostacyclin Inhibits IFN-{gamma}-Stimulated Cytokine Expression by Reduced Recruitment of CBP/p300 to STAT1 in a SOCS-1-Independent Manner
J. Immunol., December 1, 2009; 183(11): 6981 - 6988.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. Grassia, M. Maddaluno, A. Guglielmotti, G. Mangano, G. Biondi, P. Maffia, and A. Ialenti
The anti-inflammatory agent bindarit inhibits neointima formation in both rats and hyperlipidaemic mice
Cardiovasc Res, December 1, 2009; 84(3): 485 - 493.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
S. A. Parikh and M. A. Costa
Secondary Prevention, the Interventional Way: Prophylactic Drug-Eluting Stents for Nonobstructive Saphenous Vein Graft Disease
Circulation, November 17, 2009; 120(20): 1940 - 1942.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. S. K. Potula, D. Wang, D. Van Quyen, N. K. Singh, V. Kundumani-Sridharan, M. Karpurapu, E. A. Park, W. C. Glasgow, and G. N. Rao
Src-dependent STAT-3-mediated Expression of Monocyte Chemoattractant Protein-1 Is Required for 15(S)-Hydroxyeicosatetraenoic Acid-induced Vascular Smooth Muscle Cell Migration
J. Biol. Chem., November 6, 2009; 284(45): 31142 - 31155.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
T. Aoki, H. Kataoka, R. Ishibashi, K. Nozaki, K. Egashira, and N. Hashimoto
Impact of Monocyte Chemoattractant Protein-1 Deficiency on Cerebral Aneurysm Formation
Stroke, March 1, 2009; 40(3): 942 - 951.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
F. Montecucco and F. Mach
Common inflammatory mediators orchestrate pathophysiological processes in rheumatoid arthritis and atherosclerosis
Rheumatology, January 1, 2009; 48(1): 11 - 22.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Schober
Chemokines in Vascular Dysfunction and Remodeling
Arterioscler Thromb Vasc Biol, November 1, 2008; 28(11): 1950 - 1959.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. M. Handel, Z. Johnson, D. H. Rodrigues, A. C. dos Santos, R. Cirillo, V. Muzio, S. Riva, M. Mack, M. Deruaz, F. Borlat, et al.
An engineered monomer of CCL2 has anti-inflammatory properties emphasizing the importance of oligomerization for chemokine activity in vivo
J. Leukoc. Biol., October 1, 2008; 84(4): 1101 - 1108.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
Z. A. Ali, C. A. Bursill, G. Douglas, E. McNeill, M. Papaspyridonos, A. L. Tatham, J. K. Bendall, A. M. Akhtar, N. J. Alp, D. R. Greaves, et al.
CCR2-Mediated Antiinflammatory Effects of Endothelial Tetrahydrobiopterin Inhibit Vascular Injury-Induced Accelerated Atherosclerosis
Circulation, September 30, 2008; 118(14_suppl_1): S71 - S77.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
E. A. Eugenin, S. Morgello, M. E. Klotman, A. Mosoian, P. A. Lento, J. W. Berman, and A. D. Schecter
Human Immunodeficiency Virus (HIV) Infects Human Arterial Smooth Muscle Cells in Vivo and in Vitro: Implications for the Pathogenesis of HIV-Mediated Vascular Disease
Am. J. Pathol., April 1, 2008; 172(4): 1100 - 1111.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Borensztajn, J. Stiekema, S. Nijmeijer, P. H. Reitsma, M. P. Peppelenbosch, and C. A. Spek
Factor Xa Stimulates Proinflammatory and Profibrotic Responses in Fibroblasts via Protease-Activated Receptor-2 Activation
Am. J. Pathol., February 1, 2008; 172(2): 309 - 320.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
K. Egashira, K. Nakano, K. Ohtani, K. Funakoshi, G. Zhao, Y. Ihara, J.-i. Koga, S. Kimura, R. Tominaga, and K. Sunagawa
Local Delivery of Anti-Monocyte Chemoattractant Protein-1 by Gene-Eluting Stents Attenuates In-Stent Stenosis in Rabbits and Monkeys
Arterioscler Thromb Vasc Biol, December 1, 2007; 27(12): 2563 - 2568.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
D. Burt, G. Salvidio, E. Tarabra, F. Barutta, S. Pinach, P. Dentelli, G. Camussi, P. C. Perin, and G. Gruden
The Monocyte Chemoattractant Protein-1/Cognate CC Chemokine Receptor 2 System Affects Cell Motility in Cultured Human Podocytes
Am. J. Pathol., December 1, 2007; 171(6): 1789 - 1799.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
26/9/2063    most recent
01.ATV.0000235694.69719.e2v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schepers, A.
Right arrow Articles by Quax, P.H.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schepers, A.
Right arrow Articles by Quax, P.H.A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
Medline Plus Health Information
*Cholesterol
*Genes and Gene Therapy
Related Collections
Right arrow Restenosis
Right arrow Animal models of human disease
Right arrow Growth factors/cytokines
Right arrow Peripheral vascular disease
Right arrow Coagulation inhibitors
Right arrow Gene therapy
Right arrow Mechanism of atherosclerosis/growth factors