Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2006;26:1481-1487
Published online before print April 27, 2006, doi: 10.1161/01.ATV.0000223875.14120.93
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
26/7/1481    most recent
01.ATV.0000223875.14120.93v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liou, J.-Y.
Right arrow Articles by Wu, K. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liou, J.-Y.
Right arrow Articles by Wu, K. K.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*HYDROGEN PEROXIDE
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2006;26:1481.)
© 2006 American Heart Association, Inc.


Vascular Biology

Protection of Endothelial Survival by Peroxisome Proliferator-Activated Receptor-{delta} Mediated 14-3-3 Upregulation

Jun-Yang Liou; Sang Lee; Dipak Ghelani; Nevenka Matijevic-Aleksic; Kenneth K. Wu

From the Vascular Biology Research Center (J.-Y.L., S.L., D.G., K.K.W.), Brown Foundation Institute of Molecular Medicine, and Division of Hematology (J.-Y.L., S.L., D.G., N.M.-A., K.K.W.), Department of Internal Medicine, Medical School, University of Texas Health Science Center at Houston.

Correspondence to Kenneth K. Wu, Vascular Biology Research Center, Brown Foundation Institute of Molecular Medicine, and Division of Hematology, Department of Internal Medicine, Medical School, University of Texas Health Science Center at Houston, Houston, TX 77030-1503. E-mail kenneth.k.wu{at}uth.tmc.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Objective— To determine the role of prostacyclin (PGI2) in protecting endothelial cells (ECs) from apoptosis and elucidate the protective mechanism.

Methods and Results— To evaluate the effect of PGI2 on EC survival, we treated ECs with Ad-COX1/PGIS (Ad-COPI), which augmented selectively PGI2 production or carbaprostacyclin (cPGI2) followed by H2O2 for 4 hours. Ad-COPI inhibited annexin V–positive cells and blocked caspase 3 activation. cPGI2 inhibited apoptosis in a concentration-dependent manner. L-165041 had a similar effect, suggesting the involvement of peroxisome proliferator-activated receptor-{delta} (PPAR{delta}). ECs expressed functional PPAR{delta}. PPAR{delta} overexpression enhanced whereas PPAR{delta} knockdown by small interfering RNA abrogated the antiapoptotic action of cPGI2 and L-165041. Our results show for the first time that PGI2 stimulated 14-3-3{alpha} expression via PPAR{delta} activation. cPGI2 and L-165041 induced binding oaf PPAR{delta} to PPAR response elements located between –1426 and –1477 of 14-3-3{alpha} promoter region, thereby activating 14-3-3{alpha} promoter activity and protein expression. Upregulation of 14-3-3{alpha} proteins resulted in an increase in Bad binding to 14-3-3{alpha} and a reduction in Bad translocation to mitochondria.

Conclusions— PGI2 protects ECs from H2O2-induced apoptosis by inducing PPAR{delta} binding to 14-3-3{alpha} promoter, thereby upregulating 14-3-3{alpha} protein expression. Elevated 14-3-3{alpha} augments Bad sequestration and prevents Bad-triggered apoptosis.

We postulated that EC-synthesized PGI2 protects ECs from apoptosis. Results show that PGI2 generated by transduction with an adenoviral vector containing a bicistronic cyclooxygenase-1 and PGI2 synthase construct (Ad-COPI) or synthetic carbaprostacyclin (cPGI2) suppressed H2O2-induced EC apoptosis by a novel PPAR{delta}-mediated 14-3-3{alpha} transcriptional upregulation.


Key Words: apoptosis • endothelial cells • PPAR{delta}, prostacyclin • 14-3-3


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Vascular endothelial cells (ECs) are metabolically active, capable of synthesizing an array of compounds in response to exogenous stimulation. These molecules play crucial roles in protecting vascular integrity. Among the molecules, prostacyclin (PGI2) inhibits platelet aggregation, regulates vascular tone, antagonizes the actions of thromboxane A2, and protects tissues from apoptosis.1–4 The biological actions of PGI2 are mediated by a PGI2-specific Gs-coupled receptor that signals via the cAMP-dependent protein kinase A pathway.5 Recent studies suggest that certain PGI2 actions may be mediated via the peroxisome proliferator-activated receptor-{delta} (PPAR{delta}) pathway. Several PGI2 synthetic analogs such as carbaprostacyclin (cPGI2) have been shown to bind and activate PPAR{delta}.6 PPAR{delta} is involved in controlling keratinocyte and cancer cell apoptosis.7,8 cPGI2 has been shown to protect renal cells from hypertonicity-induced apoptosis, which was attributed to PPAR{delta} activation.9

