This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: 26/7/1481    most recent 01.ATV.0000223875.14120.93v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Liou, J.-Y. Articles by Wu, K. K. Search for Related Content PubMed PubMed Citation Articles by Liou, J.-Y. Articles by Wu, K. K. Pubmed/NCBI databases Gene GEO Profiles HomoloGene UniGene Compound via MeSH Substance via MeSH Hazardous Substances DB HYDROGEN PEROXIDE

(Arteriosclerosis, Thrombosis, and Vascular Biology. 2006;26:1481.)
© 2006 American Heart Association, Inc.

Vascular Biology

Protection of Endothelial Survival by Peroxisome Proliferator-Activated Receptor- Mediated 14-3-3 Upregulation

Jun-Yang Liou; Sang Lee; Dipak Ghelani; Nevenka Matijevic-Aleksic; Kenneth K. Wu

From the Vascular Biology Research Center (J.-Y.L., S.L., D.G., K.K.W.), Brown Foundation Institute of Molecular Medicine, and Division of Hematology (J.-Y.L., S.L., D.G., N.M.-A., K.K.W.), Department of Internal Medicine, Medical School, University of Texas Health Science Center at Houston.

Correspondence to Kenneth K. Wu, Vascular Biology Research Center, Brown Foundation Institute of Molecular Medicine, and Division of Hematology, Department of Internal Medicine, Medical School, University of Texas Health Science Center at Houston, Houston, TX 77030-1503. E-mail kenneth.k.wu{at}uth.tmc.edu

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Objective— To determine the role of prostacyclin (PGI₂) in protecting endothelial cells (ECs) from apoptosis and elucidate the protective mechanism.

Methods and Results— To evaluate the effect of PGI₂ on EC survival, we treated ECs with Ad-COX1/PGIS (Ad-COPI), which augmented selectively PGI₂ production or carbaprostacyclin (cPGI₂) followed by H₂O₂ for 4 hours. Ad-COPI inhibited annexin V–positive cells and blocked caspase 3 activation. cPGI₂ inhibited apoptosis in a concentration-dependent manner. L-165041 had a similar effect, suggesting the involvement of peroxisome proliferator-activated receptor- (PPAR). ECs expressed functional PPAR. PPAR overexpression enhanced whereas PPAR knockdown by small interfering RNA abrogated the antiapoptotic action of cPGI₂ and L-165041. Our results show for the first time that PGI₂ stimulated 14-3-3 expression via PPAR activation. cPGI₂ and L-165041 induced binding oaf PPAR to PPAR response elements located between –1426 and –1477 of 14-3-3 promoter region, thereby activating 14-3-3 promoter activity and protein expression. Upregulation of 14-3-3 proteins resulted in an increase in Bad binding to 14-3-3 and a reduction in Bad translocation to mitochondria.

Conclusions— PGI₂ protects ECs from H₂O₂-induced apoptosis by inducing PPAR binding to 14-3-3 promoter, thereby upregulating 14-3-3 protein expression. Elevated 14-3-3 augments Bad sequestration and prevents Bad-triggered apoptosis.

We postulated that EC-synthesized PGI₂ protects ECs from apoptosis. Results show that PGI₂ generated by transduction with an adenoviral vector containing a bicistronic cyclooxygenase-1 and PGI₂ synthase construct (Ad-COPI) or synthetic carbaprostacyclin (cPGI₂) suppressed H₂O₂-induced EC apoptosis by a novel PPAR-mediated 14-3-3 transcriptional upregulation.

Key Words: apoptosis • endothelial cells • PPAR, prostacyclin • 14-3-3

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Vascular endothelial cells (ECs) are metabolically active, capable of synthesizing an array of compounds in response to exogenous stimulation. These molecules play crucial roles in protecting vascular integrity. Among the molecules, prostacyclin (PGI₂) inhibits platelet aggregation, regulates vascular tone, antagonizes the actions of thromboxane A₂, and protects tissues from apoptosis.^1–4 The biological actions of PGI₂ are mediated by a PGI₂-specific Gs-coupled receptor that signals via the cAMP-dependent protein kinase A pathway.⁵ Recent studies suggest that certain PGI₂ actions may be mediated via the peroxisome proliferator-activated receptor- (PPAR) pathway. Several PGI₂ synthetic analogs such as carbaprostacyclin (cPGI₂) have been shown to bind and activate PPAR.⁶ PPAR is involved in controlling keratinocyte and cancer cell apoptosis.^7,8 cPGI₂ has been shown to protect renal cells from hypertonicity-induced apoptosis, which was attributed to PPAR activation.⁹

