Atherosclerosis and Lipoproteins |
From the Division of Biopharmaceutics (M.V.E., D.Y., R.B.H., T.J.C.V.B.) Leiden/Amsterdam Center for Drug Research, Gorlaeus Laboratories, Leiden University, Leiden, The Netherlands; Centre for Molecular Medicine and Therapeutics (R.R.S., E.R.J., M.R.H.), Childrens and Womens Hospital, University of British Columbia, Vancouver, Canada.
Correspondence to M. Van Eck, Division of Biopharmaceutics, Gorlaeus Laboratories, Einsteinweg 55, 2333 CC Leiden, The Netherlands. E-mail M.Eck{at}LACDR.LeidenUniv.nl
| Abstract |
|---|
|
|
|---|
Methods and Results Chimeras that specifically overexpress ABCA1 in macrophages were generated by transplantation of bone marrow from human ABCA1 bacterial artificial chromosome (BAC) transgenic mice into LDLr/ mice. Peritoneal macrophages isolated from the ABCA1 BAC
LDLr/ chimeras exhibited a 60% (P=0.0006) increase in cholesterol efflux to apolipoprotein AI. To induce atherosclerosis, the mice were fed a Western-type diet containing 0.25% cholesterol and 15% fat for 9, 12, and 15 weeks, allowing analysis of effects on initial lesion development as well as advanced lesions. No significant effect of macrophage ABCA1 overexpression was observed on atherosclerotic lesion size after 9 weeks on the Western-type diet (245±36x103 µm2 in ABCA1 BAC
LDLr/ mice versus 210±20x103 µm2 in controls). However, after 12 weeks, the mean atherosclerotic lesion area in ABCA1 BAC
LDLr/ mice remained only 164±15x103 µm2 (P=0.0008) compared with 513±56x103 µm2 in controls (3.1-fold lower). Also, after 15 weeks on the diet, lesions in mice transplanted with ABCA1 overexpressing bone marrow were still 1.6-fold smaller (393±27x103 µm2 compared with 640±59x103 µm2 in control transplanted mice; P=0.0015).
Conclusion ABCA1 upregulation in macrophages inhibits the progression of atherosclerotic lesions.
ATP-binding cassette transporter 1 (ABCA1) is a key regulator of cellular cholesterol and phospholipid transport. To investigate the therapeutic benefit of upregulation of macrophage ABCA1, chimeras were created that specifically overexpress ABCA1 in macrophages by bone marrow transplantation. The studies show that ABCA1 upregulation in macrophages inhibited the progression of atherosclerotic lesions.
Key Words: atherosclerosis leukocytes cholesterol transplantation
| Introduction |
|---|
|
|
|---|
| Methods |
|---|
|
|
|---|
Bone Marrow Transplantation
To induce bone marrow aplasia, male LDLr/ recipient mice were exposed to a single dose of 9 Gy (0.19 Gy/min, 200 kV, 4 mA) total body irradiation using an Andrex Smart 225 Röntgen source (YXLON International) with a 6-mm aluminum filter 1 day before the transplantation. Bone marrow was isolated by flushing the femurs and tibias from male ABCA1 BAC or wild-type (WT) littermates. Irradiated recipients received 0.5x107 bone marrow cells by tail vein injection.
Assessment of Chimerism
The hematologic chimerism of the LDLr/ mice was determined using genomic DNA from bone marrow by polymerase chain reaction (PCR) at 20 weeks after transplant. The forward and reverse primers 5'GGCTGGATTAGCAGTCCTCA3' and 5'ATCCCCAACTCAAAACCACA3' for human ABCA1 and 5'TGGGAACTCCTAAAAT3' and 5'CCATGTGGTGTGTAGACA3' for mouse ABCA1 gene were used. Murine and human ABCA1 mRNA expression relative to 18Sr-RNA in peritoneal macrophages was quantitatively determined on an ABI Prism 7700 Sequence Detection system (Applied Biosystems) using the following primers and probes for human ABCA1: forward, 5'CCTGACCGGGTTGTTCCC3'; reverse, 5'TTCTGCCGGATGGTGCTC3'; probe, 5'ACATCCTGGGAAAAGACATTCGCTCTGA3' and for murine ABCA1: forward, 5'TCCGAGCGAATGTCCTTC3'; reverse, 5'GCGCTCAACTTTTACGAAGGC3'; probe, 5'CCCAACTTCTGGCACGGCCTACATC3'. For analyses of ABCA1 protein expression, 100 to 150 µg of protein was separated on 7.5% polyacrylamide gels and was transferred to polyvinylidene difluoride membranes (Millipore) and probed with ABCA1PEP4 antibody20 or anti-GAPDH (Chemicon) as a control. Immunolabeling was detected by enhanced chemiluminescence (Amersham Pharmacia Biotech), and protein levels were quantitated using NIH Image software.