It is conceivable that EC-derived PGI2 production in response to exogenous stimuli may, in an autocrine or paracrine manner, protect ECs from apoptosis. However, this notion has not been supported by reported data. The aims of this study were, hence, to determine whether PGI2 protects ECs from H2O2-induced apoptosis and to elucidate the protective mechanism. Because authentic PGI2 is unstable and unsuitable for this study, we transduced human umbilical vein ECs (HUVECs) with an adenoviral vector containing a bicistronic cyclooxygenase-1 (COX-1) and PGI2 synthase (PGIS) construct (Ad-COPI), which selectively augment PGI2 synthesis in HUVECs.10 ECs synthesize PGI2 by 3 enzymatic steps: (1) activation of an 85-kDa cytosolic phospholipase A2, which catalyzes release of arachidonic acid from membrane phospholipids; (2) conversion of arachidonic acid into prostaglandin H2 by cyclooxygenases (COX-1 and COX-2); and (3) conversion of prostaglandin H2 into PGI2 by PGIS.11 These enzymes are colocalized and functionally coupled.12,13 COX-1 and PGIS undergo autoinactivation during catalysis, thereby limiting the extent of PGI2 synthesis.14–16 Limitation of PGI2 production is circumvented by Ad-COPI–induced cooverexpression of COX-1 and PGIS, which selectively augments PGI2 production without a concurrent increase in the production of other eicosanoids.10 Thus, Ad-COPI is well suited for evaluating the effect of authentic PGI2 on EC survival. The results show that Ad-COPI suppressed annexin V–positive cells and caspase 3 activation. cPGI2 protected HUVECs from apoptosis in a concentration-dependent manner. Furthermore, L-165041, a selective PPAR{delta} ligand, suppressed H2O2-induced apoptosis, suggesting the involvement of PPAR{delta}. HUVECs expressed functional PPAR{delta}. Overexpression of PPAR{delta} by Ad-PPAR{delta} enhanced whereas knockdown of PPAR{delta} with small interfering RNA (siRNA) abrogated the antiapoptotic action of cPGI2 and L-165041. Our results reveal for the first time that PGI2 upregulated 14-3-3, especially 14-3-3{alpha}, in a PPAR{delta}-dependent manner. cPGI2 induced binding of PPAR{delta} to PPAR response elements (PPREs), thereby activating 14-3-3{alpha} promoter activity. 14-3-3{alpha} is a member of 14-3-3 family, which binds phosphorylated Bad and sequesters Bad in the cytosol.17–20 Our results show that 14-3-3{alpha} upregulation amplified Bad binding and reduced Bad translocation to mitochondria, whereby it inhibited cytochrome c release, caspase 3 activation, and EC apoptosis.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Recombinant Adenoviral Vectors
Ad-COPI vectors were generated by homologous recombination and amplified in 293 cells as described previously.10 An empty adenovirus (Ad-null) or Ad-GFP was used as a control. Ad-PPAR{delta} was kindly provided by Drs Kinzler and Vogelstein at Johns Hopkins University, Baltimore, Md. The recombinant viruses were purified by CsCl density-gradient centrifugation, and the virus titers were determined by a plaque assay as described previously.10

Cell Culture and Treatment
HUVECs were prepared from freshly obtained umbilical veins and cultured as described previously.21 In initial experiments, HUVECs (at passage 3 or 4) grown in a 6-well plate were treated with various concentrations of H2O2 for various periods of time, and apoptosis was determined. We found treatment of HUVECs with 0.5 mmol/L H2O2 for 4 hours to be optimal. To evaluate the effects of cPGI2 and L-165041 on apoptosis, HUVECs were pretreated with either compound for 4 hours before treatment with H2O2 in serum-free medium for 4 hours. Based on our previous experimental results,10 we infected HUVECs with recombinant adenoviruses for 48 hours. ECV304 cells were maintained in DMEM containing 10% FBS. For induction of ECV304 apoptosis, cells were treated with 2 mmol/L H2O2 for 8 hours.

Assay of Apoptosis
Apoptosis was analyzed by flow cytometry using annexin V staining. Cells were washed with PBS and incubated with a fluorescein isothiocyanate–labeled annexin V antibody (Beckman Coulter). The labeled cells were analyzed by flow cytometry (Beckman Coulter Epics XL). Apoptosis was also analyzed by incubating cells with 1 µg/mL Hoechst 33258 for 15 minutes and counting positively stained cells by fluorescent microscopy. Caspase-3 activity was assayed by flow cytometry using a caspase-3 assay kit (Calbiochem). Cytochrome c release was analyzed using immunofluorescent microscopy by a method described previously.22 The images were processed by Adobe Photoshop software. In all the assays, the results were expressed as percentages of positively stained cells.

Plasmid Constructs and Luciferase Reporter Assay
To construct human 14-3-3{alpha} vector, the complete coding sequence of 14-3-3{alpha} was amplified by polymerase chain reaction (PCR) and cloned into pCDNA3.1+ vector (Invitrogen). siRNA of PPAR{delta} (sense sequence: ACAGATGAAGACAGATGCACC) was purchased from Applied Biosystems. To achieve high transfection efficiency, the endothelial-like ECV304 cells were transfected with 14-3-3{alpha} vector or siRNA-PPAR{delta} by Effectene transfection kit (Quiagene). For cloning 14-3-3{alpha} promoter, a 1.6-kb (–1625 to +24) 5'-flanking region of human genomic sequence was amplified by PCR and cloned into pGL3 luciferase reporter. 5'-deletion constructs (–1348 to +24, –787 to +24, –412 to +24 and –47 to +24) were amplified by PCR and subcloned to pGL3 vector. PPAR{delta}-specific response element reporter7 was kindly provided by Drs Kinzler and Vogelstein. For the luciferase assay, ECV304 cells were transfected with reporter constructs by Fugene 6 transfection reagent (Roche) for 48 hours. After treatment with cPGI2 or other compounds, cells were lysed, luciferase activity was measured using a kit from Promega, and the emitted light was determined in a luminometer. Protein concentrations of cell lysates were determined by a protein assay kit (Bio-Rad). Luciferase activity was expressed as relative light unit/µg protein.

