This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: 26/5/1022    most recent 01.ATV.0000210278.67076.8fv1 Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Walcher, D. Articles by Marx, N. Search for Related Content PubMed PubMed Citation Articles by Walcher, D. Articles by Marx, N. Pubmed/NCBI databases Compound via MeSH Substance via MeSH

(Arteriosclerosis, Thrombosis, and Vascular Biology. 2006;26:1022.)
© 2006 American Heart Association, Inc.

Vascular Biology

LXR Activation Reduces Proinflammatory Cytokine Expression in Human CD4-Positive Lymphocytes

Daniel Walcher; Andreas Kümmel; Bettina Kehrle; Helga Bach; Miriam Grüb; Renate Durst; Vinzenz Hombach; Nikolaus Marx

From the Department of Internal Medicine II, Cardiology, University of Ulm, Germany.

Correspondence to Nikolaus Marx, MD, Department of Internal Medicine II–Cardiology, University of Ulm, Robert-Koch-Str. 8, D-89081 Ulm, Germany. E-mail nikolaus.marx{at}medizin.uni-ulm.de

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Background— CD4-positive lymphocytes, the major T-cell population in human atheroma, mainly secrete Th-1-type proinflammatory cytokines, like interferon (IFN), tumor necrosis factor (TNF), and interleukin (IL)-2, thus promoting atherogenesis. Recent data suggest that the nuclear transcription factors liver X receptor-alpha and liver X receptor-beta (LXR and LXRß) limit plaque formation in animal models by modulating macrophage function. Still, the role of LXRs in CD4-positive lymphocytes is currently unexplored.

Methods and Results— Human CD4-positive lymphocytes express LXR and LXRß mRNA and protein. Activation of CD4-positive cells by anti-CD3 mAbs, anti-CD3/CD28 mAbs, as well as PMA/ionomycin significantly increased Th1-cytokine mRNA and protein expression. Treatment with the LXR activator T0901317 reduced this increase of IFN, TNF, and IL-2 in a concentration-dependent manner with a maximum at 1 µmol/L T0901317. Transient transfection assays revealed an inhibition of IFN promoter activity by T0901317 as the underlying molecular mechanism. Such anti-inflammatory actions were also evident in cell–cell interactions with medium conditioned by T0901317-treated CD4-positive cells attenuating human monocyte CD64 expression.

Conclusions— Human CD4-positive lymphocytes express both LXR and LXRß, and LXR activation can reduce Th-1 cytokine expression in these cells. These data provide new insight how LXR activators might modulate the inflammatory process in atherogenesis and as such influence lesion development.

The present study demonstrates both LXR and LXRß expression in human CD4-positive lymphocytes, as well as reduced Th-1 cytokine expression by LXR activation in these cells. These data provide new insight how LXR activators might modulate the inflammatory process in atherogenesis and as such influence lesion development.

Key Words: atherosclerosis • IFN • LXR • T-lymphocytes

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
CD4-positive lymphocytes play a critical role in early atherogenesis.¹ During endothelial dysfunction, these cells are attracted by chemokines released from endothelial cells (ECs) and cells in the subendothelium and enter the vessel wall as naive Th0-cells. In the intima they encounter antigens like oxidized low-density lipoprotein (oxLDL) and subsequently mainly differentiate to Th1-cells, releasing pro-inflammatory cytokines, like interferon (IFN) and tumor necrosis factor (TNF).² These cytokines then orchestrate the inflammatory process during plaque development by activating ECs, monocyte/macrophages, and vascular smooth muscle cells (VSMCs).³ Moreover, interruption of the IFN signaling pathway reduces the extent of atherosclerotic lesions in apolipoprotein E (apoE)-deficient mice.⁴ Despite this large body of data implicating IFN in vascular disease, only few studies addressed modulatory pathways to limit Th1-cytokine release from human CD4-positive lymphocytes, eg, by activation of nuclear transcription factors like peroxisome proliferators-activated receptors (PPARs).⁵ However, the role of the recently described liver X receptors alpha and beta (LXR, LXRß), both belonging to the same group of nuclear transcription factors, remains unexplored in CD4-positive lymphocytes.

LXR and LXRß are ligand-activated transcription factors, consisting of a ligand-binding and a DNA-binding domain. On activation, LXRs build heterodimers with another nuclear receptor, the retinoic X receptor (RXR), and bind to specific DR4-type LXR response elements (LXREs) in the promoter region of their target genes, thus regulating their expression.⁶ LXRs are activated by sterol metabolites like 22(R)-and 24(S)-hydroxycholesterol, as well as 24(S), 25-epoxycholesterol. In addition, synthetic LXR agonists include T0901317 as well as GW3965. The 2 LXR subtypes share substantial sequence homology and seem to respond to the same ligands. However, their tissue distribution is different. LXR is mainly present in liver, intestine, adipose tissue, and macrophages, whereas LXRß is ubiquitously expressed.⁷ Originally, LXRs have been described as regulators of gene expression in lipid and cholesterol metabolism, but recent data suggest that activation of these receptors may modulate atherogenesis. As such, LXR agonists reduce lesion development in mouse models of arteriosclerosis at least in part by influencing gene expression in cholesterol absorption and reverse cholesterol transport.^8,9 Moreover, LXRs have been shown to exhibit anti-inflammatory effects by limiting the expression of pro-inflammatory mediators, like IL-6, COX-2, and matrix metalloproteinase (MMP)-9.⁷ Because CD4-positive lymphocyte-derived cytokine release is critical for the inflammatory response in lesion development, we examined the expression and functional role of LXRs in CD4-positive T-cells with respect to their effect on Th1-cytokine expression.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Cell Culture
Human CD4-positive T cells were isolated from freshly drawn blood of healthy volunteers by Ficoll-Histopaque (Sigma) gradient centrifugation to obtain mononuclear cells (PBMCs) and subsequent negative selection of CD4-positive T cells by magnetic bead separation (Miltenyi Biotech) as described by the manufacturer’s protocol.⁵ The purity of CD4-positive T cells was >97% as determined by flow cytometry. Human monocytes were isolated as previously described.¹⁰

Reverse-Transcription Polymerase Chain Reaction
Please see http://atvb.ahajournals.org for details.

Preparation of Nuclear and Cytosolic Extracts and Western Blot Analysis
For Western blotting, nuclear and cytosolic extracts of 10⁷ cells were prepared as previously described.¹¹ Standard Western blot analysis on total cell lysates was performed using mouse anti-LXR and -ß antibodies (mAbs, Perseus Proteomics).

Stimulation Assays, Enzyme-Linked Immunosorbent Assays, and Cell Viability Studies
Human CD4-positive T cells (1x10⁶ cells/mL) were pretreated with the LXR activator T0901317 for 30 minutes (Alexis, dissolved in DMSO) and stimulated with anti-CD3 Abs for 48 hours (R&D Systems) or with a combined stimulation with anti-CD3 and anti-CD28 antibodies (Dynabeads) for 6 hours or with PMA (10 ng/mL)/ionomycin (0.5 µmol/L) for 6 hours, according to previously published time courses for these stimuli.¹² Cells were then harvested and IFN, TNF, IL-2, and IL-10 enzyme-linked immunosorbent assays (ELISA) (R&D Systems) were performed on cell-free supernatants as recommended by the manufacturer. In some experiments cells were stimulated with the LXR activator for 24 hours and the release of IL-10, a typical Th2-cytokine, was measured by ELISA (R&D Systems). Independent experiments were performed using cells from different donors. Cell viability was assessed by standard trypan blue exclusion.

KI67 Staining
Please see http://atvb.ahajournals.org for details.

Northern Blot Analysis
For Northern blot experiments, cells were treated with anti-CD3 Abs for 24 hours or anti-CD3/CD28 antibodies for 4 hours or with PMA/ionomycin for 4 hours in the presence or absence of T0901317. Five micrograms of total RNA were used in standard Northern blot analysis using cDNA probes against IFN, TNF, and IL-2, or against the house keeping gene GAPDH.

Transient Transfection Assays
To examine whether LXRs are functionally active in cells of the lymphocytic lineage, Jurkat cells were transiently transfected with a luciferase reporter construct containing 3 copies of a canonical LXRE and a pCMV-ß-galactosidase construct using superfect according to the manufacturer’s protocol. For IFN promoter studies, we cloned 2 deletion promoter reporter constructs. For polymerase chain reaction (PCR), the following oligonucleotides were used to amplify the whole promoter of the human IFN: sense 5'- CGCGGATCCGCTCTGATGAAGGACTTCCTCAC -3'; antisense 5'- GGGCTCGAGCCGTTTCCGAGAGAATTAAGCCA -3'. The resulting PCR fragment was cloned into the BamHI and XhoI sites of the pGL3 luciferase reporter plasmid to achieve: [p(624)IFN-LUC]. The proximal fragment of the IFN-promoter lacking portions of the 5'-sequence, but containing the 2 critical AP-1–CREB-ATF binding sites [distal (–96 to –75bp) and proximal (–66 to –47 bp) element] for PMA/ionomycin-induced promoter activity, we got as a kindly gift from Dr J. Plutzky (Boston, Mass) [p(108)IFN-LUC]. It was amplified by PCR with 2 BglII sites and cloned into the pGL3 luciferase reporter plasmid. Transfected cells were stimulated with PMA/ionomycin in the presence or absence of T0901317 (1 µmol/L) for 16 hours, before cells were harvested. Luciferase and ß-galactosidase activity was measured using the Dual-Light assay (Tropix, Bedford, Mass).

Flow Cytometry
Human CD4-positive T cells were incubated with an equal volume of PBS containing saturating concentrations (10 mg/L) of fluorescein isothiocyanate (FITC)-conjugated anti-CD3 antibodies and PE-conjugated anti-CD4 antibodies for 30 minutes at room temperature. To examine the influence of T0901317 on the pro-inflammatory activity of T-cell supernatants toward other vascular cells, freshly isolated human monocytes were incubated with supernatants (50% original monocyte media and 50% conditioned media from T cells) derived from T cells after CD3 activation in the absence or presence of the LXR agonist (Figure 5A, upper panel). In some experiments, cells were first treated with conditioned media from anti-CD3–activated T cells (Figure 5B, upper panel) and then T0901317 was directly added to monocytes at similar concentrations. After 18 hours, cells were harvested for the investigation of monocyte CD64 expression on the cell surface. After washing, monocytes were stained with FITC-conjugated anti-CD64 antibodies. Finally, T cells or monocytes were washed 3 times and stored in 1% paraformaldehyde (Sigma) at 4°C until flow cytometric analysis was performed within 24 hours. To examine that T0901317 is active in human monocytes, we stimulated cells with IFN in the presence or absence of T0901317 and assessed TNF protein content in cell-free supernatant.

View larger version (17K): [in this window] [in a new window]   Figure 5. LXR activation reduces pro-inflammatory activity of T-cell supernatants on human monocytes in the absence of any direct effects on monocyte CD64 response. A, Freshly isolated human monocytes were incubated for 18 hours with conditioned media (SN) from CD4-positive T cells stimulated with anti-CD3 mAbs in the presence or absence of the LXR agonist (1 µmol/L T0901317) and mean fluorescence intensity of monocyte CD64 expression was measured by flow cytometry (upper panel). Results are expressed as percent of control (monocytes incubated with supernatants from activated T cells). Bars represent mean±SEM (n=5). *P<0.05. B, Human monocytes were incubated with conditioned media from CD3-activated T cells to induce CD64 expression and then directly stimulated with the LXR agonist T0901317 for 18 hours before CD64 expression was assessed by flow cytometry (upper panel). Results are expressed as percent of control (monocytes incubated with supernatants from activated T cells). Bars represent mean±SEM (n=7); no significant difference was seen except as compared with unstimulated cells. *P<0.05. Insert, T0901317 is active in human monocytes. Human monocytes were stimulated with IFN in the presence or absence of T9001317 for 6 hours and monocyte TNF release measured was measured by ELISA. Bars represent mean±SEM (n=6). *P<0.05 compared with IFN-stimulated cells.

Statistical Analysis
Results of the experimental studies are reported as mean±standard error of the mean (SEM). Differences were analyzed by 1-way-ANOVA followed by the appropriate post-hoc test. A P<0.05 was regarded as significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Human CD4-Positive Lymphocytes Express LXR and LXRß mRNA and Protein
Isolated human CD4-positive lymphocytes express LXR and LXRß mRNA as determined by reverse-transcription (RT) PCR (Figure 1A). Western blot analysis revealed that both, LXR and LXRß protein are present in the nuclear fraction of isolated human CD4-positive T cells (Figure 1B), but not in the cytosol (data not shown). In addition, T-lymphocyte–like Jurkat cells also express LXR and LXRß mRNA and protein (Figure 1A and 1B).

View larger version (45K): [in this window] [in a new window]   Figure 1. CD4-positive human T cells express LXR and LXRß. A, RT-PCR reaction of LXR, LXRß, and GAPDH mRNA in isolated human CD4-positive T cells (CD4), as well as in lymphocyte- like Jurkat cells (Ju) reveals a cDNA fragment of the expected size. Also shown a DNA ladder (MW) and a negative control consisting of RT-PCR reactions lacking reverse-transcriptase (Co). B, Western blot analysis on nucleic fractions of human CD4-positive T cells and Jurkat cells using an anti-human LXR Ab or an anti-human LXRß Ab. C, LXRs are functionally active in cells of the lymphocytic lineage. Jurkat cells were transiently transfected with a promoter reporter construct containing 3 copies of a canonical LXRE. Transfected cells were stimulated with T0901317 for 16 hours before promoter activity was measured. Results of luciferase activity (LUC) were normalized to ß-galactosidase (ß-GAL). Bars represent mean±SEM. *P<0.05 compared with unstimulated cells; n=6.

To examine whether LXRs are functionally active in cells of the lymphocytic lineage, we transiently transfected Jurkat cells with a LUC reporter promoter construct containing 3 copies of a canonical LXRE. As shown in Figure 1C, the LXR activators T0901317 significantly induced reporter activity suggesting that LXRs are functionally active in these cells.

LXR Activation Inhibits IFN Expression in Human CD4-Positive T Cells
Unstimulated human CD4-positive T cells secreted only small amounts of IFN as determined by ELISA of cell-free supernatants, whereas incubation of cells with immobilized anti-CD3 Abs significantly increased IFN protein secretion from 2±3 to 466±222 pg/mL (P<0.05; n=13). Concomitant treatment with the LXR activator T0901317 inhibited this increase in a concentration-dependent manner with a maximal reduction to 40±18% at 1 µmol/L (P<0.05, compared with anti-CD3-activated cells, n=13). Similar data were obtained for TNF with a maximal reduction of anti-CD3-induced cytokine release to 51±14% at 1 µmol/L (P<0.05, compared with anti-CD3-activated cells, n=18; Figure 2A). Stimulation of cells with the LXR activator T0901317 did not affect cell viability (by trypan blue exclusion) or cell surface CD3 expression as determined by flow cytometry (Table I, available online at http://atvb.ahajournals.org).

View larger version (22K): [in this window] [in a new window]   Figure 2. The LXR activator T0901317 inhibits TH1 cytokine expression in human CD4-positive T cells. A, Isolated CD4-positive T cells were treated with anti-CD3 Abs in the absence or presence of T0901317 at concentrations indicated. After 48 hours cytokine protein content in cell-free supernatants was measured by ELISA. Results are expressed as percent of CD3-activated cells (% control). Bars represent mean±SEM (n=13 for IFN; n=18 for TNF). *P<0.05 compared with anti-CD3–activated cells. B, Isolated CD4-positive T cells were treated with anti-CD3- and anti-CD28- Abs in the absence or presence of T0901317 at concentrations indicated. After 6 hours cytokine protein content in cell-free supernatants was measured by ELISA. Results are expressed as percent of CD3/CD28-activated cells (% control). Bars represent mean±SEM (n=7). C, LXR activation inhibits PMA/ionomycin-induced IFN, TNF, and IL-2 protein expression. Isolated CD4-positive T cells were stimulated with PMA/ionomycin (10 ng/mL / 0.5 µmol/L) in the absence or presence of the LXR activator T0901317. After 6 hours, cytokine protein contents in cell-free supernatants were measured by ELISA. Results are expressed as percent of PMA/ionomycin-treated cells (% control). Bars represent mean±SEM (n=6 for IFN; n=10 for TNF and IL-2). *P<0.05 compared with PMA/ionomycin-treated cells. P<0.05 compared with anti-CD3/CD28–activated cells.

To examine whether LXR activation is capable of counteracting Th1-cytokine expression on treatment with a more potent stimulus, we performed similar experiments using a combined CD3/CD28 stimulation to induce cytokine release. As shown in Figure 2B, T0901317 decreased anti-CD3/CD28-induced IFN and TNF release in a concentration-dependent manner with a maximal reduction at 1 µmol/L to 74±2% and 79±2%, respectively (P<0.05 compared with anti-CD3/CD28-acitivated cells, n=7) (Figure 2B). Because this stronger stimulation of cell with anti-CD3/CD28 antibodies (in contrast to the stimulation with anti-CD3 alone¹³) also enhanced IL-2 protein secretion from 0 to 718±107 pg/mL, we next assessed the effect of LXR activation on this Th1-cytokine. Treatment of cells with T0901317 decreased IL-2 release in a concentration-dependent manner with a maximal reduction to 75±3% (P<0.05 compared with anti-CD3/CD28-acitivated cells, n=7) (Figure 2B).

To investigate whether LXR activator’s effect on CD4-positive lymphocyte-derived IFN expression depended on the stimulus used, we also used PMA/ionomycin to induce IFN release. PMA/ionomycin treatment of human CD4-positive T cells increased IFN protein content in the supernatant from 0 to 149±23 pg/mL. Treatment of cells with T0901317 reduced this IFN release to 46±10% at 1 µmol/L (P<0.05 compared with PMA/ionomycin-stimulated cells; n=6. Similar results were obtained for the release of TNF with a reduction to 59±5% and IL-2 with a reduction to 55±4% at 1 µmol/L T0901317 (P<0.05 compared with PMA/ionomycin-stimulated cells; n=10) (Figure 2C). Solvent alone (DMSO) did not have an effect on Th1-cytokine expression (data not shown). In addition, to exclude that differences in cell proliferation account for the changes in cytokine expression observed, we stimulated cells with anti-CD3 or anti-CD3/CD28 antibodies, or with PMA/ionomycin in the presence or absence of T0901317 and assessed cell proliferation by nuclear KI67 staining. Stimulation of cells with anti-CD3 or anti-CD3/CD28 antibodies markedly increased KI67 expression, whereas PMA/ionomycin treatment had only a moderate effect on KI67 positivity. Still, independent of the stimulus used, we did not find a significant effect of T0901317 on cell proliferation making it unlikely that differences in the number of Th1-cytokine secreting cells play a causal role in this context (please see Figure I, available online at http://atvb.ahajournals.org).

To examine the effect of LXR activation on the expression of counterbalancing Th2-cytokines, we stimulated CD4-positive lymphocytes with PMA/ionomycin and measured the release of IL-10, a typical TH2 cytokine. PMA/ionomycin induced IL-10 secretion from 0 to 241±43 pg/mL (P<0.01; n=4), but treatment of cells with T0901317 did not significantly alter the expression of this Th2-cytokine (214±45 pg/mL (p=not significant compared with PMA/ionomycin-stimulated cells; n=4). Moreover, T0901317 did not induce IL-10 expression, thus making it unlikely that LXR activation induces a Th-2 response in these cells (data not shown).

LXR Activation Reduces Cytokine mRNA Expression in Human CD4-Positive Lymphocytes
To examine whether the decrease in pro-inflammatory cytokine expression by the LXR activator resulted from reduced cytokine mRNA expression, we treated CD4-positive T cells with T0901317 and performed Northern blot analysis. As shown in Figure 3, T091323 significantly reduced anti-CD3–induced, anti-CD3/CD28–induced, as well as PMA/ionomycin-induced Th1-cytokine mRNA, but did not affect mRNA levels of the constitutively expressed gene GAPDH.

View larger version (45K): [in this window] [in a new window]   Figure 3. LXR activation inhibits pro-inflammatory cytokine mRNA expression in human CD4-positive cells. Representative Northern blot analysis for cytokine expression of human CD4-positive T cells treated with anti-CD3 antibodies for 24 hours (A) or anti-CD3 and anti-CD28 antibodies for 4 hours (B), or with PMA/ionomycin for 4 hours in the presence or absence of T0901317. D, Densitometric analysis of cytokine mRNA expression. Data are normalized to GAPDH and expressed as percent of control. Bars represent mean±SEM (n=5 for anti-CD3–stimulated cells; n=8 for anti-CD3/CD28–stimulated and PMA/ionomycin-stimulated cells. *P<0.05).

LXR Activation Reduces IFN Promoter Activity
Next, we sought to investigate whether the effect of T0901317 on IFN mRNA expression is caused by a reduction in IFN promoter activity. To this end, we performed transient transfection assays in Jurkat cells using 2 different IFN promoter reporter constructs. PMA/ionomycin stimulation of cells transfected with a 624 bp IFN promoter construct [p(624)IFN-LUC], previously shown to exhibit highest activity on stimulation,¹⁴ led to a 12.8±1.9-fold increase in normalized promoter activity (LUC/ß-GAL activity). Treatment with the LXR activator T0901317 significantly reduced this increase to 8.2±1.0-fold (P<0.05, compared with PMA/ionomycin-stimulated cells; n=3). Transfection studies with a 108 bp IFN promoter deletion construct, lacking portions of the 5'-sequence, but containing the 2 critical AP-1–CREB-ATF binding sites [distal (–96 to –75 bp) and proximal (–66 to –47 bp) element] for PMA/ionomycin-induced promoter activity,¹⁴ revealed a 4.1±0.6-fold increase in promoter activity on PMA/ionomycin stimulation. T0901317 treatment significantly reduced this increase to 2.7±0.3 (P<0.05 compared with PMA/ionomycin-stimulated cells; n=4), suggesting that the LXR activator may interact with these 2 sites (Figure 4). In the case of all constructs, T0901317 alone had no effect on promoter activity compared with control, consistent with the lack of a canonical LXRE in the IFN promoter.

View larger version (9K): [in this window] [in a new window]   Figure 4. LXR activation reduces IFN promoter activity. Jurkat cells were transiently cotransfected with the 2 different IFN constructs and a ß-galactosidase expression construct (pCMV/ß-GAL). Transfected cells were stimulated with agents indicated for 16 hours, and assays were performed for luciferase and ß-galactosidase activity. Results for each construct were normalized to ß-galactosidase activity and expressed as fold induction compared with unstimulated cells. Bars represent mean±SEM (n=3); *P<0.05 compared with PMA/ionomycin-stimulated cells.

T0901317 Reduces Pro-inflammatory Activity of CD4-Positive Lymphocytes on Human Monocytes
To examine potential functional effects of LXR-mediated reduced T-cell cytokine expression, we incubated supernatants from stimulated CD4-positive T cells with human monocytes and measured monocyte CD64 surface expression by flow cytometry. CD64 is the high-affinity receptor for IgG involved in phagocytosis and antigen capture, an IFN-regulated gene in human monocytes, and its expression on the cell surface indicates IFN activity on monocytes in vitro and in vivo.¹⁵ Incubation of freshly isolated human monocytes with supernatants from CD3-activated T cells significantly increased monocyte CD64 cell surface expression by 2-fold. Supernatants taken from activated CD4-positive T cells after T0901317 treatment significantly reduced this increase (Figure 5A), consistent with reduced cytokine content in the media (data not shown). To exclude that these findings resulted from direct effects of residual LXR agonist in T cell supernatants, we stimulated human monocytes with conditioned media from CD4-positive cells to induce CD64 expression and then added T0901317 directly to the cells. As shown in Figure 5B, T0901317 did not have a direct significant effect on monocyte CD64 expression. To demonstrate that T091317 was active in human monocytes, we stimulated cells with IFN in the presence or absence of T0901317 and measured monocytes TNF release. IFN induced TNF secretion from 78±35pg/mL to 480±187pg/mL (P<0.05; n=6) and T0901317 significantly reduced this increase to 71±9% (P<0.05 compared with IFN-stimulated cells, n=6) (Figure 5B, inset), suggesting that the LXR activator is active in the monocytes used.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The present study demonstrates the expression of LXR and LXRß in CD4-positive lymphocytes and shows that activation of LXRs by the synthetic agonist T0901317 reduces Th1-cytokine expression in these cells. These data suggest that LXRs, in addition to their modulatory action on macrophage function, may exhibit direct anti-inflammatory effects in CD4-positive lymphocytes, potentially contributing to the beneficial effects of LXR agonist on lesion development in animal models of arteriosclerosis.

Originally, LXRs have been described as regulators of cholesterol metabolism and reverse cholesterol transport, but recent data suggest that these receptors may directly influence the expression of pro-inflammatory mediators in macrophages.⁷ Our study extends the knowledge on LXRs by demonstrating their expression in CD4-positive lymphocytes, another cell type critically involved in the inflammatory processes during atherogenesis. We describe the expression of both LXR and LXRß in cells of the lymphocytic lineage and demonstrate that LXRs are functionally active in these cells, because T0901317 is capable of activating a canonical LXRE in transfected cells. Future studies have to examine the presence of LXRs in human atheroma.

The effect of T0901317 on Th-1 cytokine expression is most likely mediated by an activation of LXRs. T0901317 is a well-characterized, synthetic LXR activator with no established activity on other receptors or transcription factors and the concentrations used in our study have previously been shown to regulate typical LXR target genes, like ABCA-1.^16–18 Because no subtype-specific agonists for LXR or LXRß have been described so far, we, like others before in macrophages,^19,20 cannot distinguish whether the effect on Th1 cytokines expression is mediated via LXR, LXRß, or both. Further studies are needed to establish subtype specific agonists, thus allowing further elucidation of the role of LXR subtypes in macrophage and T cell activation.

Our data suggest that the reduction in IFN expression is caused by an inhibition of IFN promoter activity. PMA/ionomycin-induced IFN expression is mediated via 2 AP-1–CREB-ATF binding sites in the proximal part of the IFN promoter. Transient transfection experiments using a promoter reporter construct containing these 2 binding sites, but lacking the 5' part of the promoter revealed a significant reduction of reporter activity on LXR agonist treatment. Previous reports have shown that the inhibition of IFN expression by glucocorticoids is mediated by limiting the binding of AP-1–CREB-ATF to the promoter,²¹ suggesting that LXRs and GR, both members of the family of nuclear transcription factors, share similar pathways with respect to the regulation of IFN gene expression.

The effects of the LXR agonist on human T cells extend to inhibition of other pro-inflammatory Th1 cytokines, TNF and IL-2, implicating LXRs as a potential nodal point for the regulation of T-cell–modulated inflammatory responses. In addition, the results obtained are unlikely to be derived from a shift of T cells toward a potential anti-inflammatory Th-2 response because T0901317 did not increase levels of IL-10, a classic TH2-cytokine, in CD4-positive T cells. Moreover, the LXR activator did not reduce PMA/ionomycin-induced IL-10 secretion. Still, we did not detect IL-4 and IL-5 in our system and thus cannot completely rule out an effect of T0901317 on these TH2 cytokines. Overall, these data suggest that LXR activation may shift the T-cell response toward a reduction of pro-inflammatory cell activation.

The reduction of IFN expression by LXR activators provides novel insight into LXRs anti-atherogenic effects. Data in animals have shown that LXR agonist treatment decreases lesion development in a mouse model of arteriosclerosis.^8,22 Because LXRs play an important role in cholesterol efflux from macrophages as well as in the reduction of lipid content in foam cells, such mechanisms have been proposed as the main mechanism at work. However, recent studies have shown that LXR agonists exhibit direct anti-inflammatory activity in macrophages, suggesting that a combined metabolic and anti-inflammatory effect of LXRs may contribute to such beneficial effects on atherogenesis. Our study now proposes that the anti-inflammatory action of LXRs not only is limited to macrophages but also extends to CD4-positive lymphocytes, major effectors of the inflammatory response in the vessel wall. T-cell–derived cytokines like IFN are critically involved in lesion development. As such, IFN has been shown to induce the expression of T-cell–specific chemokines from endothelial cells, thus facilitating the migration of additional T cells into the vessel wall, potentially creating a vicious circle of T cell recruitment and activation.²³ Moreover, IFN has been implicated in plaque destabilization through its capacity to induce the expression of matrix-degrading MMPs. Therefore, a reduction of IFN release from activated T-cells, as described here, may at least in part contribute to the beneficial effects of LXR activator treatment on atherogenesis in mice, but this needs to be confirmed in additional in vivo experiments. Further studies are warranted to examine whether LXR activation may become a therapeutical tool to also modulate the inflammatory processes in atherogenesis in humans. To date in vivo application of LXR agonists is limited because of an increase in triglyceride during treatment, but the development of selective or partial agonists may help to overcome these problems and then potentially provide us with novel drugs to influence lesion development in patients at high-risk.

	Acknowledgments

 
This work was supported by grants of the Deutsche Forschungsgemeinschaft (SFB 451, project B9) and the Else-Kröner-Fresenius-Siftung to Dr Nikolaus Marx, as well as by a grant of the Deutsche Forschungsgemeinschaft (SFB 451, project B11) to Dr Daniel Walcher.

	Footnotes

 
D.W. and A.K. contributed equally to this study.

Received June 30, 2005; accepted February 2, 2006.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Hansson GK, Jonasson L, Lojsthed B, Stemme S, Kocher O, Gabbiani G. Localization of T lymphocytes and macrophages in fibrous and complicated human atherosclerotic plaques. Atherosclerosis. 1988; 72: 135–141.[CrossRef][Medline] [Order article via Infotrieve]

2. Hansson GK, Hellstrand M, Rymo L, Rubbia L, Gabbiani G. Interferon gamma inhibits both proliferation and expression of differentiation-specific alpha-smooth muscle actin in arterial smooth muscle cells. J Exp Med. 1989; 170: 1595–1608.[Abstract/Free Full Text]

3. Libby P, Ridker PM, Maseri A. Inflammation and atherosclerosis. Circulation. 2002; 105: 1135–1143.[Abstract/Free Full Text]

4. Gupta S, Pablo AM, Jiang X, Wang N, Tall AR, Schindler C. IFN-gamma potentiates atherosclerosis in ApoE knock-out mice. J Clin Invest. 1997; 99: 2752–2761.[Medline] [Order article via Infotrieve]

5. Marx N, Kehrle B, Kohlhammer K, Grub M, Koenig W, Hombach V, Libby P, Plutzky J. PPAR activators as antiinflammatory mediators in human T lymphocytes: implications for atherosclerosis and transplantation-associated arteriosclerosis. Circ Res. 2002; 90: 703–710.[Abstract/Free Full Text]

6. Lund EG, Menke JG, Sparrow CP. Liver X receptor agonists as potential therapeutic agents for dyslipidemia and atherosclerosis. Arterioscler Thromb Vasc Biol. 2003; 23: 1169–1177.[Abstract/Free Full Text]

7. Tontonoz P, Mangelsdorf DJ. Liver X receptor signaling pathways in cardiovascular disease. Mol Endocrinol. 2003; 17: 985–993.[Abstract/Free Full Text]

8. Tangirala RK, Bischoff ED, Joseph SB, Wagner BL, Walczak R, Laffitte BA, Daige CL, Thomas D, Heyman RA, Mangelsdorf DJ, Wang X, Lusis AJ, Tontonoz P, Schulman IG. Identification of macrophage liver X receptors as inhibitors of atherosclerosis. Proc Natl Acad Sci U S A. 2002; 99: 11896–11901.[Abstract/Free Full Text]

9. Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, Tontonoz P. Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat Med. 2003; 9: 213–219.[CrossRef][Medline] [Order article via Infotrieve]

10. Marx N, Mackman N, Schönbeck U, Yilmaz N, Hombach V, Libby P, Plutzky J. PPARalpha activators inhibit Tissue Factor expression and activity in human monocytes. Circulation. 2001; 103: 213–219.[Abstract/Free Full Text]

11. Marx N, Schönbeck U, Lazar MA, Libby P, Plutzky J. Peroxisome proliferator activated receptor gamma activators inhibit gene expression and migration in human vascular smooth muscle cells. Circ Res. 1998; 83: 1097–1103.[Abstract/Free Full Text]

12. Harada Y, Watanabe S, Yssel H, Arai K. Factors affecting the cytokine production of human T cells stimulated by different modes of activation. J Allergy Clin Immunol. 1996; 98: S161–S173.[CrossRef]

13. Diehn M, Alizadeh AA, Rando OJ, Liu CL, Stankunas K, Botstein D, Crabtree GR, Brown PO. Genomic expression programs and the integration of the CD28 costimulatory signal in T cell activation. Proc Natl Acad Sci U S A. 2002; 99: 11796–11801.[Abstract/Free Full Text]

14. Penix L, Weaver WM, Pang Y, Young HA, Wilson CB. Two essential regulatory elements in the human interferon gamma promoter confer activation specific expression in T cells. J Exp Med. 1993; 178: 1483–1496.[Abstract/Free Full Text]

15. Liuzzo G, Vallejo AB, Kopecky SL, Frye RL, Holmes DR, Goronzy JJ, Weyand CM. Molecular fingerprints of Interferon-gamma signaling in unstable angina. Circulation. 2001; 103: 1509–1514.[Abstract/Free Full Text]

16. Costet P, Luo Y, Wang N, Tall AR. Sterol-dependent transactivation of the ABC1 promoter by the liver X receptor/retinoid X receptor. J Biol Chem. 2000; 275: 28240–28245.[Abstract/Free Full Text]

17. Schwartz K, Lawn RM, Wade DP. ABC1 gene expression and ApoA-I-mediated cholesterol efflux are regulated by LXR. Biochem Biophys Res Commun. 2000; 274: 794–802.[CrossRef][Medline] [Order article via Infotrieve]

18. Venkateswaran A, Laffitte BA, Joseph SB, Mak PA, Wilpitz DC, Edwards PA, Tontonoz P. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc Natl Acad Sci U S A. 2000; 97: 12097–12102.[Abstract/Free Full Text]

19. Castrillo A, Joseph SB, Marathe C, Mangelsdorf DJ, Tontonoz P. Liver X receptor-dependent repression of matrix metalloproteinase-9 expression in macrophages. J Biol Chem. 2003; 278: 10443–10449.[Abstract/Free Full Text]

20. Ogawa D, Stone JF, Takata Y, Blaschke F, Chu VH, Towler DA, Law RE, Hsueh WA, Bruemmer D. Liver x receptor agonists inhibit cytokine-induced osteopontin expression in macrophages through interference with activator protein-1 signaling pathways. Circ Res. 2005; 96: e59–67.[Abstract/Free Full Text]

21. Cippitelli M, Sica A, Viggiano V, Ye J, Ghosh P, Birrer MJ, Young HA. Negative transcriptional regulation of the interferon-gamma promoter by glucocorticoids and dominant negative mutants of c-Jun. J Biol Chem. 1995; 270: 12548–12556.[Abstract/Free Full Text]

22. Joseph SB, McKilligin E, Pei L, Watson MA, Collins AR, Laffitte BA, Chen M, Noh G, Goodman J, Hagger GN, Tran J, Tippin TK, Wang X, Lusis AJ, Hsueh WA, Law RE, Collins JL, Willson TM, Tontonoz P. Synthetic LXR ligand inhibits the development of atherosclerosis in mice. Proc Natl Acad Sci U S A. 2002; 99: 7604–7609.[Abstract/Free Full Text]

23. Mach F, Sauty A, Iarossi AS, Sukhova GK, Neote K, Libby P, Luster AD. The interferon-gamma inducible CXC chemokines IP-10, Mig, and I-TAC are differentially expressed by human atheroma-associated cells: Implications for lymphocyte recruitment in atherogenesis. J Clin Invest. 1999; 104: 1041–1049.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				R. Geyeregger, M. Shehata, M. Zeyda, F. W. Kiefer, K. M. Stuhlmeier, E. Porpaczy, G. J. Zlabinger, U. Jager, and T. M. Stulnig Liver X receptors interfere with cytokine-induced proliferation and cell survival in normal and leukemic lymphocytes J. Leukoc. Biol., November 1, 2009; 86(5): 1039 - 1048. [Abstract] [Full Text] [PDF]

				S. Wu, R. Yin, R. Ernest, Y. Li, O. Zhelyabovska, J. Luo, Y. Yang, and Q. Yang Liver X receptors are negative regulators of cardiac hypertrophy via suppressing NF-{kappa}B signalling Cardiovasc Res, October 1, 2009; 84(1): 119 - 126. [Abstract] [Full Text] [PDF]

				G. Heine, A. Dahten, K. Hilt, D. Ernst, M. Milovanovic, B. Hartmann, and M. Worm Liver X Receptors Control IgE Expression in B Cells J. Immunol., May 1, 2009; 182(9): 5276 - 5282. [Abstract] [Full Text] [PDF]

				E. Rigamonti, G. Chinetti-Gbaguidi, and B. Staels Regulation of Macrophage Functions by PPAR-{alpha}, PPAR-{gamma}, and LXRs in Mice and Men Arterioscler Thromb Vasc Biol, June 1, 2008; 28(6): 1050 - 1059. [Abstract] [Full Text] [PDF]

				C. Fontaine, E. Rigamonti, A. Nohara, P. Gervois, E. Teissier, J.-C. Fruchart, B. Staels, and G. Chinetti-Gbaguidi Liver X Receptor Activation Potentiates the Lipopolysaccharide Response in Human Macrophages Circ. Res., July 6, 2007; 101(1): 40 - 49. [Abstract] [Full Text] [PDF]

				R. Geyeregger, M. Zeyda, W. Bauer, E. Kriehuber, M. D. Saemann, G. J. Zlabinger, D. Maurer, and T. M. Stulnig Liver X receptors regulate dendritic cell phenotype and function through blocked induction of the actin-bundling protein fascin Blood, May 15, 2007; 109(10): 4288 - 4295. [Abstract] [Full Text] [PDF]

				F. Blaschke, Y. Takata, E. Caglayan, A. Collins, P. Tontonoz, W. A. Hsueh, and R. K. Tangirala A Nuclear Receptor Corepressor-Dependent Pathway Mediates Suppression of Cytokine-Induced C-Reactive Protein Gene Expression by Liver X Receptor Circ. Res., December 8, 2006; 99(12): e88 - e99. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: 26/5/1022    most recent 01.ATV.0000210278.67076.8fv1 Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Walcher, D. Articles by Marx, N. Search for Related Content PubMed PubMed Citation Articles by Walcher, D. Articles by Marx, N. Pubmed/NCBI databases Compound via MeSH Substance via MeSH