Macrophage Cholesterol Efflux Studies
Thioglycollate-elicited peritoneal macrophages were incubated with 0.5 µCi/mL 3H-cholesterol in DMEM/0.2% BSA for 24 hours at 37°C. To determine cholesterol loading, cells were washed 3 times with washing buffer (50 mmol/L Tris containing 0.9% NaCl, 1 mmol/L EDTA, and 5 mmol/L CaCl2, pH 7.4), lysed in 0.1 mol/L NaOH, and the radioactivity was determined by liquid scintillation counting. Cholesterol efflux was studied by incubation of the cells with DMEM/0.2% BSA alone or supplemented with either 10 µg/mL apoAI (Calbiochem) or 50 µg/mL human HDL. Radioactivity in the medium was determined by scintillation counting after 24 hours of incubation.
Serum Lipid Analyses
After an overnight fast, blood was drawn from each mouse by tail bleeding. Total cholesterol, triglycerides, and phospholipids in serum were determined using enzymatic colorimetric assays (Roche Diagnostics). The distribution of lipids over the different lipoproteins was determined by fractionation using a Superose 6 column (3.2x30 mm; Smart-system; Pharmacia). Total cholesterol, triglyceride, and phospholipid contents in the effluent were determined as above.
Histological Analysis of the Aortic Root
To analyze the effect of macrophage ABCA1 overexpression on atherosclerosis, transplanted mice were euthanized after 9, 12, and 15 weeks on the Western-type diet. The atherosclerotic lesion areas in oil red Ostained cryostat sections of the aortic root were quantified using the Leica image analysis system, consisting of a Leica DMRE microscope coupled to a video camera and Leica Qwin Imaging software (Leica Ltd.). Mean lesion area (in µm2) was calculated from 10 oil red Ostained sections, starting at the appearance of the tricuspid valves. For the assessment of macrophage infiltration, sections were immunolabeled with MOMA-2 (generous gift of Dr G. Kraal, Vrije Universiteit, Amsterdam, The Netherlands). The amount of collagen in the lesions was determined using Massons Trichrome Accustain according to manufacturer instructions (Sigma Diagnostics). TUNEL staining of lesions was performed using the In Situ Cell Death Detection kit (Roche). TUNEL-positive nuclei were visualized with Nova Red (Vector), and sections were counterstained with 0.3% methylgreen. Sections treated with DNase (2U per section) served as positive control. All quantifications were done blinded by computer-aided morphometric analysis using the Leica image analysis system.
Statistical Analyses
Statistical analyses were performed using the unpaired Student t test (Instat GraphPad software).
| Results |
|---|
|
|
|---|
|
Effect of Macrophage ABCA1 Overexpression on Plasma Lipid Levels
On regular chow diet, the majority of the cholesterol in LDLr/ mice is transported by LDL and HDL, phospholipids by HDL, and triglycerides by very lowdensity lipoprotein (VLDL) and LDL (Figure 2). In contrast to the ABCA1 BAC transgenic mice that displayed mildly increased HDL cholesterol levels,20 no significant effect on HDL cholesterol, triglyceride, or phospholipid levels was observed when ABCA1 was overexpressed solely in macrophages.
|
To induce atherosclerotic lesion development, the transplanted mice were fed Western-type diet starting at 8 weeks after transplantation. On diet feeding, serum cholesterol levels increased &3-fold in both groups of mice because of an increase in VLDL and LDL cholesterol (Table). The increase in VLDL and LDL cholesterol coincided with an increase in phospholipids. No significant effect of macrophage ABCA1 overexpression on serum lipid levels or lipid distribution among the different lipoproteins was observed (Figure 2).