Preparation of Mitochondrial Fraction
Mitochondrial fractions were prepared by a mitochondria isolation kit (Sigma) as described previously.22 Nuclear and cytosolic fractions were removed by 2-step gradient centrifugation, and the pellet-containing mitochondria was collected and stored at –20°C. heat shock protein 60 (Hsp60) was used as a mitochondrial marker.

Immunoprecipitation
cPGI2- or L-165041–treated HUVECs were harvested and immunoprecipitated with a 14-3-3{alpha} antibody. The immunoprecipitated complex was pulled down with protein A/G-agarose (Santa Cruz Biotechnology). After washing 5x, the proteins were analyzed by Western blotting using a Bad antibody.

Western Blot Analysis
A total of 25 µg of cell lysate proteins were applied to each lane and analyzed by Western blots as described previously.21 Rabbit polyclonal antibodies against 14-3-3 isoforms ({alpha}, {gamma}, {zeta}, and {theta}, diluted at 1:250 each) goat polyclonal antibodies against COX-1 (1:1000), and Hsp60 (1:2000) 14-3-3 isoforms ({sigma}, {eta}, and ß; diluted at 1:500 each) were purchased from Santa Cruz Biotechnology. Rabbit polyclonal antibody against PPAR{delta} (1:500) was obtained from Cayman Chemical. Rabbit polyclonal antibodies against cleaved poly(ADP-ribose)polymerase (PARP) (1:500) and Bad (1:500) were purchased from Cell Signaling. Rabbit polyclonal antibody against PGIS was prepared as described previously.23

Chromatin Immunoprecipitation
The assay was done as described previously.24 The primers for amplifying PPRE-containing region are: 5' primer: –1625CCAAGC-GCCAGAAGCTG AAG–1606, and 3' primer: –1348GAGACAGAGTTGTGCTCTTG–1329 and non-PPRE region are: 5' primer –412CGTTACAGCCTCCGTCGTTC–393, and 3' primer +4GATGATCGAGAGGATCTGGTG+24. The resulting products of 297 bp and 436 bp, respectively, were separated by agarose gel electrophoresis. Putative PPAR–retinoid X receptor (RXR) binding sites with typical AGGTCA-X-AGGTCA motif (X denotes any nucleotide) on 14-3-3{alpha} promoter region were analyzed with P-Match 1.0 software (gene-regulation biological databases).

Statistical Analysis
ANOVA software was used to determine statistical differences of apoptosis, caspase 3 activity, and luciferase activity between groups. A P value <0.05 is considered to be statistically significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
PGI2 Inhibited HUVEC Apoptosis Via PPAR{delta} Activation
To evaluate the effect of PGI2 on apoptosis, we transduced HUVECs with Ad-COPI for 48 hours, which increased equivalently COX-1 and PGIS protein levels and selectively augmented PGI2 synthesis without an increase in other eicosanoids as reported previously (supplemental Figure I, available online at http://atvb.ahajournals.org). Ad-COPI suppressed H2O2-induced HUVEC apoptosis (Figure 1A) and caspase 3 activation (supplemental Figure IIA). cPGI2 reduced annexin V–positive cells induced by H2O2 in a concentration-dependent manner (Figure 1B), whereas PGE2 at 50 µmol/L did not have an effect (data not shown). cPGI2 suppressed caspase 3 activation (supplemental Figure IIB). L-165041 also suppressed H2O2-induced annexin V cells (Figure 1C), suggesting the involvement of PPAR{delta}. Because little was known about the function of endothelial PPAR{delta}, we determined the expression of PPAR{delta} proteins in HUVECs by Western blotting. Basal PPAR{delta} was detected, which was increased by cPGI2 or L-165041 (supplemental Figure IIIA). The PPAR{delta} proteins in ECs are functionally active because a luciferase reporter containing PPREs was activated by cPGI2 in a concentration-dependent manner (Figure 2A). L-165041 induced PPRE reporter expression in a concentration-dependent manner identical to cPGI2 (data not shown).


Figure 1
View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. Prevention of HUVEC apoptosis. HUVECs were transduced with Ad-COPI or Ad-null (50 mois) for 48 hours (A), treated with cPGI2 (1 to 100 µmol/L; B), or L-165041 (50 µmol/L; C) for 4 hours, followed by H2O2 (0.5 mmol/L) for 4 hours. Annexin V–positive cells were analyzed by flow cytometry. Results are expressed as percentages of cells with positive stains. Each bar represents mean±SD (n=3). P values were determined by ANOVA program.


Figure 2
View larger version (30K):
[in this window]
[in a new window]
 
Figure 2. Functional PPAR{delta} in ECs. ECV304 cells were transfected with PPRE reporter and treated with cPGI2 (0 to 50 µmol/L; A), Ad vectors (50 moi each; B), or siRNA vectors (C) as indicated. Luciferase expression by PPRE reporter was measured and expressed as relative light unit (RLU)/µg protein. Each bar represents mean±SD (n=3).