It is conceivable that EC-derived PGI₂ production in response to exogenous stimuli may, in an autocrine or paracrine manner, protect ECs from apoptosis. However, this notion has not been supported by reported data. The aims of this study were, hence, to determine whether PGI₂ protects ECs from H₂O₂-induced apoptosis and to elucidate the protective mechanism. Because authentic PGI₂ is unstable and unsuitable for this study, we transduced human umbilical vein ECs (HUVECs) with an adenoviral vector containing a bicistronic cyclooxygenase-1 (COX-1) and PGI₂ synthase (PGIS) construct (Ad-COPI), which selectively augment PGI₂ synthesis in HUVECs.¹⁰ ECs synthesize PGI₂ by 3 enzymatic steps: (1) activation of an 85-kDa cytosolic phospholipase A₂, which catalyzes release of arachidonic acid from membrane phospholipids; (2) conversion of arachidonic acid into prostaglandin H₂ by cyclooxygenases (COX-1 and COX-2); and (3) conversion of prostaglandin H₂ into PGI₂ by PGIS.¹¹ These enzymes are colocalized and functionally coupled.^12,13 COX-1 and PGIS undergo autoinactivation during catalysis, thereby limiting the extent of PGI₂ synthesis.^14–16 Limitation of PGI₂ production is circumvented by Ad-COPI–induced cooverexpression of COX-1 and PGIS, which selectively augments PGI₂ production without a concurrent increase in the production of other eicosanoids.¹⁰ Thus, Ad-COPI is well suited for evaluating the effect of authentic PGI₂ on EC survival. The results show that Ad-COPI suppressed annexin V–positive cells and caspase 3 activation. cPGI₂ protected HUVECs from apoptosis in a concentration-dependent manner. Furthermore, L-165041, a selective PPAR ligand, suppressed H₂O₂-induced apoptosis, suggesting the involvement of PPAR. HUVECs expressed functional PPAR. Overexpression of PPAR by Ad-PPAR enhanced whereas knockdown of PPAR with small interfering RNA (siRNA) abrogated the antiapoptotic action of cPGI₂ and L-165041. Our results reveal for the first time that PGI₂ upregulated 14-3-3, especially 14-3-3, in a PPAR-dependent manner. cPGI₂ induced binding of PPAR to PPAR response elements (PPREs), thereby activating 14-3-3 promoter activity. 14-3-3 is a member of 14-3-3 family, which binds phosphorylated Bad and sequesters Bad in the cytosol.^17–20 Our results show that 14-3-3 upregulation amplified Bad binding and reduced Bad translocation to mitochondria, whereby it inhibited cytochrome c release, caspase 3 activation, and EC apoptosis.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Recombinant Adenoviral Vectors
Ad-COPI vectors were generated by homologous recombination and amplified in 293 cells as described previously.¹⁰ An empty adenovirus (Ad-null) or Ad-GFP was used as a control. Ad-PPAR was kindly provided by Drs Kinzler and Vogelstein at Johns Hopkins University, Baltimore, Md. The recombinant viruses were purified by CsCl density-gradient centrifugation, and the virus titers were determined by a plaque assay as described previously.¹⁰

Cell Culture and Treatment
HUVECs were prepared from freshly obtained umbilical veins and cultured as described previously.²¹ In initial experiments, HUVECs (at passage 3 or 4) grown in a 6-well plate were treated with various concentrations of H₂O₂ for various periods of time, and apoptosis was determined. We found treatment of HUVECs with 0.5 mmol/L H₂O₂ for 4 hours to be optimal. To evaluate the effects of cPGI₂ and L-165041 on apoptosis, HUVECs were pretreated with either compound for 4 hours before treatment with H₂O₂ in serum-free medium for 4 hours. Based on our previous experimental results,¹⁰ we infected HUVECs with recombinant adenoviruses for 48 hours. ECV304 cells were maintained in DMEM containing 10% FBS. For induction of ECV304 apoptosis, cells were treated with 2 mmol/L H₂O₂ for 8 hours.

Assay of Apoptosis
Apoptosis was analyzed by flow cytometry using annexin V staining. Cells were washed with PBS and incubated with a fluorescein isothiocyanate–labeled annexin V antibody (Beckman Coulter). The labeled cells were analyzed by flow cytometry (Beckman Coulter Epics XL). Apoptosis was also analyzed by incubating cells with 1 µg/mL Hoechst 33258 for 15 minutes and counting positively stained cells by fluorescent microscopy. Caspase-3 activity was assayed by flow cytometry using a caspase-3 assay kit (Calbiochem). Cytochrome c release was analyzed using immunofluorescent microscopy by a method described previously.²² The images were processed by Adobe Photoshop software. In all the assays, the results were expressed as percentages of positively stained cells.

Plasmid Constructs and Luciferase Reporter Assay
To construct human 14-3-3 vector, the complete coding sequence of 14-3-3 was amplified by polymerase chain reaction (PCR) and cloned into pCDNA3.1+ vector (Invitrogen). siRNA of PPAR (sense sequence: ACAGATGAAGACAGATGCACC) was purchased from Applied Biosystems. To achieve high transfection efficiency, the endothelial-like ECV304 cells were transfected with 14-3-3 vector or siRNA-PPAR by Effectene transfection kit (Quiagene). For cloning 14-3-3 promoter, a 1.6-kb (–1625 to +24) 5'-flanking region of human genomic sequence was amplified by PCR and cloned into pGL3 luciferase reporter. 5'-deletion constructs (–1348 to +24, –787 to +24, –412 to +24 and –47 to +24) were amplified by PCR and subcloned to pGL3 vector. PPAR-specific response element reporter⁷ was kindly provided by Drs Kinzler and Vogelstein. For the luciferase assay, ECV304 cells were transfected with reporter constructs by Fugene 6 transfection reagent (Roche) for 48 hours. After treatment with cPGI₂ or other compounds, cells were lysed, luciferase activity was measured using a kit from Promega, and the emitted light was determined in a luminometer. Protein concentrations of cell lysates were determined by a protein assay kit (Bio-Rad). Luciferase activity was expressed as relative light unit/µg protein.