|
Effect of Macrophage ABCA1 Overexpression on Atherosclerotic Lesion Initiation and Progression
To investigate the therapeutic potential of increasing macrophage ABCA1 expression as a means of preventing atherosclerosis, we assessed whether and to what degree upregulation of ABCA1 in macrophages affected lesion formation. Lesion development was analyzed in the aortic root of WT
LDLr/ mice and in ABCA1 BAC
LDLr/ chimeras after 9, 12, and 15 weeks of Western-type diet feeding (Figure 3). After 9 weeks on the Western diet, no significant effect of macrophage ABCA1 overexpression on the atherosclerotic lesion size was observed (245±36x103 µm2 in ABCA1 BAC
LDLr/ mice [n=11] versus 210±20x103 µm2 in controls [n=11]). Lesions in both groups of mice were primarily composed of macrophage-derived foam cells (94±2.3% and 94±2.1% for WT and ABCA1 BAC transplanted mice, respectively), indicating that macrophage ABCA1 overexpression does not prevent foam cell formation and thus the initiation of atherosclerosis. Between 9 and 12 weeks of diet feeding, atherosclerosis in the mice transplanted with control bone marrow progressed further in size to 513±56x103 µm2 (n=14). However, in the ABCA1 BAC
LDLr/ mice, no time-dependent increase in lesion size was observed. The mean atherosclerotic lesion area was thus 3.1-fold smaller (164±15x103 µm2; n=14, P=0.0008) compared with control transplanted animals. Interestingly, at this time point, lesions were still primarily composed of macrophage-derived foam cells (88±3.0% and 91±4.0% for WT and ABCA1 BAC transplanted mice, respectively). Thus, although macrophage ABCA1 overexpression did not inhibit the initiation of foam cell formation, the progression of lesions was markedly inhibited by upregulation of ABCA1 in macrophages. Between 12 and 15 weeks of diet feeding, lesions in control transplanted mice had progressed only slightly in size to 640±59x103 µm2 (n=9), whereas lesion development in mice transplanted with ABCA1 overexpressing bone marrow had increased to 393±27x 103 µm2 (n=9; P=0.0015). At this time point, the lesion composition was markedly different. The macrophage content of the lesions of mice transplanted with WT bone marrow was 40±4.0%, whereas the collagen content was 15±2.2%. In contrast, mice transplanted with ABCA1 overexpressing bone marrow contained more macrophages and less collagen (53±3.9% [P=0.026] and 8.9±1.1% [P=0.029], respectively), indicative of less advanced lesions. Also, a predominant part of the lesions consisted of acellular necrotic areas. However, the acellular area of the lesions of mice reconstituted with ABCA1 overexpressing bone marrow was 2-fold smaller compared with control transplanted animals (53±17x103 µm2 in ABCA1 BAC and 108±20x103 µm2 in WT, respectively; P=0.057). Thus, although lesion progression was not completely halted by overexpression of ABCA1 in macrophages, the progression was still largely reduced.
|
Because ABCA1 has been implicated in the removal of apoptotic cells, the effect of macrophage ABCA1 overexpression on the number of TUNEL-positive cells was determined at the different stages of lesion development (Figure 4). After 9 weeks on Western-type diet, no effect of macrophage ABCA1 overexpression on the absolute number of TUNEL-positive cells in the lesions was observed. However, after 12 and 15 weeks, the number of TUNEL-positive cells was significantly lower in the ABCA1 BAC transplanted animals. In addition, the percentage of apoptotic nuclei to the total number of nuclei was decreased in lesions of mice transplanted with ABCA1 BAC overexpressing bone marrow. However, this effect was also observed at 9 weeks on Western-type diet and was independent of the extent of lesion development.