To determine the role of PPAR{delta} in regulating the antiapoptotic activity of PGI2, we transduced HUVECs with Ad-PPAR{delta}, which, as expected, increased PPAR{delta} protein levels (data not shown). Coinfection of HUVECs with Ad-PPAR{delta} and Ad-COPI augmented the PPRE reporter response by 4-fold over that infected with Ad-GFP (Figure 2B). Conversely, PPAR{delta} knockdown with siRNA abrogated the PPRE reporter activity induced by cPGI2 or L-165041 (Figure 2C). Ad-PPAR{delta} reduced H2O2-induced Hoechst-positive cells (Figure 3A), and caspase 3 activation (supplemental Figure IIC) to a similar extent, and knockdown of PPAR{delta} expression abrogated the antiapoptotic action of cPGI2 and L-165041 (Figure 3B). Together, these results suggest an essential role of PPAR{delta} activation in PGI2-mediated antiapoptotic action.


Figure 3
View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. Regulation of HUVEC apoptosis by PPAR{delta}. A, HUVECs transduced with the indicated Ad vector were treated with H2O2 for 4 hours. Percentages of Hoechst-positive cells were determined by microscopy. Each bar represents mean±SD (n=3). B, ECV304 cells transfected with siRNA or control were treated with cPGI2 or L-165041 (10 µmol/L each) for 4 hours, followed by H2O2 for 4 hours. PARP cleavage was determined by Western blotting. This figure is representative of 2 experiments.

Upregulation of 14-3-3 Proteins by PPAR{delta} Activation
We hypothesized that PPAR{delta} suppresses apoptosis by upregulating a survival factor in ECs. We screened a number of factors and identified 14-3-3 as a potential target. HUVECs expressed predominantly 14-3-3{alpha}, {theta}, {zeta}, and {gamma} isoforms (Figure 4A). 14-3-3 ß, {eta}, and {sigma} proteins were barely detectable (Figure 4A). 14-3-3{alpha} was increased by cPGI2 and L-165041 to a similar extent (>3-fold). 14-3-3{theta} and 14-3-3{zeta} were increased by a lesser extent, whereas 14-3-3{gamma} was unaltered (Figure 4A). We focused on 14-3-3{alpha} in our subsequent experiments. Ad-PPAR{delta} increased 14-3-3{alpha} by &2-fold and augmented the effect of cPGI2 or L-165041 by an additional 2-fold (Figure 4B). PPAR{delta} siRNA abrogated 14-3-3{alpha} protein levels induced by cPGI2 or L-165041 (Figure 4C). The control siRNA vector had no effect. Together, these results indicate that 14-3-3{alpha} expression is regulated by PPAR{delta} activation.


Figure 4
View larger version (15K):
[in this window]
[in a new window]
 
Figure 4. Upregulation of 14-3-3 by cPGI2 and L-165041. A, HUVECs were treated with cPGI2 (50 µmol/L) or L-165041 (50 µmol/L) for 4 hours and transduced with the indicated Ad and treated with cPGI2 or L-165041 (B). C, ECV304 cells transfected with siRNA were treated with cPGI2 or L-165041. 14-3-3 proteins were analyzed by Western blots. For B and C, the top shows a representative blot and the bottom, densitometry (n=3).

Requirement of PPREs for PGI2-Induced 14-3-3{alpha} Transcriptional Activation
To determine whether PGI2 stimulates 14-3-3{alpha} expression via PPAR{delta}-mediated transcriptional activation, we transfected ECs with the 1.6-kb (–1625 to +24) 14-3-3{alpha} promoter vector. cPGI2 and L-165041 increased the luciferase activity by &2-fold over the control (supplemental Figure IIIB), which was abrogated by specific PPAR{delta} siRNA (Figure 5A). Analysis of this promoter region with P-Match 1.0 revealed 3 contiguous canonical PPREs located at –1426/–1438, –1444/–1456, and –1465/–1477. To determine whether they are required for 14-3-3{alpha} promoter activity, we constructed several 5'-deletion mutants into pGL3 expression vector and transfected them into ECV304. Ad-COPI increased the wild-type (p1625) promoter activity, which was enhanced by Ad-PPAR{delta} (Figure 5B). Deletion of the PPRE-containing region such as in the p1348 mutant abolished the response to Ad-COPI and Ad-PPAR{delta}. Shorter 5'-deletion mutants (ie, p787 and p412) failed to respond to Ad-COPI or Ad-PPAR{delta} but retained the basal promoter activity. Basal promoter activity was completely abolished in the p47 mutant (Figure 5B). To ascertain PPAR{delta} binding to 14-3-3{alpha} promoter, we performed chromatin immunoprecipitation with a PPAR{delta}-specific antibody. There was little basal PPAR{delta} binding to 14-3-3{alpha}, and its binding was enhanced by cPGI2 and L-165041 to a similar extent (Figure 5C). As controls, PPAR{delta} binding was not detected with nonimmune IgG or with a DNA sequence located at the proximal region of the 14-3-3{alpha} promoter (Figure 5C).