Preparation of Mitochondrial Fraction
Mitochondrial fractions were prepared by a mitochondria isolation kit (Sigma) as described previously.²² Nuclear and cytosolic fractions were removed by 2-step gradient centrifugation, and the pellet-containing mitochondria was collected and stored at –20°C. heat shock protein 60 (Hsp60) was used as a mitochondrial marker.

Immunoprecipitation
cPGI₂- or L-165041–treated HUVECs were harvested and immunoprecipitated with a 14-3-3 antibody. The immunoprecipitated complex was pulled down with protein A/G-agarose (Santa Cruz Biotechnology). After washing 5x, the proteins were analyzed by Western blotting using a Bad antibody.

Western Blot Analysis
A total of 25 µg of cell lysate proteins were applied to each lane and analyzed by Western blots as described previously.²¹ Rabbit polyclonal antibodies against 14-3-3 isoforms (, , , and , diluted at 1:250 each) goat polyclonal antibodies against COX-1 (1:1000), and Hsp60 (1:2000) 14-3-3 isoforms (, , and ß; diluted at 1:500 each) were purchased from Santa Cruz Biotechnology. Rabbit polyclonal antibody against PPAR (1:500) was obtained from Cayman Chemical. Rabbit polyclonal antibodies against cleaved poly(ADP-ribose)polymerase (PARP) (1:500) and Bad (1:500) were purchased from Cell Signaling. Rabbit polyclonal antibody against PGIS was prepared as described previously.²³

Chromatin Immunoprecipitation
The assay was done as described previously.²⁴ The primers for amplifying PPRE-containing region are: 5' primer: ^–1625CCAAGC-GCCAGAAGCTG AAG^–1606, and 3' primer: ^–1348GAGACAGAGTTGTGCTCTTG^–1329 and non-PPRE region are: 5' primer ^–412CGTTACAGCCTCCGTCGTTC^–393, and 3' primer ⁺⁴GATGATCGAGAGGATCTGGTG⁺²⁴. The resulting products of 297 bp and 436 bp, respectively, were separated by agarose gel electrophoresis. Putative PPAR–retinoid X receptor (RXR) binding sites with typical AGGTCA-X-AGGTCA motif (X denotes any nucleotide) on 14-3-3 promoter region were analyzed with P-Match 1.0 software (gene-regulation biological databases).

Statistical Analysis
ANOVA software was used to determine statistical differences of apoptosis, caspase 3 activity, and luciferase activity between groups. A P value <0.05 is considered to be statistically significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
PGI₂ Inhibited HUVEC Apoptosis Via PPAR Activation
To evaluate the effect of PGI₂ on apoptosis, we transduced HUVECs with Ad-COPI for 48 hours, which increased equivalently COX-1 and PGIS protein levels and selectively augmented PGI₂ synthesis without an increase in other eicosanoids as reported previously (supplemental Figure I, available online at http://atvb.ahajournals.org). Ad-COPI suppressed H₂O₂-induced HUVEC apoptosis (Figure 1A) and caspase 3 activation (supplemental Figure IIA). cPGI₂ reduced annexin V–positive cells induced by H₂O₂ in a concentration-dependent manner (Figure 1B), whereas PGE₂ at 50 µmol/L did not have an effect (data not shown). cPGI₂ suppressed caspase 3 activation (supplemental Figure IIB). L-165041 also suppressed H₂O₂-induced annexin V cells (Figure 1C), suggesting the involvement of PPAR. Because little was known about the function of endothelial PPAR, we determined the expression of PPAR proteins in HUVECs by Western blotting. Basal PPAR was detected, which was increased by cPGI₂ or L-165041 (supplemental Figure IIIA). The PPAR proteins in ECs are functionally active because a luciferase reporter containing PPREs was activated by cPGI₂ in a concentration-dependent manner (Figure 2A). L-165041 induced PPRE reporter expression in a concentration-dependent manner identical to cPGI₂ (data not shown).

View larger version (20K): [in this window] [in a new window]   Figure 1. Prevention of HUVEC apoptosis. HUVECs were transduced with Ad-COPI or Ad-null (50 mois) for 48 hours (A), treated with cPGI2 (1 to 100 µmol/L; B), or L-165041 (50 µmol/L; C) for 4 hours, followed by H2O2 (0.5 mmol/L) for 4 hours. Annexin V–positive cells were analyzed by flow cytometry. Results are expressed as percentages of cells with positive stains. Each bar represents mean±SD (n=3). P values were determined by ANOVA program.

View larger version (30K): [in this window] [in a new window]   Figure 2. Functional PPAR in ECs. ECV304 cells were transfected with PPRE reporter and treated with cPGI2 (0 to 50 µmol/L; A), Ad vectors (50 moi each; B), or siRNA vectors (C) as indicated. Luciferase expression by PPRE reporter was measured and expressed as relative light unit (RLU)/µg protein. Each bar represents mean±SD (n=3).