|
| Discussion |
|---|
|
|
|---|
To study the therapeutic potential of upregulation of macrophage ABCA1 to prevent atherosclerosis, we determined atherosclerosis susceptibility of chimeras that specifically overexpress ABCA1 on macrophages, created by transplantation of bone marrow from human ABCA1 BAC transgenic mice into LDLr/ mice. In this study, we show that overexpression of ABCA1 in macrophages did not influence initial lesion development in LDLr/ mice. However, specific deletion of macrophage ABCA1 in LDLr/ mice did induce initial lesion development (M.V.E., unpublished data, 2005). The expression of ABCA1 in macrophages is tightly controlled by intracellular cholesterol levels.18,19 Its activity is dramatically increased on cholesterol loading of macrophages and the subsequent transformation into foam cells. It is therefore conceivable that cholesterol efflux via ABCA1 is already maximally activated in macrophages in the atherosclerotic lesion. As a result, further upregulation of ABCA1 expression does not inhibit initial lesion development. However, ABCA1 overexpression did inhibit the progression of the size of these fatty streak lesions. During the progression of atherosclerosis, macrophage foam cells accumulate large amounts of unesterified cholesterol, a process that is thought to contribute to macrophage death.28 Increased levels of intracellular free cholesterol accelerate the degradation of ABCA1 in macrophages.29 In agreement, Albrecht et al recently showed that the microenvironment of the atherosclerotic plaque induces ABCA1 protein degradation.30 This might provide a possible explanation for the fact that overexpression of ABCA1 did not inhibit initial lesion formation, whereas the progression of these lesions was inhibited. Progression of atherosclerotic lesions is also characterized by an ongoing chronic inflammatory reaction and extensive cellular necrosis and apoptosis.31 Several lines of evidence have suggested a role for ABCA1 in the engulfment of apoptotic cells.3234 In agreement, we demonstrate that the percentage of apoptotic nuclei to the total number of nuclei was decreased in lesions of mice transplanted with ABCA1 BAC overexpressing bone marrow. However, this effect was independent of the extent of lesion development. It is thus unlikely that the protective effects of macrophage ABCA1 overexpression in later stages of lesion development are solely the result of accelerated clearance of apoptotic cells.
In conclusion, the important effect of macrophage ABCA1 overexpression in prevention of atherosclerotic lesion progression reported in this study renders this transporter an attractive target for the development of novel therapeutic agents designed to prevent the progression of atherosclerosis.
| Acknowledgments |
|---|
| Footnotes |
|---|
Received July 25, 2005; accepted January 18, 2006.
| References |
|---|
|
|
|---|
2. Graeves DR, Gough PJ, Gordon S. Recent progress in defining the role of scavenger receptors in transport, atherosclerosis and host defense. Curr Opin Lipidol. 1998; 9: 425432.[CrossRef][Medline] [Order article via Infotrieve]
3. Miller GJ, Miller NE. Plasma high-density-lipoprotein concentration and development of ischemic heart disease. Lancet. 1975; 1: 1619.[CrossRef][Medline] [Order article via Infotrieve]
4. Wilson PWF, Abbott RD, Castelli WP. High density lipoprotein cholesterol and mortality: the Framingham Heart Study. Arteriosclerosis. 1988; 8: 737741.
5. Goldbourt U, Yaari S, Medalie JH. Isolated low HDL cholesterol as a risk factor for coronary heart disease mortality: a 21 year follow-up of 8000 men. Arterioscler Thromb Vasc Biol. 1997; 17: 107113.
6. Barter PJ, Nicholls S, Rye KA, Anantharamaiah GM, Navab M, Fogelman AM. Antiinflammatory properties of HDL. Circ Res. 2004; 95: 764772.
7. Assmann G, Gotto AM Jr. HDL cholesterol and protective factors in atherosclerosis. Circulation. 2004; 109: III8III14.[Medline] [Order article via Infotrieve]
8. Von Eckardstein A, Nofer JR, Assmann G. High density lipoproteins and arteriosclerosis. Role of cholesterol efflux and reverse cholesterol transport. Arterioscler Thromb Vasc Biol. 2001; 21: 1327.
9. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Genest JJr, Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat Genet. 1999; 22: 336345.[CrossRef][Medline] [Order article via Infotrieve]
10. Bodzioch M, Orso M, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G. The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease. Nat Genet. 1999; 22: 347351.[CrossRef][Medline] [Order article via Infotrieve]
11. Rust S, Rosier M, Funke H, von Eckardstein A, Cullen P, Kroes HY, Hordijk R, Geisel J, Kastelein J, Molhuizen HO, Schreiner M, Mischke A, Hahmann HW, Assmann G. Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1. Nat Genet. 1999; 22: 352355.[CrossRef][Medline] [Order article via Infotrieve]
12. Clee SM, Zwinderman AH, Engert JC, Zwarts KY, Molhuizen HO, Roomp K, Jukema JW, van Wijland M, van Dam M, Hudson TJ, Brooks-Wilson A, Genest JJr, Kastelein JJ, Hayden MR. Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease. Circulation. 2001; 103: 11981205.