Figure 5
View larger version (30K):
[in this window]
[in a new window]
 
Figure 5. PPAR{delta}-dependent activation of 14-3-3{alpha} promoter activity. A, ECV304 cells were transfected with 1.6-kb promoter construct with or without PPAR{delta}-siRNA, followed by cPGI2 or L-165041. B, ECV304 cells transduced with the indicated Ad vector were transfected with wild-type or 5'-deletion mutants shown at the top. Each bar represents mean±SD (n=3); **P<0.01. C, Chromatin immunoprecipitation analysis of PPAR{delta} binding to 14-3-3{alpha} promoter. Binding was detected at –1625/–1328, which harbors PPREs but not at control –412/+24.

14-3-3{alpha} Protected ECs From Apoptosis
Because 14-3-3 binds and sequesters Bad19 and cPGI2 and L-165041 increase 14-3-3{alpha} protein levels, we determined whether 14-3-3{alpha} upregulation amplified Bad binding. ECs were treated with cPGI2, L-165041, or vehicle, and the cell lysate was immunoprecipitated with a 14-3-3{alpha} antibody. Bad proteins in the precipitate were analyzed by Western blots. Both cPGI2 and L-165041 increased Bad binding to 14-3-3{alpha} (Figure 6A). In view of increased binding by 14-3-3{alpha}, we anticipated that cPGI2 and L-165041 suppress Bad translocation to mitochondria. To test this, we prepared mitochondrial fractions from ECs treated with and without H2O2, cPGI2, or L-165041. Hsp60 was included as a mitochondrial marker. The results show that H2O2 increased Bad in the mitochondrial fraction consistent with Bad translocation (Figure 6B). Pretreatment of cells with cPGI2 or L-165041 blocked H2O2-induced Bad translocation to mitochondria (Figure 6B). H2O2-induced Bad mitochondrial translocation resulted in increased cytochrome c release into cytosol, which was suppressed by cPGI2 (supplemental Figure IV). The role of 14-3-3{alpha} in regulating Bad-mediated apoptosis was further supported by 14-3-3{alpha} overexpression. Transfection of cells with 14-3-3{alpha} vector reduced H2O2-induced PARP cleavage to the basal level (Figure 6C). 14-3-3{alpha} overexpression also suppressed the basal PARP cleavage.


Figure 6
View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. Role of 14-3-3{alpha} in antiapoptosis. A, HUVECs were treated with cPGI2 or L-165041 for 4 hours. Cell lysates were immunoprecipitated with 14-3-3{alpha} antibody, and Bad in immunoprecipitation was analyzed. B, HUVECs were treated as indicated, and Bad and Hsp60 in mitochondrial fraction was analyzed. C, ECV304 cells transfected with the indicated vectors were treated with H2O2. Cleaved PARP was analyzed by Western blots. D, Schematic illustration of the protective mechanism of PGI2 via PPAR{delta}-dependent 14-3-3{alpha} upregulation.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
Results from this study provide strong evidence for EC protection by PGI2. Authentic PGI2 generated by Ad-COPI transduction and the synthetic cPGI2 protected HUVECs and ECV304 cells from H2O2-induced apoptosis in a PPAR{delta}-dependent manner. Several pieces of evidence support the requirement of PPAR{delta} activation for the antiapoptotic action of PGI2. First, HUVECs expressed functional PPAR{delta}, which prevented H2O2-induced apoptosis. Second, PPAR{delta} suppression by siRNA abrogated the protective action of PGI2 or L-165041. Third, overexpression of PPAR{delta} amplified the antiapoptotic action of PGI2. It was reported that PPAR{delta} protected keratinocytes from apoptosis by upregulating the expression of phosphoinositide-dependent kinase (PDK) and activation of Akt.25 In this study, we evaluated the effect of PGI2 and L-165041 on PDK-1 and Akt in HUVECs and did not detect changes in PDK-1 protein level or phosphorylated Akt (data not shown). In contrast, our results identified 14-3-3{alpha} as the PPAR{delta}-driven antiapoptotic gene. Ad-COPI, cPGI2, and L-165041 increased 14-3-3{alpha} protein expression, which was abrogated by PPAR{delta} siRNA and enhanced by Ad-PPAR{delta}. Importantly, our results provide direct evidence for the first time for transcriptional activation of 14-3-3{alpha} by PPAR{delta}. These results demonstrate the requirement of PPREs for PGI2-induced 14-3-3{alpha} promoter activation because deletion of the PPRE-containing region of 14-3-3{alpha} promoter nullified the promoter response to Ad-COPI, Ad-PPAR{delta}, or their combination. Activated PPAR{delta} forms a heterodimer with RXR and the heterodimer binds to PPREs, which comprise 2 identical hexamers with a single nucleotide in between via which transcription is activated.26 The 5'-flanking promoter region of 14-3-3{alpha} harbors 3 canonical PPREs that are located contiguously between –1426 and –1477. Deletion of these PPREs results in loss of promoter response to cPGI2 or L-165041. Our data show that cPGI2 and L-165041 induced binding of PPAR{delta} specifically to this promoter region in vivo. Together, the results indicate that 14-3-3{alpha} is a direct target of PPAR{delta}, and its transcriptional activation depends on PPAR{delta} activation.