To determine the role of PPAR in regulating the antiapoptotic activity of PGI₂, we transduced HUVECs with Ad-PPAR, which, as expected, increased PPAR protein levels (data not shown). Coinfection of HUVECs with Ad-PPAR and Ad-COPI augmented the PPRE reporter response by 4-fold over that infected with Ad-GFP (Figure 2B). Conversely, PPAR knockdown with siRNA abrogated the PPRE reporter activity induced by cPGI₂ or L-165041 (Figure 2C). Ad-PPAR reduced H₂O₂-induced Hoechst-positive cells (Figure 3A), and caspase 3 activation (supplemental Figure IIC) to a similar extent, and knockdown of PPAR expression abrogated the antiapoptotic action of cPGI₂ and L-165041 (Figure 3B). Together, these results suggest an essential role of PPAR activation in PGI₂-mediated antiapoptotic action.

View larger version (13K): [in this window] [in a new window]   Figure 3. Regulation of HUVEC apoptosis by PPAR. A, HUVECs transduced with the indicated Ad vector were treated with H2O2 for 4 hours. Percentages of Hoechst-positive cells were determined by microscopy. Each bar represents mean±SD (n=3). B, ECV304 cells transfected with siRNA or control were treated with cPGI2 or L-165041 (10 µmol/L each) for 4 hours, followed by H2O2 for 4 hours. PARP cleavage was determined by Western blotting. This figure is representative of 2 experiments.

Upregulation of 14-3-3 Proteins by PPAR Activation
We hypothesized that PPAR suppresses apoptosis by upregulating a survival factor in ECs. We screened a number of factors and identified 14-3-3 as a potential target. HUVECs expressed predominantly 14-3-3, , , and isoforms (Figure 4A). 14-3-3 ß, , and proteins were barely detectable (Figure 4A). 14-3-3 was increased by cPGI₂ and L-165041 to a similar extent (>3-fold). 14-3-3 and 14-3-3 were increased by a lesser extent, whereas 14-3-3 was unaltered (Figure 4A). We focused on 14-3-3 in our subsequent experiments. Ad-PPAR increased 14-3-3 by &2-fold and augmented the effect of cPGI₂ or L-165041 by an additional 2-fold (Figure 4B). PPAR siRNA abrogated 14-3-3 protein levels induced by cPGI₂ or L-165041 (Figure 4C). The control siRNA vector had no effect. Together, these results indicate that 14-3-3 expression is regulated by PPAR activation.

View larger version (15K): [in this window] [in a new window]   Figure 4. Upregulation of 14-3-3 by cPGI2 and L-165041. A, HUVECs were treated with cPGI2 (50 µmol/L) or L-165041 (50 µmol/L) for 4 hours and transduced with the indicated Ad and treated with cPGI2 or L-165041 (B). C, ECV304 cells transfected with siRNA were treated with cPGI2 or L-165041. 14-3-3 proteins were analyzed by Western blots. For B and C, the top shows a representative blot and the bottom, densitometry (n=3).

Requirement of PPREs for PGI₂-Induced 14-3-3 Transcriptional Activation
To determine whether PGI₂ stimulates 14-3-3 expression via PPAR-mediated transcriptional activation, we transfected ECs with the 1.6-kb (–1625 to +24) 14-3-3 promoter vector. cPGI₂ and L-165041 increased the luciferase activity by &2-fold over the control (supplemental Figure IIIB), which was abrogated by specific PPAR siRNA (Figure 5A). Analysis of this promoter region with P-Match 1.0 revealed 3 contiguous canonical PPREs located at –1426/–1438, –1444/–1456, and –1465/–1477. To determine whether they are required for 14-3-3 promoter activity, we constructed several 5'-deletion mutants into pGL3 expression vector and transfected them into ECV304. Ad-COPI increased the wild-type (p1625) promoter activity, which was enhanced by Ad-PPAR (Figure 5B). Deletion of the PPRE-containing region such as in the p1348 mutant abolished the response to Ad-COPI and Ad-PPAR. Shorter 5'-deletion mutants (ie, p787 and p412) failed to respond to Ad-COPI or Ad-PPAR but retained the basal promoter activity. Basal promoter activity was completely abolished in the p47 mutant (Figure 5B). To ascertain PPAR binding to 14-3-3 promoter, we performed chromatin immunoprecipitation with a PPAR-specific antibody. There was little basal PPAR binding to 14-3-3, and its binding was enhanced by cPGI₂ and L-165041 to a similar extent (Figure 5C). As controls, PPAR binding was not detected with nonimmune IgG or with a DNA sequence located at the proximal region of the 14-3-3 promoter (Figure 5C).

View larger version (30K): [in this window] [in a new window]   Figure 5. PPAR-dependent activation of 14-3-3 promoter activity. A, ECV304 cells were transfected with 1.6-kb promoter construct with or without PPAR-siRNA, followed by cPGI2 or L-165041. B, ECV304 cells transduced with the indicated Ad vector were transfected with wild-type or 5'-deletion mutants shown at the top. Each bar represents mean±SD (n=3); **P<0.01. C, Chromatin immunoprecipitation analysis of PPAR binding to 14-3-3 promoter. Binding was detected at –1625/–1328, which harbors PPREs but not at control –412/+24.

14-3-3 Protected ECs From Apoptosis
Because 14-3-3 binds and sequesters Bad¹⁹ and cPGI₂ and L-165041 increase 14-3-3 protein levels, we determined whether 14-3-3 upregulation amplified Bad binding. ECs were treated with cPGI₂, L-165041, or vehicle, and the cell lysate was immunoprecipitated with a 14-3-3 antibody. Bad proteins in the precipitate were analyzed by Western blots. Both cPGI₂ and L-165041 increased Bad binding to 14-3-3 (Figure 6A). In view of increased binding by 14-3-3, we anticipated that cPGI₂ and L-165041 suppress Bad translocation to mitochondria. To test this, we prepared mitochondrial fractions from ECs treated with and without H₂O₂, cPGI₂, or L-165041. Hsp60 was included as a mitochondrial marker. The results show that H₂O₂ increased Bad in the mitochondrial fraction consistent with Bad translocation (Figure 6B). Pretreatment of cells with cPGI₂ or L-165041 blocked H₂O₂-induced Bad translocation to mitochondria (Figure 6B). H₂O₂-induced Bad mitochondrial translocation resulted in increased cytochrome c release into cytosol, which was suppressed by cPGI₂ (supplemental Figure IV). The role of 14-3-3 in regulating Bad-mediated apoptosis was further supported by 14-3-3 overexpression. Transfection of cells with 14-3-3 vector reduced H₂O₂-induced PARP cleavage to the basal level (Figure 6C). 14-3-3 overexpression also suppressed the basal PARP cleavage.

View larger version (27K): [in this window] [in a new window]   Figure 6. Role of 14-3-3 in antiapoptosis. A, HUVECs were treated with cPGI2 or L-165041 for 4 hours. Cell lysates were immunoprecipitated with 14-3-3 antibody, and Bad in immunoprecipitation was analyzed. B, HUVECs were treated as indicated, and Bad and Hsp60 in mitochondrial fraction was analyzed. C, ECV304 cells transfected with the indicated vectors were treated with H2O2. Cleaved PARP was analyzed by Western blots. D, Schematic illustration of the protective mechanism of PGI2 via PPAR-dependent 14-3-3 upregulation.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
Results from this study provide strong evidence for EC protection by PGI₂. Authentic PGI₂ generated by Ad-COPI transduction and the synthetic cPGI₂ protected HUVECs and ECV304 cells from H₂O₂-induced apoptosis in a PPAR-dependent manner. Several pieces of evidence support the requirement of PPAR activation for the antiapoptotic action of PGI₂. First, HUVECs expressed functional PPAR, which prevented H₂O₂-induced apoptosis. Second, PPAR suppression by siRNA abrogated the protective action of PGI₂ or L-165041. Third, overexpression of PPAR amplified the antiapoptotic action of PGI₂. It was reported that PPAR protected keratinocytes from apoptosis by upregulating the expression of phosphoinositide-dependent kinase (PDK) and activation of Akt.²⁵ In this study, we evaluated the effect of PGI₂ and L-165041 on PDK-1 and Akt in HUVECs and did not detect changes in PDK-1 protein level or phosphorylated Akt (data not shown). In contrast, our results identified 14-3-3 as the PPAR-driven antiapoptotic gene. Ad-COPI, cPGI₂, and L-165041 increased 14-3-3 protein expression, which was abrogated by PPAR siRNA and enhanced by Ad-PPAR. Importantly, our results provide direct evidence for the first time for transcriptional activation of 14-3-3 by PPAR. These results demonstrate the requirement of PPREs for PGI₂-induced 14-3-3 promoter activation because deletion of the PPRE-containing region of 14-3-3 promoter nullified the promoter response to Ad-COPI, Ad-PPAR, or their combination. Activated PPAR forms a heterodimer with RXR and the heterodimer binds to PPREs, which comprise 2 identical hexamers with a single nucleotide in between via which transcription is activated.²⁶ The 5'-flanking promoter region of 14-3-3 harbors 3 canonical PPREs that are located contiguously between –1426 and –1477. Deletion of these PPREs results in loss of promoter response to cPGI₂ or L-165041. Our data show that cPGI₂ and L-165041 induced binding of PPAR specifically to this promoter region in vivo. Together, the results indicate that 14-3-3 is a direct target of PPAR, and its transcriptional activation depends on PPAR activation.

Seven isoforms of 14-3-3 proteins have been identified in mammalian cells. They share sequence homology and biochemical properties.¹⁷ Because 14-3-3 expression in ECs has not been reported, we analyzed their protein levels in HUVECs. Results show that basal 14-3-3 and 14-3-3 were detected at a higher density than other isoforms, and basal 14-3-3ß, , and were barely detectable. Because the affinity of antibodies for each isoform may vary, the isoform abundance cannot be accurately determined, and the data should be interpreted with caution. However, response to stimulation by PPAR activation is clearly isoform specific. 14-3-3, and to a lesser extent 14-3-3, proteins are significantly upregulated by cPGI₂ or L-165041. 14-3-3 are cytosolic proteins serving as a scaffold to interact with a large number of proteins.²⁷ They play a role in protecting cells from apoptosis through their binding and sequestering phosphorylated Bad in cytosol.¹⁹ Under apoptotic stimulation, Bad is dissociated from 14-3-3 and translocated to mitochondria, where it interacts with Bcl-XL and disrupts the protective function of Bcl-XL, resulting in outer membrane permeabilization, release of cytochrome c, and activation of caspase 9 and 3.²⁸ Our results confirm that H₂O₂ induces Bad translocation to mitochondria in HUVECs, suggesting that the basal 14-3-3 protein levels were inadequate for preventing Bad translocation. Because cPGI₂ and L-165041 increase 14-3-3 and augment 14-3-3 binding of Bad, their prevention of Bad translocation is attributed to elevated 14-3-3. These findings reveal for the first time that constitutively expressed 14-3-3 is transcriptionally regulated by PPAR, and its upregulation confers resistance to the H₂O₂-induced apoptosis. Together, our findings shed light on a novel mechanism by which PGI₂ protects ECs from apoptosis. As illustrated in Figure 6D, we propose that PGI₂ binds and activates PPAR, which forms a heterodimer with RXR and binds to specific PPREs on 14-3-3 promoter. PPAR-mediated 14-3-3 upregulation increases the capacity of 14-3-3 to bind and sequester Bad, thereby reducing Bad translocation to mitochondria and the consequent caspase 3 activation and apoptosis. It is important to note that this protective signaling pathway is enforced by a positive feedback regulation. Our results show that cPGI₂ and L-165041 increased PPAR protein levels by &3-fold. To our knowledge, the positive feedback regulation of PPAR expression has not reported previously, and the mechanism by which this occurs is unclear. Nevertheless, feedback upregulation of PPAR by its ligands is important in amplifying the PPAR14-3-3 protection program.

To demonstrate the antiapoptotic action of PGI₂, we transduced HUVECs with Ad-COPI, which selectively increased PGI₂ production. The results show a consistent inhibition of H₂O₂-induced annexin V–positive and Hoechst-positive cells and caspase 3 activation. cPGI₂ had a similar effect as Ad-COPI, except that high concentrations of cPGI₂ were required to inhibit H₂O₂-induced apoptosis. One intriguing question is whether the intracellularly produced PGI₂ by Ad-COPI acts directly on PPAR without secretion into the extracellular milieu. It has been shown that PPAR is distributed in cytosol and nucleus of ECs.²⁹ Because intracellular PGI₂ is produced at the perinuclear membrane, PGI₂ may bind cytosolic PPAR and facilitates its translocation or, alternatively, may enter nucleus, where it binds and activates PPAR. There is little published data on this issue, which requires further investigation. Ad-COPI gene transfer has been shown to protect neurons from ischemia-reperfusion injury in vivo,³⁰ which may be attributed to the antiapoptotic action of PGI₂. This gene transfer approach has potential for protecting blood vessels and treating vascular diseases.

	Acknowledgments

 
We thank Drs Vogelstein and Kinzler for providing Ad-PPAR and PPAR response element reporter, Dr Jaou-Chen Huang for statistic analysis, Shao-Tzu Tang and Hui-Ping Tseng for technical assistance, and Dr Song-Kun Shyue for performing high-performance liquid chromatography analysis.

Sources of Funding

This work was supported by National Institutes of Health grants R01-HL-50675 and P50-NS-23327.

Disclosures

None.

	Footnotes

 
Original received February 1, 2006; final version accepted April 7, 2006.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Moncada S, Vane JR. Pharmacology and endogenous roles of prostaglandin endoperoxides, thromboxane A2, and prostacyclin. Pharmacol Rev. 1978; 30: 293–331.[Medline] [Order article via Infotrieve]
2. Adderley SR, Fitzgerald DJ. Oxidative damage of cardiomyocytes is limited by extracellular regulated kinases 1/2-mediated induction of cyclooxygenase-2. J Biol Chem. 1999; 274: 5038–5046.[Abstract/Free Full Text]
3. Cheng Y, Austin SC, Rocca B, Koller BH, Coffman TM, Grosser T, Lawson JA, FitzGerald GA. Role of prostacyclin in the cardiovascular response to thromboxane A2. Science. 2002; 296: 539–541.[Abstract/Free Full Text]
4. Hao CM, Komhoff M, Guan Y, Redha R, Breyer MD. Selective targeting of cyclooxygenase-2 reveals its role in renal medullary interstitial cell survival. Am J Physiol. 1999; 277: F352–F359.
5. Narumiya S, Sugimoto Y, Ushikubi F. Prostanoid receptors: structures, properties, and functions. Physiol Rev. 1999; 79: 1193–1226.[Abstract/Free Full Text]
6. Forman BM, Chen J, Evans RM. Hypolipidemic drugs, polyunsaturated fatty acids, and eicosanoids are ligands for peroxisome proliferator-activated receptors alpha and delta. Proc Natl Acad Sci U S A. 1997; 94: 4312–4317.[Abstract/Free Full Text]
7. He TC, Chan TA, Vogelstein B, Kinzler KW. PPAR is an APC-regulated target of nonsteroidal anti-inflammatory drugs. Cell. 1999; 99: 335–345.[CrossRef][Medline] [Order article via Infotrieve]
8. Tan NS, Michalik L, Noy N, Yasmin R, Pacot C, Heim M, Fluhmann B, Desvergne B, Wahli W. Critical roles of PPAR beta/delta in keratinocyte response to inflammation. Genes Dev. 2001; 15: 3263–3277.[Abstract/Free Full Text]
9. Hao CM, Redha R, Morrow J, Breyer MD. Peroxisome proliferator-activated receptor activation promotes cell survival following hypertonic stress. J Biol Chem. 2002; 277: 21341–21345.[Abstract/Free Full Text]
10. Shyue SK, Tsai MJ, Liou JY, Willerson JT, Wu KK. Selective augmentation of prostacyclin production by combined prostacyclin synthase and cyclooxygenase-1 gene transfer. Circulation. 2001; 103: 2090–2095.[Abstract/Free Full Text]
11. Wu KK. Inducible cyclooxygenase and nitric oxide synthase. Adv Pharmacol. 1995; 33: 179–207.
12. Liou JY, Shyue SK, Tsai MJ, Chung CL, Chu KY, Wu KK. Colocalization of prostacyclin synthase with prostaglandin H synthase-1 (PGHS-1) but not phorbol ester-induced PGHS-2 in cultured endothelial cells. J Biol Chem. 2000; 275: 15314–15320.[Abstract/Free Full Text]
13. Schievella AR, Regier MK, Smith WL, Lin LL. Calcium-mediated translocation of cytosolic phospholipase A2 to the nuclear envelope and endoplasmic reticulum. J Biol Chem. 1995; 270: 30749–30754.[Abstract/Free Full Text]
14. Sanduja SK, Tsai AL, Matijevic-Aleksic N, Wu KK. Kinetics of prostacyclin synthesis in PGHS-1-overexpressed endothelial cells. Am J Physiol. 1994; 267: C1459–C1466.
15. Ham EA, Egan RW, Soderman DD, Gale PH, Kuehl FA Jr. Peroxidase-dependent deactivation of prostacyclin synthetase. J Biol Chem. 1979; 254: 2191–2194.[Abstract/Free Full Text]
16. Egan RW, Paxton J, Kuehl FA Jr. Mechanism for irreversible self-deactivation of prostaglandin synthetase. J Biol Chem. 1976; 251: 7329–7335.[Abstract/Free Full Text]
17. Fu H, Subramanian RR, Masters SC. 14-3-3 proteins: structure, function, and regulation. Annu Rev Pharmacol Toxicol. 2000; 40: 617–647.[CrossRef][Medline] [Order article via Infotrieve]
18. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell. 1997; 91: 231–241.[CrossRef][Medline] [Order article via Infotrieve]
19. Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ. Serine phosphorylation of death agonist BAD in response to survival factor results in binding to 14-3-3 not BCL-X(L). Cell. 1996; 87: 619–628.[CrossRef][Medline] [Order article via Infotrieve]
20. Zhou XM, Liu Y, Payne G, Lutz RJ, Chittenden T. Growth factors inactivate the cell death promoter BAD by phosphorylation of its BH3 domain on Ser155. J Biol Chem. 2000; 275: 25046–25051.[Abstract/Free Full Text]
21. Xu XM, Sansores-Garcia L, Chen XM, Matijevic-Aleksic N, Du M, Wu KK. Suppression of inducible cyclooxygenase-2 gene transcription by aspirin and sodium salicylate. Proc Natl Acad Sci U S A. 1999; 96: 5292–5297.[Abstract/Free Full Text]
22. Liou JY, Aleksic N, Chen SF, Han TJ, Shyue SK, Wu KK. Mitochondrial localization of cyclooxygenase-2 and calcium-independent phospholipase A₂ in human cancer cells: implication in apoptosis resistance. Exp Cell Res. 2005; 306: 75–84.[CrossRef][Medline] [Order article via Infotrieve]
23. Shyue SK, Ruan KH, Wang LH, Wu KK. Prostacyclin synthase active sites. Identification by molecular modeling-guided site-directed mutagenesis. J Biol Chem. 1997; 272: 3657–3662.[Abstract/Free Full Text]
24. Deng WG, Zhu Y, Wu KK. Role of p300 and PCAF in regulating cyclooxygenase-2 promoter activation by inflammatory mediators. Blood. 2004; 103: 2135–2142.[Abstract/Free Full Text]
25. Di-Poï N, Tan NS, Michalik L, Wahli W, Desvergne B. Antiapoptotic role of PPARß in keratinocytes via transcriptional control of the Akt1 signaling pathway. Mol Cell. 2002; 10: 721–733.[CrossRef][Medline] [Order article via Infotrieve]
26. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, Umesono K, Evans RM. Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci U S A. 1994; 91: 7355–7359.[Abstract/Free Full Text]
27. Tzivion G, Avruch J. 14-3-3 proteins: active cofactors in cellular regulation by serine/threonine phosphorylation. J Biol Chem. 2002; 277: 3061–3064.[Free Full Text]
28. Zha J, Harada H, Osipov K, Jockel J, Waksman G, Korsmeyer SJ. BH3 domain of BAD is required for heterodimerization with BCL-XL and pro-apoptotic activity. J Biol Chem. 1997; 272: 24101–24104.[Abstract/Free Full Text]
29. Bishop-Bailey D, Hla T. Endothelial cell apoptosis induced by the peroxisome proliferator-activated receptor (PPAR) ligand 15-deoxy-Delta12, 14-prostaglandin J2. J Biol Chem. 1999; 274: 17042–17048.[Abstract/Free Full Text]
30. Lin H, Lin TN, Cheung WM, Nian GM, Tseng PH, Chen SF, Chen JJ, Shyue SK, Liou JY, Wu CW, Wu KK. Cyclooxygenase-1 and bicistronic cyclooxygenase-1/prostacyclin synthase gene transfer protect against ischemic cerebral infarction. Circulation. 2002; 105: 1962–1969.[Abstract/Free Full Text]

This article has been cited by other articles:

				T. He, T. Lu, L. V. d'Uscio, C.-F. Lam, H.-C. Lee, and Z. S. Katusic Angiogenic Function of Prostacyclin Biosynthesis in Human Endothelial Progenitor Cells Circ. Res., July 3, 2008; 103(1): 80 - 88. [Abstract] [Full Text] [PDF]

				P. Zania, M. Papaconstantinou, C. S. Flordellis, M. E. Maragoudakis, and N. E. Tsopanoglou Thrombin mediates mitogenesis and survival of human endothelial cells through distinct mechanisms Am J Physiol Cell Physiol, May 1, 2008; 294(5): C1215 - C1226. [Abstract] [Full Text] [PDF]

				Y. Fan, Y. Wang, Z. Tang, H. Zhang, X. Qin, Y. Zhu, Y. Guan, X. Wang, B. Staels, S. Chien, et al. Suppression of Pro-inflammatory Adhesion Molecules by PPAR-{delta} in Human Vascular Endothelial Cells Arterioscler. Thromb. Vasc. Biol., February 1, 2008; 28(2): 315 - 321. [Abstract] [Full Text] [PDF]

				J.-C. Huang, W.-S. A. Wun, J. S. Goldsby, K. Egan, G. A. FitzGerald, and K. K. Wu Prostacyclin receptor signaling and early embryo development in the mouse Hum. Reprod., November 1, 2007; 22(11): 2851 - 2856. [Abstract] [Full Text] [PDF]

				J.-Y. Liou, D. P. Ellent, S. Lee, J. Goldsby, B.-S. Ko, N. Matijevic, J.-C. Huang, and K. K. Wu Cyclooxygenase-2-Derived Prostaglandin E2 Protects Mouse Embryonic Stem Cells from Apoptosis Stem Cells, May 1, 2007; 25(5): 1096 - 1103. [Abstract] [Full Text] [PDF]

				J.-Y. Liou, D. Ghelani, S. Yeh, and K. K. Wu Nonsteroidal Anti-inflammatory Drugs Induce Colorectal Cancer Cell Apoptosis by Suppressing 14-3-3{varepsilon} Cancer Res., April 1, 2007; 67(7): 3185 - 3191. [Abstract] [Full Text] [PDF]

				L. Brunelli, K. A. Cieslik, J. L. Alcorn, M. Vatta, and A. Baldini Peroxisome Proliferator-Activated Receptor-{delta} Upregulates 14-3-3{epsilon} in Human Endothelial Cells via CCAAT/Enhancer Binding Protein-{beta} Circ. Res., March 16, 2007; 100(5): e59 - e71. [Abstract] [Full Text] [PDF]

				J.-C. Huang, W.-S.A. Wun, J.S. Goldsby, I.C. Wun, D. Noorhasan, and K.K. Wu Stimulation of embryo hatching and implantation by prostacyclin and peroxisome proliferator-activated receptor {delta} activation: implication in IVF Hum. Reprod., March 1, 2007; 22(3): 807 - 814. [Abstract] [Full Text] [PDF]

				A. Iwashita, Y. Muramatsu, T. Yamazaki, M. Muramoto, Y. Kita, S. Yamazaki, K. Mihara, A. Moriguchi, and N. Matsuoka Neuroprotective Efficacy of the Peroxisome Proliferator-Activated Receptor {delta}-Selective Agonists in Vitro and in Vivo J. Pharmacol. Exp. Ther., March 1, 2007; 320(3): 1087 - 1096. [Abstract] [Full Text] [PDF]

				J. D. Brown and J. Plutzky Peroxisome Proliferator Activated Receptors as Transcriptional Nodal Points and Therapeutic Targets Circulation, January 30, 2007; 115(4): 518 - 533. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: 26/7/1481    most recent 01.ATV.0000223875.14120.93v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Liou, J.-Y. Articles by Wu, K. K. Search for Related Content PubMed PubMed Citation Articles by Liou, J.-Y.