13. Tregouet DA, Ricard S, Nicaud V, Arnould I, Soubigou S, Rosier M, Duverger N, Poirier O, Mace S, Kee F, Morrison C, Denefle P, Tiret L, Evans A, Deleuze JF, Cambien F. In-depth haplotype analysis of ABCA1 gene polymorphisms in relation to plasma ApoA1 levels and myocardial infarction. Arterioscler Thromb Vasc Biol. 2004; 24: 775781.
14. Brousseau ME, Bodzioch M, Schaefer EJ, Goldkamp AL, Kielar D, Probst M, Ordovas JM, Aslanidis C, Lackner KJ, Bloomfield Rubins H, Collins D, Robins SJ, Wilson PW, Schmitz G. Common variants in the gene encoding ATP-binding cassette transporter 1 in men with low HDL cholesterol levels and coronary heart disease. Atherosclerosis. 2001; 154: 607611.[CrossRef][Medline] [Order article via Infotrieve]
15. Singaraja RR, Fievet C, Castro G, James ER, Hennuyer N, Clee SM, Bissada N, Choy JC, Fruchart JC, McManus BM, Staels B, Hayden MR. Increased ABCA1 activity protects against atherosclerosis. J Clin Invest. 2002; 110: 3542.[CrossRef][Medline] [Order article via Infotrieve]
16. Joyce CW, Amar MJ, Lambert G, Vaisman BL, Paigen B, Najib-Fruchart J, Hoyt RFJr, Neufeld ED, Remaley AT, Fredrickson DS, Brewer HBJr, Santamarina-Fojo S. The ATP binding cassette transporter A1 (ABCA1) modulates the development of aortic atherosclerosis in C57BL/6 and apoE-knockout mice. Proc Natl Acad Sci U S A. 2002; 99: 407412.
17. Van Eck M, Bos IST, Kaminski WE, Orso E, Rothe G, Twisk J, Bottcher A, Van AmersfoortES, Christiansen-Weber TA, Fung-Leung WP, Van BerkelTJ, Schmitz G. Leukocyte ATP-binding cassette transporter A1 (ABCA1) deficiency promotes atherosclerotic lesion development. Proc Natl Acad Sci U S A. 2002; 99: 62986303.
18. Langmann T, Klucken J, Reil M, Liebisch G, Luciani MF, Chimini G, Kaminski WE, Schmitz G. l. Molecular cloning of the human ATP-binding cassette transporter 1 (hABC1): evidence for sterol-dependent regulation in macrophages. Biochem Biophys Res Commun. 1999; 257: 2933.[CrossRef][Medline] [Order article via Infotrieve]
19. Wade DP, Owen JS. Regulation of the cholesterol efflux gene, ABCA1. Lancet. 2001; 357: 161163.[CrossRef][Medline] [Order article via Infotrieve]
20. Singaraja RR, Bocher V, James ER, Clee SM, Zhang LH, Leavitt BR, Tan B, Brooks-Wilson A, Kwok A, Bissada N, Yang YZ, Liu G, Tafuri SR, Fievet C, Wellington CL, Staels B, Hayden MR. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and apoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements intron 1. J Biol Chem. 2001; 276: 3396933979.
21. Clee SM, Kastelein JJ, Van Dam M, Marcil M, Roomp K, Zwarts KY, Collins JA, Roelants R, Tamasawa N, Stulc T, Suda T, Ceska R, Boucher B, Rondeau C, DeSouich C, Brooks-Wilson A, Molhuizen HO, Frohlich J, Genest JJr, Hayden MR. Age and residual cholesterol efflux affect HDL cholesterol levels and coronary artery disease in ABCA1 heterozygotes. J Clin Invest. 2000; 106: 12631270.[Medline] [Order article via Infotrieve]
22. Van DamMJ, de Groot E, Clee SM, Hovingh GK, Roelants R, Brooks-Wilson A, Zwinderman AH, Smit AJ, Smelt AH, Groen AK, Hayden MR, Kastelein JJ. Association between increased arterial-wall thickness and impairment in ABCA1-driven cholesterol efflux: an observational study. Lancet. 2002; 359: 3741.[CrossRef][Medline] [Order article via Infotrieve]
23. Kiss RS, McManus DC, Franklin V, Tan WL, McKenzie A, Chimini G, Marcel YL. The lipidation by hepatocytes of human apolipoprotein A-I occurs by both ABCA1-dependent and -independent pathways. J Biol Chem. 2003; 278: 1011910127.