Seven isoforms of 14-3-3 proteins have been identified in mammalian cells. They share sequence homology and biochemical properties.17 Because 14-3-3 expression in ECs has not been reported, we analyzed their protein levels in HUVECs. Results show that basal 14-3-3{gamma} and 14-3-3{alpha} were detected at a higher density than other isoforms, and basal 14-3-3ß, {eta}, and {sigma} were barely detectable. Because the affinity of antibodies for each isoform may vary, the isoform abundance cannot be accurately determined, and the data should be interpreted with caution. However, response to stimulation by PPAR{delta} activation is clearly isoform specific. 14-3-3{alpha}, and to a lesser extent 14-3-3{theta}, proteins are significantly upregulated by cPGI2 or L-165041. 14-3-3 are cytosolic proteins serving as a scaffold to interact with a large number of proteins.27 They play a role in protecting cells from apoptosis through their binding and sequestering phosphorylated Bad in cytosol.19 Under apoptotic stimulation, Bad is dissociated from 14-3-3 and translocated to mitochondria, where it interacts with Bcl-XL and disrupts the protective function of Bcl-XL, resulting in outer membrane permeabilization, release of cytochrome c, and activation of caspase 9 and 3.28 Our results confirm that H2O2 induces Bad translocation to mitochondria in HUVECs, suggesting that the basal 14-3-3 protein levels were inadequate for preventing Bad translocation. Because cPGI2 and L-165041 increase 14-3-3{alpha} and augment 14-3-3{alpha} binding of Bad, their prevention of Bad translocation is attributed to elevated 14-3-3{alpha}. These findings reveal for the first time that constitutively expressed 14-3-3{alpha} is transcriptionally regulated by PPAR{delta}, and its upregulation confers resistance to the H2O2-induced apoptosis. Together, our findings shed light on a novel mechanism by which PGI2 protects ECs from apoptosis. As illustrated in Figure 6D, we propose that PGI2 binds and activates PPAR{delta}, which forms a heterodimer with RXR and binds to specific PPREs on 14-3-3{alpha} promoter. PPAR{delta}-mediated 14-3-3{alpha} upregulation increases the capacity of 14-3-3{alpha} to bind and sequester Bad, thereby reducing Bad translocation to mitochondria and the consequent caspase 3 activation and apoptosis. It is important to note that this protective signaling pathway is enforced by a positive feedback regulation. Our results show that cPGI2 and L-165041 increased PPAR{delta} protein levels by &3-fold. To our knowledge, the positive feedback regulation of PPAR{delta} expression has not reported previously, and the mechanism by which this occurs is unclear. Nevertheless, feedback upregulation of PPAR{delta} by its ligands is important in amplifying the PPAR{delta}->14-3-3{alpha} protection program.

To demonstrate the antiapoptotic action of PGI2, we transduced HUVECs with Ad-COPI, which selectively increased PGI2 production. The results show a consistent inhibition of H2O2-induced annexin V–positive and Hoechst-positive cells and caspase 3 activation. cPGI2 had a similar effect as Ad-COPI, except that high concentrations of cPGI2 were required to inhibit H2O2-induced apoptosis. One intriguing question is whether the intracellularly produced PGI2 by Ad-COPI acts directly on PPAR{delta} without secretion into the extracellular milieu. It has been shown that PPAR{delta} is distributed in cytosol and nucleus of ECs.29 Because intracellular PGI2 is produced at the perinuclear membrane, PGI2 may bind cytosolic PPAR{delta} and facilitates its translocation or, alternatively, may enter nucleus, where it binds and activates PPAR{delta}. There is little published data on this issue, which requires further investigation. Ad-COPI gene transfer has been shown to protect neurons from ischemia-reperfusion injury in vivo,30 which may be attributed to the antiapoptotic action of PGI2. This gene transfer approach has potential for protecting blood vessels and treating vascular diseases.


*    Acknowledgments
 
We thank Drs Vogelstein and Kinzler for providing Ad-PPAR{delta} and PPAR{delta} response element reporter, Dr Jaou-Chen Huang for statistic analysis, Shao-Tzu Tang and Hui-Ping Tseng for technical assistance, and Dr Song-Kun Shyue for performing high-performance liquid chromatography analysis.

Sources of Funding

This work was supported by National Institutes of Health grants R01-HL-50675 and P50-NS-23327.

Disclosures

None.


*    Footnotes
 
Original received February 1, 2006; final version accepted April 7, 2006.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 

  1. Moncada S, Vane JR. Pharmacology and endogenous roles of prostaglandin endoperoxides, thromboxane A2, and prostacyclin. Pharmacol Rev. 1978; 30: 293–331.[Medline] [Order article via Infotrieve]
  2. Adderley SR, Fitzgerald DJ. Oxidative damage of cardiomyocytes is limited by extracellular regulated kinases 1/2-mediated induction of cyclooxygenase-2. J Biol Chem. 1999; 274: 5038–5046.[Abstract/Free Full Text]
  3. Cheng Y, Austin SC, Rocca B, Koller BH, Coffman TM, Grosser T, Lawson JA, FitzGerald GA. Role of prostacyclin in the cardiovascular response to thromboxane A2. Science. 2002; 296: 539–541.[Abstract/Free Full Text]
  4. Hao CM, Komhoff M, Guan Y, Redha R, Breyer MD. Selective targeting of cyclooxygenase-2 reveals its role in renal medullary interstitial cell survival. Am J Physiol. 1999; 277: F352–F359.
  5. Narumiya S, Sugimoto Y, Ushikubi F. Prostanoid receptors: structures, properties, and functions. Physiol Rev. 1999; 79: 1193–1226.[Abstract/Free Full Text]
  6. Forman BM, Chen J, Evans RM. Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors alpha and delta. Proc Natl Acad Sci U S A. 1997; 94: 4312–4317.[Abstract/Free Full Text]
  7. He TC, Chan TA, Vogelstein B, Kinzler KW. PPAR{delta} is an APC-regulated target of nonsteroidal anti-inflammatory drugs. Cell. 1999; 99: 335–345.[CrossRef][Medline] [Order article via Infotrieve]
  8. Tan NS, Michalik L, Noy N, Yasmin R, Pacot C, Heim M, Fluhmann B, Desvergne B, Wahli W. Critical roles of PPAR beta/delta in keratinocyte response to inflammation. Genes Dev. 2001; 15: 3263–3277.[Abstract/Free Full Text]
  9. Hao CM, Redha R, Morrow J, Breyer MD. Peroxisome proliferator-activated receptor {delta} activation promotes cell survival following hypertonic stress. J Biol Chem. 2002; 277: 21341–21345.[Abstract/Free Full Text]
  10. Shyue SK, Tsai MJ, Liou JY, Willerson JT, Wu KK. Selective augmentation of prostacyclin production by combined prostacyclin synthase and cyclooxygenase-1 gene transfer. Circulation. 2001; 103: 2090–2095.[Abstract/Free Full Text]
  11. Wu KK. Inducible cyclooxygenase and nitric oxide synthase. Adv Pharmacol. 1995; 33: 179–207.
  12. Liou JY, Shyue SK, Tsai MJ, Chung CL, Chu KY, Wu KK. Colocalization of prostacyclin synthase with prostaglandin H synthase-1 (PGHS-1) but not phorbol ester-induced PGHS-2 in cultured endothelial cells. J Biol Chem. 2000; 275: 15314–15320.[Abstract/Free Full Text]
  13. Schievella AR, Regier MK, Smith WL, Lin LL. Calcium-mediated translocation of cytosolic phospholipase A2 to the nuclear envelope and endoplasmic reticulum. J Biol Chem. 1995; 270: 30749–30754.[Abstract/Free Full Text]
  14. Sanduja SK, Tsai AL, Matijevic-Aleksic N, Wu KK. Kinetics of prostacyclin synthesis in PGHS-1-overexpressed endothelial cells. Am J Physiol. 1994; 267: C1459–C1466.
  15. Ham EA, Egan RW, Soderman DD, Gale PH, Kuehl FA Jr. Peroxidase-dependent deactivation of prostacyclin synthetase. J Biol Chem. 1979; 254: 2191–2194.[Abstract/Free Full Text]
  16. Egan RW, Paxton J, Kuehl FA Jr. Mechanism for irreversible self-deactivation of prostaglandin synthetase. J Biol Chem. 1976; 251: 7329–7335.[Abstract/Free Full Text]
  17. Fu H, Subramanian RR, Masters SC. 14-3-3 proteins: structure, function, and regulation. Annu Rev Pharmacol Toxicol. 2000; 40: 617–647.[CrossRef][Medline] [Order article via Infotrieve]
  18. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell. 1997; 91: 231–241.[CrossRef][Medline] [Order article via Infotrieve]
  19. Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ. Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell. 1996; 87: 619–628.[CrossRef][Medline] [Order article via Infotrieve]
  20. Zhou XM, Liu Y, Payne G, Lutz RJ, Chittenden T. Growth factors inactivate the cell death promoter BAD by phosphorylation of its BH3 domain on Ser155. J Biol Chem. 2000; 275: 25046–25051.[Abstract/Free Full Text]
  21. Xu XM, Sansores-Garcia L, Chen XM, Matijevic-Aleksic N, Du M, Wu KK. Suppression of inducible cyclooxygenase-2 gene transcription by aspirin and sodium salicylate. Proc Natl Acad Sci U S A. 1999; 96: 5292–5297.[Abstract/Free Full Text]
  22. Liou JY, Aleksic N, Chen SF, Han TJ, Shyue SK, Wu KK. Mitochondrial localization of cyclooxygenase-2 and calcium-independent phospholipase A2 in human cancer cells: implication in apoptosis resistance. Exp Cell Res. 2005; 306: 75–84.[CrossRef][Medline] [Order article via Infotrieve]
  23. Shyue SK, Ruan KH, Wang LH, Wu KK. Prostacyclin synthase active sites. Identification by molecular modeling-guided site-directed mutagenesis. J Biol Chem. 1997; 272: 3657–3662.[Abstract/Free Full Text]
  24. Deng WG, Zhu Y, Wu KK. Role of p300 and PCAF in regulating cyclooxygenase-2 promoter activation by inflammatory mediators. Blood. 2004; 103: 2135–2142.[Abstract/Free Full Text]
  25. Di-Poï N, Tan NS, Michalik L, Wahli W, Desvergne B. Antiapoptotic role of PPARß in keratinocytes via transcriptional control of the Akt1 signaling pathway. Mol Cell. 2002; 10: 721–733.[CrossRef][Medline] [Order article via Infotrieve]
  26. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, Umesono K, Evans RM. Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci U S A. 1994; 91: 7355–7359.[Abstract/Free Full Text]
  27. Tzivion G, Avruch J. 14-3-3 proteins: active cofactors in cellular regulation by serine/threonine phosphorylation. J Biol Chem. 2002; 277: 3061–3064.[Free Full Text]
  28. Zha J, Harada H, Osipov K, Jockel J, Waksman G, Korsmeyer SJ. BH3 domain of BAD is required for heterodimerization with BCL-XL and pro-apoptotic activity. J Biol Chem. 1997; 272: 24101–24104.[Abstract/Free Full Text]
  29. Bishop-Bailey D, Hla T. Endothelial cell apoptosis induced by the peroxisome proliferator-activated receptor (PPAR) ligand 15-deoxy-Delta12, 14-prostaglandin J2. J Biol Chem. 1999; 274: 17042–17048.[Abstract/Free Full Text]
  30. Lin H, Lin TN, Cheung WM, Nian GM, Tseng PH, Chen SF, Chen JJ, Shyue SK, Liou JY, Wu CW, Wu KK. Cyclooxygenase-1 and bicistronic cyclooxygenase-1/prostacyclin synthase gene transfer protect against ischemic cerebral infarction. Circulation. 2002; 105: 1962–1969.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Circ. Res.Home page
T. He, T. Lu, L. V. d'Uscio, C.-F. Lam, H.-C. Lee, and Z. S. Katusic
Angiogenic Function of Prostacyclin Biosynthesis in Human Endothelial Progenitor Cells
Circ. Res., July 3, 2008; 103(1): 80 - 88.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
P. Zania, M. Papaconstantinou, C. S. Flordellis, M. E. Maragoudakis, and N. E. Tsopanoglou
Thrombin mediates mitogenesis and survival of human endothelial cells through distinct mechanisms
Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1215 - C1226.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
Y. Fan, Y. Wang, Z. Tang, H. Zhang, X. Qin, Y. Zhu, Y. Guan, X. Wang, B. Staels, S. Chien, et al.
Suppression of Pro-inflammatory Adhesion Molecules by PPAR-{delta} in Human Vascular Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., February 1, 2008; 28(2): 315 - 321.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
J.-C. Huang, W.-S. A. Wun, J. S. Goldsby, K. Egan, G. A. FitzGerald, and K. K. Wu
Prostacyclin receptor signaling and early embryo development in the mouse
Hum. Reprod., November 1, 2007; 22(11): 2851 - 2856.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
J.-Y. Liou, D. P. Ellent, S. Lee, J. Goldsby, B.-S. Ko, N. Matijevic, J.-C. Huang, and K. K. Wu
Cyclooxygenase-2-Derived Prostaglandin E2 Protects Mouse Embryonic Stem Cells from Apoptosis
Stem Cells, May 1, 2007; 25(5): 1096 - 1103.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J.-Y. Liou, D. Ghelani, S. Yeh, and K. K. Wu
Nonsteroidal Anti-inflammatory Drugs Induce Colorectal Cancer Cell Apoptosis by Suppressing 14-3-3{varepsilon}
Cancer Res., April 1, 2007; 67(7): 3185 - 3191.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
L. Brunelli, K. A. Cieslik, J. L. Alcorn, M. Vatta, and A. Baldini
Peroxisome Proliferator-Activated Receptor-{delta} Upregulates 14-3-3{epsilon} in Human Endothelial Cells via CCAAT/Enhancer Binding Protein-{beta}
Circ. Res., March 16, 2007; 100(5): e59 - e71.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
J.-C. Huang, W.-S.A. Wun, J.S. Goldsby, I.C. Wun, D. Noorhasan, and K.K. Wu
Stimulation of embryo hatching and implantation by prostacyclin and peroxisome proliferator-activated receptor {delta} activation: implication in IVF
Hum. Reprod., March 1, 2007; 22(3): 807 - 814.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
A. Iwashita, Y. Muramatsu, T. Yamazaki, M. Muramoto, Y. Kita, S. Yamazaki, K. Mihara, A. Moriguchi, and N. Matsuoka
Neuroprotective Efficacy of the Peroxisome Proliferator-Activated Receptor {delta}-Selective Agonists in Vitro and in Vivo
J. Pharmacol. Exp. Ther., March 1, 2007; 320(3): 1087 - 1096.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. D. Brown and J. Plutzky
Peroxisome Proliferator Activated Receptors as Transcriptional Nodal Points and Therapeutic Targets
Circulation, January 30, 2007; 115(4): 518 - 533.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
26/7/1481    most recent
01.ATV.0000223875.14120.93v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liou, J.-Y.
Right arrow Articles by Wu, K. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liou, J.-Y.
Right arrow