24. Basso F, Freeman L, Knapper Cl, Remaley A, Stonik J, Neufeld EB, Tansey T, Amar MJ, Fruchart-Najib J, Duverger N, Santamarina-Fojo S, Brewer HB Jr. Role of the hepatic ABCA1 transporter in modulating intrahepatic cholesterol and plasma HDL cholesterol concentrations. J Lipid Res. 2003; 44: 296302.
25. Wellington CL, Brunham LR, Zhou S, Singaraja RR, Visscher H, Gelfer A, Ross C, James E, Liu G, Huber MT, Yang YZ, Parks RJ, Groen A, Fruchart-Najib J, Hayden MR. Alterations of plasma lipids in mice via adenoviral-mediated hepatic overexpression of human ABCA1. J Lipid Res. 2003; 44: 14701480.
26. Timmins JM, Lee J-Y, Boudyguina E, Kluckman KD, Brunham LR, Mulya A, Gebre AK, Coutinho JM, Colvin PL, Smith TL, Hayden MR, Maeda N, Parks JS. Targeted inactivation of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoA-I. J Clin Invest. 2005; 115: 13331142.[CrossRef][Medline] [Order article via Infotrieve]
27. Aiello RJ, Brees D, Bourassa PA, Royer L, Lindsey S, Coskran T, Haghpassand M, Francone OL. Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages. Arterioscler Thromb Vasc Biol. 2002; 22: 630637.
28. Tabas I. Free cholesterol-induced cytotoxicity. A possible contributing factor to macrophage foam cell necrosis in advanced atherosclerotic lesions. Trends Cardiovasc Med. 1997; 7: 256263.[CrossRef]
29. Feng B, Tabas I. ABCA1-mediated cholesterol efflux is defective in free cholesterol-loaded macrophages. J Biol Chem. 2002; 277: 4327143280.
30. Albrecht C, Soumian S, Amey JS, Sardini A, Higgins CF, Davies AH, Gibbs RG. ABCA1 expression in carotid atherosclerotic plaques. Stroke. 2004; 35: 28012806.
31. Geng Y-J, Libby P. Progression of the atheroma. A struggle between death and procreation. Arterioscler Thromb Vasc Biol. 2002; 22: 13701380.
32. Hamon Y, Chambenoit O, Chimini G. ABCA1 and the engulfment of apoptotic cells. Biochim Biophys Acta. 2002; 1585: 6471.[Medline] [Order article via Infotrieve]
33. Luciani MF, Chimini G. The ATP binding cassette transporter ABC1, is required for the engulfment of corpses generated by apoptotic cell death. EMBO J. 1996; 15: 226235.[Medline] [Order article via Infotrieve]
34. Hamon Y, Broccardo C, Chambenoit O, Luciani MF, Toti F, Chaslin S, Freyssinet JM, Devaux PF, McNeish J, Marguet D, Chimini G. ABC1 promotes engulfment of apoptotic cells and transbilayer redistribution of phosphatidylserine. Nat Cell Biol. 2000; 2: 399406.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
L. R. Brunham, R. R. Singaraja, M. Duong, J. M. Timmins, C. Fievet, N. Bissada, M. H. Kang, A. Samra, J.-C. Fruchart, B. McManus, et al. Tissue-Specific Roles of ABCA1 Influence Susceptibility to Atherosclerosis Arterioscler. Thromb. Vasc. Biol., April 1, 2009; 29(4): 548 - 554. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Baldan, D. D. Bojanic, and P. A. Edwards The ABCs of sterol transport J. Lipid Res., April 1, 2009; 50(Supplement): S80 - S85. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Rader, E. T. Alexander, G. L. Weibel, J. Billheimer, and G. H. Rothblat The role of reverse cholesterol transport in animals and humans and relationship to atherosclerosis J. Lipid Res., April 1, 2009; 50(Supplement): S189 - S194. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Paul, H. H. D. Meyer, K. Leidl, S. Soumian, and C. Albrecht A novel enzyme immunoassay specific for ABCA1 protein quantification in human tissues and cells J. Lipid Res., October 1, 2008; 49(10): 2259 - 2267. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Burgess, K. Naus, J. Chan, V. Hirsch-Reinshagen, G. Tansley, L. Matzke, B. Chan, A. Wilkinson, J. Fan, J. Donkin, et al. Overexpression of Human ABCG1 Does Not Affect Atherosclerosis in Fat-Fed ApoE-Deficient Mice Arterioscler. Thromb. Vasc. Biol., October 1, 2008; 28(10): 1731 - 1737. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Oram The ins and outs of ABCA J. Lipid Res., June 1, 2008; 49(6): 1150 - 1151. [Full Text] [PDF] |
||||
![]() |
R. Out, M. Hoekstra, K. Habets, I. Meurs, V. de Waard, R. B. Hildebrand, Y. Wang, G. Chimini, J. Kuiper, T. J.C. Van Berkel, et al. Combined Deletion of Macrophage ABCA1 and ABCG1 Leads to Massive Lipid Accumulation in Tissue Macrophages and Distinct Atherosclerosis at Relatively Low Plasma Cholesterol Levels Arterioscler. Thromb. Vasc. Biol., February 1, 2008; 28(2): 258 - 264. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Yan, M. I. Mayranpaa, J. Wong, J. Perttila, M. Lehto, M. Jauhiainen, P. T. Kovanen, C. Ehnholm, A. J. Brown, and V. M. Olkkonen OSBP-related Protein 8 (ORP8) Suppresses ABCA1 Expression and Cholesterol Efflux from Macrophages J. Biol. Chem., January 4, 2008; 283(1): 332 - 340. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Schiopu, B. Frendeus, B. Jansson, I. Soderberg, I. Ljungcrantz, Z. Araya, P. K. Shah, R. Carlsson, J. Nilsson, and G. N. Fredrikson Recombinant Antibodies to an Oxidized Low-Density Lipoprotein Epitope Induce Rapid Regression of Atherosclerosis in Apobec-1 / /Low-Density Lipoprotein Receptor / Mice J. Am. Coll. Cardiol., December 11, 2007; 50(24): 2313 - 2318. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-D. Wang, V. Franklin, and Y. L. Marcel In Vivo Reverse Cholesterol Transport From Macrophages Lacking ABCA1 Expression Is Impaired Arterioscler. Thromb. Vasc. Biol., August 1, 2007; 27(8): 1837 - 1842. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Hirsch-Reinshagen, J. Y. Chan, A. Wilkinson, T. Tanaka, J. Fan, G. Ou, L. F. Maia, R. R. Singaraja, M. R. Hayden, and C. L. Wellington Physiologically regulated transgenic ABCA1 does not reduce amyloid burden or amyloid-{beta} peptide levels in vivo J. Lipid Res., April 1, 2007; 48(4): 914 - 923. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Out, M. Hoekstra, I. Meurs, P. de Vos, J. Kuiper, M. Van Eck, and T. J.C. Van Berkel Total Body ABCG1 Expression Protects Against Early Atherosclerotic Lesion Development in Mice Arterioscler. Thromb. Vasc. Biol., March 1, 2007; 27(3): 594 - 599. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Oram and A. M. Vaughan ATP-Binding Cassette Cholesterol Transporters and Cardiovascular Disease Circ. Res., November 10, 2006; 99(10): 1031 - 1043. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Joyce, E. M. Wagner, F. Basso, M. J. Amar, L. A. Freeman, R. D. Shamburek, C. L. Knapper, J. Syed, J. Wu, B. L. Vaisman, et al. ABCA1 Overexpression in the Liver of LDLr-KO Mice Leads to Accumulation of Pro-atherogenic Lipoproteins and Enhanced Atherosclerosis J. Biol. Chem., November 3, 2006; 281(44): 33053 - 33065. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Vaughan and J. F. Oram ABCA1 and ABCG1 or ABCG4 act sequentially to remove cellular cholesterol and generate cholesterol-rich HDL J. Lipid Res., November 1, 2006; 47(11): 2433 - 2443. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Out, M. Hoekstra, R. B. Hildebrand, J. K. Kruit, I. Meurs, Z. Li, F. Kuipers, T. J.C. Van Berkel, and M. Van Eck Macrophage ABCG1 Deletion Disrupts Lipid Homeostasis in Alveolar Macrophages and Moderately Influences Atherosclerotic Lesion Development in LDL Receptor-Deficient Mice Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2295 - 2300. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ranalletta, N. Wang, S. Han, L. Yvan-Charvet, C. Welch, and A. R. Tall Decreased Atherosclerosis in Low-Density Lipoprotein Receptor Knockout Mice Transplanted With Abcg1-/- Bone Marrow Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2308 - 2315. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2006 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |