Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2006;26:929-934
Published online before print February 2, 2006, doi: 10.1161/01.ATV.0000208364.22732.16
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
26/4/929    most recent
01.ATV.0000208364.22732.16v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Eck, M.
Right arrow Articles by Van Berkel, T. J.C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Eck, M.
Right arrow Articles by Van Berkel, T. J.C.
Related Collections
Right arrow Animal models of human disease
Right arrow Pathophysiology
Right arrow Genetically altered mice
Right arrow Lipid and lipoprotein metabolism
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2006;26:929.)
© 2006 American Heart Association, Inc.


Atherosclerosis and Lipoproteins

Macrophage ATP-Binding Cassette Transporter A1 Overexpression Inhibits Atherosclerotic Lesion Progression in Low-Density Lipoprotein Receptor Knockout Mice

Miranda Van Eck; Roshni R. Singaraja; Dan Ye; Reeni B. Hildebrand; Erick R. James; Michael R. Hayden; Theo J.C. Van Berkel

From the Division of Biopharmaceutics (M.V.E., D.Y., R.B.H., T.J.C.V.B.) Leiden/Amsterdam Center for Drug Research, Gorlaeus Laboratories, Leiden University, Leiden, The Netherlands; Centre for Molecular Medicine and Therapeutics (R.R.S., E.R.J., M.R.H.), Children’s and Women’s Hospital, University of British Columbia, Vancouver, Canada.

Correspondence to M. Van Eck, Division of Biopharmaceutics, Gorlaeus Laboratories, Einsteinweg 55, 2333 CC Leiden, The Netherlands. E-mail M.Eck{at}LACDR.LeidenUniv.nl


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— ATP-binding cassette transporter A1 (ABCA1) is a key regulator of cellular cholesterol and phospholipid transport. Previously, we have shown that inactivation of macrophage ABCA1 induces atherosclerosis in low-density lipoprotein receptor knockout (LDLr–/–) mice. However, the possibly beneficial effects of specific upregulation of macrophage ABCA1 on atherogenesis are still unknown.

Methods and Results— Chimeras that specifically overexpress ABCA1 in macrophages were generated by transplantation of bone marrow from human ABCA1 bacterial artificial chromosome (BAC) transgenic mice into LDLr–/– mice. Peritoneal macrophages isolated from the ABCA1 BAC -> LDLr–/– chimeras exhibited a 60% (P=0.0006) increase in cholesterol efflux to apolipoprotein AI. To induce atherosclerosis, the mice were fed a Western-type diet containing 0.25% cholesterol and 15% fat for 9, 12, and 15 weeks, allowing analysis of effects on initial lesion development as well as advanced lesions. No significant effect of macrophage ABCA1 overexpression was observed on atherosclerotic lesion size after 9 weeks on the Western-type diet (245±36x103 µm2 in ABCA1 BAC -> LDLr–/– mice versus 210±20x103 µm2 in controls). However, after 12 weeks, the mean atherosclerotic lesion area in ABCA1 BAC -> LDLr–/– mice remained only 164±15x103 µm2 (P=0.0008) compared with 513±56x103 µm2 in controls (3.1-fold lower). Also, after 15 weeks on the diet, lesions in mice transplanted with ABCA1 overexpressing bone marrow were still 1.6-fold smaller (393±27x103 µm2 compared with 640±59x103 µm2 in control transplanted mice; P=0.0015).

Conclusion— ABCA1 upregulation in macrophages inhibits the progression of atherosclerotic lesions.

ATP-binding cassette transporter 1 (ABCA1) is a key regulator of cellular cholesterol and phospholipid transport. To investigate the therapeutic benefit of upregulation of macrophage ABCA1, chimeras were created that specifically overexpress ABCA1 in macrophages by bone marrow transplantation. The studies show that ABCA1 upregulation in macrophages inhibited the progression of atherosclerotic lesions.


Key Words: atherosclerosis • leukocytes • cholesterol • transplantation


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Atherosclerotic cardiovascular disease is the major cause of morbidity and mortality in Western societies. The genesis and progression of atherosclerotic lesions involves a complicated sequence of events in which various cell types in the arterial wall, including macrophages, play an important role.1 Deposition of excessive amounts of cholesterol in macrophages leading to their transformation into foam cells is a pathological hallmark of atherosclerosis. Macrophages cannot limit their uptake of cholesterol via scavenger receptors.2 Therefore, cholesterol efflux is an important mechanism to maintain cholesterol homeostasis in macrophages and to prevent atherosclerotic lesion development. Epidemiological studies have shown a strong inverse relationship between low plasma cholesterol levels and coronary artery disease.3–5 It is currently generally accepted that high plasma levels of high-density lipoprotein (HDL) protect against the development of atherosclerosis. Several mechanisms have been proposed by which HDL inhibits the development and progression of atherosclerosis, including protection against oxidative damage, inhibition of endothelial dysfunction, and anti-inflammatory effects.6,7 Most important, HDL facilitates reverse cholesterol transport, a process by which excess cholesterol from peripheral tissues is transferred via the plasma to the liver for either recycling or excretion from the body as bile.8 A key regulator of cholesterol efflux from macrophages is ATP-binding cassette transporter 1 (ABCA1). Mutations in ABCA1 cause Tangier disease, an autosomal recessive disorder that is characterized by severe HDL deficiency and increased susceptibility to atherosclerosis.9–11 In addition, several lines of evidence indicate that ABCA1 gene variations may contribute to the interindividual variability in atherosclerosis susceptibility in humans.12–14 Activation of ABCA1 is thus an attractive target for development of therapeutic interventions. Overexpression of ABCA1 in mice decreases atherosclerosis in apolipoprotein E (apoE) knockout15 and C57BL/6 mice.16 We have previously shown bone marrow transplantation to be a useful technique to study the role of macrophage ABCA1 in atherosclerosis. Specific disruption of ABCA1 in macrophages using bone marrow transplantation resulted in an increased susceptibility to atherosclerotic lesion development without altering plasma HDL levels, providing evidence that macrophage ABCA1 plays a critical role in the protection against atherosclerosis, independent of effects on HDL cholesterol.17 The expression of ABCA1 in macrophages is tightly controlled by intracellular cholesterol levels.18,19 Its activity is dramatically increased on cholesterol loading of macrophages and the subsequent transformation into foam cells. Therefore, it is conceivable that cholesterol efflux via ABCA1 is already maximally activated in macrophages in the atherosclerotic lesion. To study the therapeutic potential of upregulation of macrophage ABCA1 to prevent atherosclerosis, we determined atherosclerosis susceptibility of chimeras that specifically overexpress ABCA1 on macrophages, created by transplantation of bone marrow from human ABCA1 overexpressing bacterial artificial chromosome (BAC) transgenic mice into low-density lipoprotein (LDL) receptor knockout (LDLr–/–) mice. The findings from these studies revealed that specific upregulation of macrophage ABCA1 prevents progression of atherosclerosis and thus is an attractive therapeutic target for the prevention of atherosclerotic lesion development.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Mice
ABCA1 BAC transgenic mice hemizygous for the human ABCA1 gene were described previously.20 Nontransgenic littermates were used as controls. LDLr–/– mice were obtained from the Jackson Laboratory (Bar Harbor, Me). Mice were maintained on sterilized regular chow containing 4.3% (w/w) fat and no cholesterol (RM3; Special Diet Services) or fed a Western-type diet containing 15% (w/w) fat and 0.25% (w/w) cholesterol (Diet W; Hope Farms). Drinking water was supplied with antibiotics (83 mg/L ciprofloxacin and 67 mg/L polymyxin B sulfate) and 6.5 g/L sucrose. Animal experiments were performed at the Gorlaeus laboratories of the Leiden/Amsterdam Center for Drug Research in accordance with the national laws. All experimental protocols were approved by the ethics committee for animal experiments of Leiden University.

Bone Marrow Transplantation
To induce bone marrow aplasia, male LDLr–/– recipient mice were exposed to a single dose of 9 Gy (0.19 Gy/min, 200 kV, 4 mA) total body irradiation using an Andrex Smart 225 Röntgen source (YXLON International) with a 6-mm aluminum filter 1 day before the transplantation. Bone marrow was isolated by flushing the femurs and tibias from male ABCA1 BAC or wild-type (WT) littermates. Irradiated recipients received 0.5x107 bone marrow cells by tail vein injection.

Assessment of Chimerism
The hematologic chimerism of the LDLr–/– mice was determined using genomic DNA from bone marrow by polymerase chain reaction (PCR) at 20 weeks after transplant. The forward and reverse primers 5'GGCTGGATTAGCAGTCCTCA3' and 5'ATCCCCAACTCAAAACCACA3' for human ABCA1 and 5'TGGGAACTCCTAAAAT3' and 5'CCATGTGGTGTGTAGACA3' for mouse ABCA1 gene were used. Murine and human ABCA1 mRNA expression relative to 18Sr-RNA in peritoneal macrophages was quantitatively determined on an ABI Prism 7700 Sequence Detection system (Applied Biosystems) using the following primers and probes for human ABCA1: forward, 5'CCTGACCGGGTTGTTCCC3'; reverse, 5'TTCTGCCGGATGGTGCTC3'; probe, 5'ACATCCTGGGAAAAGACATTCGCTCTGA3' and for murine ABCA1: forward, 5'TCCGAGCGAATGTCCTTC3'; reverse, 5'GCGCTCAACTTTTACGAAGGC3'; probe, 5'CCCAACTTCTGGCACGGCCTACATC3'. For analyses of ABCA1 protein expression, 100 to 150 µg of protein was separated on 7.5% polyacrylamide gels and was transferred to polyvinylidene difluoride membranes (Millipore) and probed with ABCA1PEP4 antibody20 or anti-GAPDH (Chemicon) as a control. Immunolabeling was detected by enhanced chemiluminescence (Amersham Pharmacia Biotech), and protein levels were quantitated using NIH Image software.

Macrophage Cholesterol Efflux Studies
Thioglycollate-elicited peritoneal macrophages were incubated with 0.5 µCi/mL 3H-cholesterol in DMEM/0.2% BSA for 24 hours at 37°C. To determine cholesterol loading, cells were washed 3 times with washing buffer (50 mmol/L Tris containing 0.9% NaCl, 1 mmol/L EDTA, and 5 mmol/L CaCl2, pH 7.4), lysed in 0.1 mol/L NaOH, and the radioactivity was determined by liquid scintillation counting. Cholesterol efflux was studied by incubation of the cells with DMEM/0.2% BSA alone or supplemented with either 10 µg/mL apoAI (Calbiochem) or 50 µg/mL human HDL. Radioactivity in the medium was determined by scintillation counting after 24 hours of incubation.

Serum Lipid Analyses
After an overnight fast, blood was drawn from each mouse by tail bleeding. Total cholesterol, triglycerides, and phospholipids in serum were determined using enzymatic colorimetric assays (Roche Diagnostics). The distribution of lipids over the different lipoproteins was determined by fractionation using a Superose 6 column (3.2x30 mm; Smart-system; Pharmacia). Total cholesterol, triglyceride, and phospholipid contents in the effluent were determined as above.

Histological Analysis of the Aortic Root
To analyze the effect of macrophage ABCA1 overexpression on atherosclerosis, transplanted mice were euthanized after 9, 12, and 15 weeks on the Western-type diet. The atherosclerotic lesion areas in oil red O–stained cryostat sections of the aortic root were quantified using the Leica image analysis system, consisting of a Leica DMRE microscope coupled to a video camera and Leica Qwin Imaging software (Leica Ltd.). Mean lesion area (in µm2) was calculated from 10 oil red O–stained sections, starting at the appearance of the tricuspid valves. For the assessment of macrophage infiltration, sections were immunolabeled with MOMA-2 (generous gift of Dr G. Kraal, Vrije Universiteit, Amsterdam, The Netherlands). The amount of collagen in the lesions was determined using Masson’s Trichrome Accustain according to manufacturer instructions (Sigma Diagnostics). TUNEL staining of lesions was performed using the In Situ Cell Death Detection kit (Roche). TUNEL-positive nuclei were visualized with Nova Red (Vector), and sections were counterstained with 0.3% methylgreen. Sections treated with DNase (2U per section) served as positive control. All quantifications were done blinded by computer-aided morphometric analysis using the Leica image analysis system.

Statistical Analyses
Statistical analyses were performed using the unpaired Student t test (Instat GraphPad software).


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Generation of LDLr–/– Mice Overexpressing Macrophage ABCA1
To assess the therapeutic potential of increasing macrophage ABCA1 to prevent atherosclerotic lesion development, we used bone marrow transplantation to selectively upregulate ABCA1 in hematopoietic cells. Bone marrow from ABCA1 overexpressing BAC transgenic mice was transplanted into LDLr–/– mice, which represent an established model for the development of atherosclerosis. Genomic DNA isolated from the LDLr–/– mice transplanted with bone marrow from ABCA1 BAC transgenic mice contained both the human and the mouse ABCA1 transcript, whereas the control transplanted group contained only mouse ABCA1, indicating that the bone marrow transfer was successful (Figure 1A). No effect was observed of human ABCA1 overexpression on murine ABCA1 mRNA levels (0.27±0.06 and 0.24±0.03 for human ABCA1 overexpressing macrophages and WT macrophages, respectively). Overexpression of ABCA1 in macrophages resulted in a 2.5-fold increase in ABCA1 protein expression (Figure 1B) and a 60% (n=3; P=0.0006) increase in cholesterol efflux to apoAI (Figure 1C).


Figure 1
View larger version (10K):
[in this window]
[in a new window]
 
Figure 1. Verification of success of bone marrow transplantation. A, Verification of successful reconstitution with donor hematopoietic cells by PCR amplification of the human ABCA1 and murine ABCA1 gene at 20 weeks after transplant using genomic DNA isolated from bone marrow. B, Analyses of the effect of ABCA1 overexpression on macrophage ABCA1 protein levels by Western blotting. C, ApoAI and HDL induced cellular cholesterol efflux from 3H-cholesterol-labeled peritoneal macrophages isolated from LDLr–/– mice transplanted with either ABCA1 BAC (n=3) or control (n=3) bone marrow at 20 weeks after transplant. Statistically significant difference ***P<0.001 compared with WT -> LDLr–/– mice.

Effect of Macrophage ABCA1 Overexpression on Plasma Lipid Levels
On regular chow diet, the majority of the cholesterol in LDLr–/– mice is transported by LDL and HDL, phospholipids by HDL, and triglycerides by very low–density lipoprotein (VLDL) and LDL (Figure 2). In contrast to the ABCA1 BAC transgenic mice that displayed mildly increased HDL cholesterol levels,20 no significant effect on HDL cholesterol, triglyceride, or phospholipid levels was observed when ABCA1 was overexpressed solely in macrophages.


Figure 2
View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Effect of macrophage ABCA1 overexpression in LDLr–/– mice on serum cholesterol, phospholipid, and triglyceride distribution. Blood samples were drawn after an overnight fast at 8 weeks after transplant while feeding regular chow diet (CHOW) and at 17 weeks after bone marrow transplantation after 9 weeks of feeding a high cholesterol Western-type diet (WTD). Sera from individual mice were loaded onto a Superose 6 column, and fractions were collected. Fractions 3 to 7 represent VLDL; fraction 8 to 14, LDL; and fractions 15 to 19, HDL, respectively. The distribution of cholesterol, phospholipids, and triglycerides over the different lipoproteins in WT -> LDLr–/– ({circ}) and ABCA1 BAC -> LDLr–/– (•) chimeras is shown. Values represent the mean±SEM of ≥12 mice. No statistically significant differences were observed.

To induce atherosclerotic lesion development, the transplanted mice were fed Western-type diet starting at 8 weeks after transplantation. On diet feeding, serum cholesterol levels increased &3-fold in both groups of mice because of an increase in VLDL and LDL cholesterol (Table). The increase in VLDL and LDL cholesterol coincided with an increase in phospholipids. No significant effect of macrophage ABCA1 overexpression on serum lipid levels or lipid distribution among the different lipoproteins was observed (Figure 2).


View this table:
[in this window]
[in a new window]
 
Effect of Leukocyte ABCA1 Overexpression in LDLr–/– Mice on Serum Lipid Levels

Effect of Macrophage ABCA1 Overexpression on Atherosclerotic Lesion Initiation and Progression
To investigate the therapeutic potential of increasing macrophage ABCA1 expression as a means of preventing atherosclerosis, we assessed whether and to what degree upregulation of ABCA1 in macrophages affected lesion formation. Lesion development was analyzed in the aortic root of WT -> LDLr–/– mice and in ABCA1 BAC -> LDLr–/– chimeras after 9, 12, and 15 weeks of Western-type diet feeding (Figure 3). After 9 weeks on the Western diet, no significant effect of macrophage ABCA1 overexpression on the atherosclerotic lesion size was observed (245±36x103 µm2 in ABCA1 BAC -> LDLr–/– mice [n=11] versus 210±20x103 µm2 in controls [n=11]). Lesions in both groups of mice were primarily composed of macrophage-derived foam cells (94±2.3% and 94±2.1% for WT and ABCA1 BAC transplanted mice, respectively), indicating that macrophage ABCA1 overexpression does not prevent foam cell formation and thus the initiation of atherosclerosis. Between 9 and 12 weeks of diet feeding, atherosclerosis in the mice transplanted with control bone marrow progressed further in size to 513±56x103 µm2 (n=14). However, in the ABCA1 BAC -> LDLr–/– mice, no time-dependent increase in lesion size was observed. The mean atherosclerotic lesion area was thus 3.1-fold smaller (164±15x103 µm2; n=14, P=0.0008) compared with control transplanted animals. Interestingly, at this time point, lesions were still primarily composed of macrophage-derived foam cells (88±3.0% and 91±4.0% for WT and ABCA1 BAC transplanted mice, respectively). Thus, although macrophage ABCA1 overexpression did not inhibit the initiation of foam cell formation, the progression of lesions was markedly inhibited by upregulation of ABCA1 in macrophages. Between 12 and 15 weeks of diet feeding, lesions in control transplanted mice had progressed only slightly in size to 640±59x103 µm2 (n=9), whereas lesion development in mice transplanted with ABCA1 overexpressing bone marrow had increased to 393±27x 103 µm2 (n=9; P=0.0015). At this time point, the lesion composition was markedly different. The macrophage content of the lesions of mice transplanted with WT bone marrow was 40±4.0%, whereas the collagen content was 15±2.2%. In contrast, mice transplanted with ABCA1 overexpressing bone marrow contained more macrophages and less collagen (53±3.9% [P=0.026] and 8.9±1.1% [P=0.029], respectively), indicative of less advanced lesions. Also, a predominant part of the lesions consisted of acellular necrotic areas. However, the acellular area of the lesions of mice reconstituted with ABCA1 overexpressing bone marrow was 2-fold smaller compared with control transplanted animals (53±17x103 µm2 in ABCA1 BAC and 108±20x103 µm2 in WT, respectively; P=0.057). Thus, although lesion progression was not completely halted by overexpression of ABCA1 in macrophages, the progression was still largely reduced.


Figure 3
View larger version (57K):
[in this window]
[in a new window]
 
Figure 3. Macrophage ABCA1 overexpression in LDLr–/– mice prevents atherosclerotic lesion progression. Formation of atherosclerotic lesions was determined at 17, 20, and 23 weeks after transplant at the aortic root of WT -> LDLr–/– and ABCA1 BAC -> LDLr–/– chimeras that were fed a high-cholesterol Western-type diet for 9, 12, and 15 weeks, respectively. The mean lesion area was calculated from oil red O–stained cross-sections of the aortic root at the level of the tricuspid valves. Values represent the mean of 9 to 14 mice. Original magnification x50. Lesions in ABCA1 BAC -> LDLr–/– mice showed a statistically significant difference of ***P<0.001 or **P<0.01 when compared with WT -> LDLr–/– mice.

Because ABCA1 has been implicated in the removal of apoptotic cells, the effect of macrophage ABCA1 overexpression on the number of TUNEL-positive cells was determined at the different stages of lesion development (Figure 4). After 9 weeks on Western-type diet, no effect of macrophage ABCA1 overexpression on the absolute number of TUNEL-positive cells in the lesions was observed. However, after 12 and 15 weeks, the number of TUNEL-positive cells was significantly lower in the ABCA1 BAC transplanted animals. In addition, the percentage of apoptotic nuclei to the total number of nuclei was decreased in lesions of mice transplanted with ABCA1 BAC overexpressing bone marrow. However, this effect was also observed at 9 weeks on Western-type diet and was independent of the extent of lesion development.


Figure 4
View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Effect of macrophage ABCA1 overexpression in LDLr–/– mice on apoptosis in atherosclerotic lesions. Numbers of apoptotic nuclei were quantified in atherosclerotic lesions at the aortic root of WT -> LDLr–/– and ABCA1 BAC -> LDLr–/– chimeras that were fed a high-cholesterol Western-type diet for 9, 12, and 15 weeks, respectively. Apoptosis is expressed as the absolute number of TUNEL-positive nuclei (left) and the percentage TUNEL-positive to total nuclei (right) in the atherosclerotic lesion. The absolute number of apoptotic nuclei in lesions in ABCA1 BAC -> LDLr–/– mice showed a statistically significant difference of *P<0.05 when compared with WT -> LDLr–/– (open bars) mice. Two-way ANOVA analysis showed that the percentage of apoptotic nuclei to the total number of nuclei was significantly lower (P<0.05) in lesions of ABCA1 BAC -> LDLr–/– (closed bars) mice.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Insights into the role of ABCA1 in atherogenesis have been gained from both patients affected with Tangier disease and recently developed animal models. Patients with mutations in ABCA1 are significantly at risk for coronary artery disease.21,22 The cardioprotective effects of ABCA1 have been confirmed recently in animal models. Overexpression of ABCA1 resulted in decreased susceptibility to spontaneous atherosclerosis in apoE knockout mice15 and in C57BL/6 mice with diet-induced atherosclerosis.16 In addition to its expression in macrophages, ABCA1 is also highly expressed by hepatocytes in the liver, where it is important for HDL lipidation.23–26 In agreement, the reduction in atherosclerosis susceptibility as a result of ABCA1 overexpression coincided with an increase in HDL cholesterol levels. Using bone marrow transplantation, we17 and Aeillo et al27 have shown that selective inactivation of ABCA1 in macrophages results in markedly increased atherosclerosis in different animal models without affecting HDL cholesterol levels. ABCA1-dependent cholesterol efflux is thus a crucial factor in the prevention of excessive cholesterol accumulation in macrophages of the arterial wall and their transformation into foam cells.

To study the therapeutic potential of upregulation of macrophage ABCA1 to prevent atherosclerosis, we determined atherosclerosis susceptibility of chimeras that specifically overexpress ABCA1 on macrophages, created by transplantation of bone marrow from human ABCA1 BAC transgenic mice into LDLr–/– mice. In this study, we show that overexpression of ABCA1 in macrophages did not influence initial lesion development in LDLr–/– mice. However, specific deletion of macrophage ABCA1 in LDLr–/– mice did induce initial lesion development (M.V.E., unpublished data, 2005). The expression of ABCA1 in macrophages is tightly controlled by intracellular cholesterol levels.18,19 Its activity is dramatically increased on cholesterol loading of macrophages and the subsequent transformation into foam cells. It is therefore conceivable that cholesterol efflux via ABCA1 is already maximally activated in macrophages in the atherosclerotic lesion. As a result, further upregulation of ABCA1 expression does not inhibit initial lesion development. However, ABCA1 overexpression did inhibit the progression of the size of these fatty streak lesions. During the progression of atherosclerosis, macrophage foam cells accumulate large amounts of unesterified cholesterol, a process that is thought to contribute to macrophage death.28 Increased levels of intracellular free cholesterol accelerate the degradation of ABCA1 in macrophages.29 In agreement, Albrecht et al recently showed that the microenvironment of the atherosclerotic plaque induces ABCA1 protein degradation.30 This might provide a possible explanation for the fact that overexpression of ABCA1 did not inhibit initial lesion formation, whereas the progression of these lesions was inhibited. Progression of atherosclerotic lesions is also characterized by an ongoing chronic inflammatory reaction and extensive cellular necrosis and apoptosis.31 Several lines of evidence have suggested a role for ABCA1 in the engulfment of apoptotic cells.32–34 In agreement, we demonstrate that the percentage of apoptotic nuclei to the total number of nuclei was decreased in lesions of mice transplanted with ABCA1 BAC overexpressing bone marrow. However, this effect was independent of the extent of lesion development. It is thus unlikely that the protective effects of macrophage ABCA1 overexpression in later stages of lesion development are solely the result of accelerated clearance of apoptotic cells.

In conclusion, the important effect of macrophage ABCA1 overexpression in prevention of atherosclerotic lesion progression reported in this study renders this transporter an attractive target for the development of novel therapeutic agents designed to prevent the progression of atherosclerosis.


*    Acknowledgments
 
This work was supported by the Netherlands Heart Foundation (grant 2001T041) and an International HDL research award awarded to M.V.E.


*    Footnotes
 
M.R.H. and T.J.C.V.B. contributed equally to this study.

Received July 25, 2005; accepted January 18, 2006.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Ross R. Atherosclerosis-An inflammatory disease. N Engl J Med. 1991; 340: 115–125.

2. Graeves DR, Gough PJ, Gordon S. Recent progress in defining the role of scavenger receptors in transport, atherosclerosis and host defense. Curr Opin Lipidol. 1998; 9: 425–432.[CrossRef][Medline] [Order article via Infotrieve]

3. Miller GJ, Miller NE. Plasma high-density-lipoprotein concentration and development of ischemic heart disease. Lancet. 1975; 1: 16–19.[CrossRef][Medline] [Order article via Infotrieve]

4. Wilson PWF, Abbott RD, Castelli WP. High density lipoprotein cholesterol and mortality: the Framingham Heart Study. Arteriosclerosis. 1988; 8: 737–741.[Abstract/Free Full Text]

5. Goldbourt U, Yaari S, Medalie JH. Isolated low HDL cholesterol as a risk factor for coronary heart disease mortality: a 21 year follow-up of 8000 men. Arterioscler Thromb Vasc Biol. 1997; 17: 107–113.[Abstract/Free Full Text]

6. Barter PJ, Nicholls S, Rye KA, Anantharamaiah GM, Navab M, Fogelman AM. Antiinflammatory properties of HDL. Circ Res. 2004; 95: 764–772.[Abstract/Free Full Text]

7. Assmann G, Gotto AM Jr. HDL cholesterol and protective factors in atherosclerosis. Circulation. 2004; 109: III8–III14.[Medline] [Order article via Infotrieve]

8. Von Eckardstein A, Nofer JR, Assmann G. High density lipoproteins and arteriosclerosis. Role of cholesterol efflux and reverse cholesterol transport. Arterioscler Thromb Vasc Biol. 2001; 21: 13–27.[Abstract/Free Full Text]

9. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Genest JJr, Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat Genet. 1999; 22: 336–345.[CrossRef][Medline] [Order article via Infotrieve]

10. Bodzioch M, Orso M, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G. The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease. Nat Genet. 1999; 22: 347–351.[CrossRef][Medline] [Order article via Infotrieve]

11. Rust S, Rosier M, Funke H, von Eckardstein A, Cullen P, Kroes HY, Hordijk R, Geisel J, Kastelein J, Molhuizen HO, Schreiner M, Mischke A, Hahmann HW, Assmann G. Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1. Nat Genet. 1999; 22: 352–355.[CrossRef][Medline] [Order article via Infotrieve]

12. Clee SM, Zwinderman AH, Engert JC, Zwarts KY, Molhuizen HO, Roomp K, Jukema JW, van Wijland M, van Dam M, Hudson TJ, Brooks-Wilson A, Genest JJr, Kastelein JJ, Hayden MR. Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease. Circulation. 2001; 103: 1198–1205.[Abstract/Free Full Text]

13. Tregouet DA, Ricard S, Nicaud V, Arnould I, Soubigou S, Rosier M, Duverger N, Poirier O, Mace S, Kee F, Morrison C, Denefle P, Tiret L, Evans A, Deleuze JF, Cambien F. In-depth haplotype analysis of ABCA1 gene polymorphisms in relation to plasma ApoA1 levels and myocardial infarction. Arterioscler Thromb Vasc Biol. 2004; 24: 775–781.[Abstract/Free Full Text]

14. Brousseau ME, Bodzioch M, Schaefer EJ, Goldkamp AL, Kielar D, Probst M, Ordovas JM, Aslanidis C, Lackner KJ, Bloomfield Rubins H, Collins D, Robins SJ, Wilson PW, Schmitz G. Common variants in the gene encoding ATP-binding cassette transporter 1 in men with low HDL cholesterol levels and coronary heart disease. Atherosclerosis. 2001; 154: 607–611.[CrossRef][Medline] [Order article via Infotrieve]

15. Singaraja RR, Fievet C, Castro G, James ER, Hennuyer N, Clee SM, Bissada N, Choy JC, Fruchart JC, McManus BM, Staels B, Hayden MR. Increased ABCA1 activity protects against atherosclerosis. J Clin Invest. 2002; 110: 35–42.[CrossRef][Medline] [Order article via Infotrieve]

16. Joyce CW, Amar MJ, Lambert G, Vaisman BL, Paigen B, Najib-Fruchart J, Hoyt RFJr, Neufeld ED, Remaley AT, Fredrickson DS, Brewer HBJr, Santamarina-Fojo S. The ATP binding cassette transporter A1 (ABCA1) modulates the development of aortic atherosclerosis in C57BL/6 and apoE-knockout mice. Proc Natl Acad Sci U S A. 2002; 99: 407–412.[Abstract/Free Full Text]

17. Van Eck M, Bos IST, Kaminski WE, Orso E, Rothe G, Twisk J, Bottcher A, Van AmersfoortES, Christiansen-Weber TA, Fung-Leung WP, Van BerkelTJ, Schmitz G. Leukocyte ATP-binding cassette transporter A1 (ABCA1) deficiency promotes atherosclerotic lesion development. Proc Natl Acad Sci U S A. 2002; 99: 6298–6303.[Abstract/Free Full Text]

18. Langmann T, Klucken J, Reil M, Liebisch G, Luciani MF, Chimini G, Kaminski WE, Schmitz G. l. Molecular cloning of the human ATP-binding cassette transporter 1 (hABC1): evidence for sterol-dependent regulation in macrophages. Biochem Biophys Res Commun. 1999; 257: 29–33.[CrossRef][Medline] [Order article via Infotrieve]

19. Wade DP, Owen JS. Regulation of the cholesterol efflux gene, ABCA1. Lancet. 2001; 357: 161–163.[CrossRef][Medline] [Order article via Infotrieve]

20. Singaraja RR, Bocher V, James ER, Clee SM, Zhang LH, Leavitt BR, Tan B, Brooks-Wilson A, Kwok A, Bissada N, Yang YZ, Liu G, Tafuri SR, Fievet C, Wellington CL, Staels B, Hayden MR. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and apoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements intron 1. J Biol Chem. 2001; 276: 33969–33979.[Abstract/Free Full Text]

21. Clee SM, Kastelein JJ, Van Dam M, Marcil M, Roomp K, Zwarts KY, Collins JA, Roelants R, Tamasawa N, Stulc T, Suda T, Ceska R, Boucher B, Rondeau C, DeSouich C, Brooks-Wilson A, Molhuizen HO, Frohlich J, Genest JJr, Hayden MR. Age and residual cholesterol efflux affect HDL cholesterol levels and coronary artery disease in ABCA1 heterozygotes. J Clin Invest. 2000; 106: 1263–1270.[Medline] [Order article via Infotrieve]

22. Van DamMJ, de Groot E, Clee SM, Hovingh GK, Roelants R, Brooks-Wilson A, Zwinderman AH, Smit AJ, Smelt AH, Groen AK, Hayden MR, Kastelein JJ. Association between increased arterial-wall thickness and impairment in ABCA1-driven cholesterol efflux: an observational study. Lancet. 2002; 359: 37–41.[CrossRef][Medline] [Order article via Infotrieve]

23. Kiss RS, McManus DC, Franklin V, Tan WL, McKenzie A, Chimini G, Marcel YL. The lipidation by hepatocytes of human apolipoprotein A-I occurs by both ABCA1-dependent and -independent pathways. J Biol Chem. 2003; 278: 10119–10127.[Abstract/Free Full Text]

24. Basso F, Freeman L, Knapper Cl, Remaley A, Stonik J, Neufeld EB, Tansey T, Amar MJ, Fruchart-Najib J, Duverger N, Santamarina-Fojo S, Brewer HB Jr. Role of the hepatic ABCA1 transporter in modulating intrahepatic cholesterol and plasma HDL cholesterol concentrations. J Lipid Res. 2003; 44: 296–302.[Abstract/Free Full Text]

25. Wellington CL, Brunham LR, Zhou S, Singaraja RR, Visscher H, Gelfer A, Ross C, James E, Liu G, Huber MT, Yang YZ, Parks RJ, Groen A, Fruchart-Najib J, Hayden MR. Alterations of plasma lipids in mice via adenoviral-mediated hepatic overexpression of human ABCA1. J Lipid Res. 2003; 44: 1470–1480.[Abstract/Free Full Text]

26. Timmins JM, Lee J-Y, Boudyguina E, Kluckman KD, Brunham LR, Mulya A, Gebre AK, Coutinho JM, Colvin PL, Smith TL, Hayden MR, Maeda N, Parks JS. Targeted inactivation of hepatic Abca1 causes profound hypoalphalipoproteinemia and kidney hypercatabolism of apoA-I. J Clin Invest. 2005; 115: 1333–1142.[CrossRef][Medline] [Order article via Infotrieve]

27. Aiello RJ, Brees D, Bourassa PA, Royer L, Lindsey S, Coskran T, Haghpassand M, Francone OL. Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages. Arterioscler Thromb Vasc Biol. 2002; 22: 630–637.[Abstract/Free Full Text]

28. Tabas I. Free cholesterol-induced cytotoxicity. A possible contributing factor to macrophage foam cell necrosis in advanced atherosclerotic lesions. Trends Cardiovasc Med. 1997; 7: 256–263.[CrossRef]

29. Feng B, Tabas I. ABCA1-mediated cholesterol efflux is defective in free cholesterol-loaded macrophages. J Biol Chem. 2002; 277: 43271–43280.[Abstract/Free Full Text]

30. Albrecht C, Soumian S, Amey JS, Sardini A, Higgins CF, Davies AH, Gibbs RG. ABCA1 expression in carotid atherosclerotic plaques. Stroke. 2004; 35: 2801–2806.[Abstract/Free Full Text]

31. Geng Y-J, Libby P. Progression of the atheroma. A struggle between death and procreation. Arterioscler Thromb Vasc Biol. 2002; 22: 1370–1380.[Abstract/Free Full Text]

32. Hamon Y, Chambenoit O, Chimini G. ABCA1 and the engulfment of apoptotic cells. Biochim Biophys Acta. 2002; 1585: 64–71.[Medline] [Order article via Infotrieve]

33. Luciani MF, Chimini G. The ATP binding cassette transporter ABC1, is required for the engulfment of corpses generated by apoptotic cell death. EMBO J. 1996; 15: 226–235.[Medline] [Order article via Infotrieve]

34. Hamon Y, Broccardo C, Chambenoit O, Luciani MF, Toti F, Chaslin S, Freyssinet JM, Devaux PF, McNeish J, Marguet D, Chimini G. ABC1 promotes engulfment of apoptotic cells and transbilayer redistribution of phosphatidylserine. Nat Cell Biol. 2000; 2: 399–406.[CrossRef][Medline] [Order article via Infotrieve]




This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. R. Brunham, R. R. Singaraja, M. Duong, J. M. Timmins, C. Fievet, N. Bissada, M. H. Kang, A. Samra, J.-C. Fruchart, B. McManus, et al.
Tissue-Specific Roles of ABCA1 Influence Susceptibility to Atherosclerosis
Arterioscler Thromb Vasc Biol, April 1, 2009; 29(4): 548 - 554.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
A. Baldan, D. D. Bojanic, and P. A. Edwards
The ABCs of sterol transport
J. Lipid Res., April 1, 2009; 50(Supplement): S80 - S85.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
D. J. Rader, E. T. Alexander, G. L. Weibel, J. Billheimer, and G. H. Rothblat
The role of reverse cholesterol transport in animals and humans and relationship to atherosclerosis
J. Lipid Res., April 1, 2009; 50(Supplement): S189 - S194.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
V. Paul, H. H. D. Meyer, K. Leidl, S. Soumian, and C. Albrecht
A novel enzyme immunoassay specific for ABCA1 protein quantification in human tissues and cells
J. Lipid Res., October 1, 2008; 49(10): 2259 - 2267.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. Burgess, K. Naus, J. Chan, V. Hirsch-Reinshagen, G. Tansley, L. Matzke, B. Chan, A. Wilkinson, J. Fan, J. Donkin, et al.
Overexpression of Human ABCG1 Does Not Affect Atherosclerosis in Fat-Fed ApoE-Deficient Mice
Arterioscler Thromb Vasc Biol, October 1, 2008; 28(10): 1731 - 1737.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J. F. Oram
The ins and outs of ABCA
J. Lipid Res., June 1, 2008; 49(6): 1150 - 1151.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. Out, M. Hoekstra, K. Habets, I. Meurs, V. de Waard, R. B. Hildebrand, Y. Wang, G. Chimini, J. Kuiper, T. J.C. Van Berkel, et al.
Combined Deletion of Macrophage ABCA1 and ABCG1 Leads to Massive Lipid Accumulation in Tissue Macrophages and Distinct Atherosclerosis at Relatively Low Plasma Cholesterol Levels
Arterioscler Thromb Vasc Biol, February 1, 2008; 28(2): 258 - 264.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Yan, M. I. Mayranpaa, J. Wong, J. Perttila, M. Lehto, M. Jauhiainen, P. T. Kovanen, C. Ehnholm, A. J. Brown, and V. M. Olkkonen
OSBP-related Protein 8 (ORP8) Suppresses ABCA1 Expression and Cholesterol Efflux from Macrophages
J. Biol. Chem., January 4, 2008; 283(1): 332 - 340.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
A. Schiopu, B. Frendeus, B. Jansson, I. Soderberg, I. Ljungcrantz, Z. Araya, P. K. Shah, R. Carlsson, J. Nilsson, and G. N. Fredrikson
Recombinant Antibodies to an Oxidized Low-Density Lipoprotein Epitope Induce Rapid Regression of Atherosclerosis in Apobec-1 / /Low-Density Lipoprotein Receptor / Mice
J. Am. Coll. Cardiol., December 11, 2007; 50(24): 2313 - 2318.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M.-D. Wang, V. Franklin, and Y. L. Marcel
In Vivo Reverse Cholesterol Transport From Macrophages Lacking ABCA1 Expression Is Impaired
Arterioscler Thromb Vasc Biol, August 1, 2007; 27(8): 1837 - 1842.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
V. Hirsch-Reinshagen, J. Y. Chan, A. Wilkinson, T. Tanaka, J. Fan, G. Ou, L. F. Maia, R. R. Singaraja, M. R. Hayden, and C. L. Wellington
Physiologically regulated transgenic ABCA1 does not reduce amyloid burden or amyloid-{beta} peptide levels in vivo
J. Lipid Res., April 1, 2007; 48(4): 914 - 923.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. Out, M. Hoekstra, I. Meurs, P. de Vos, J. Kuiper, M. Van Eck, and T. J.C. Van Berkel
Total Body ABCG1 Expression Protects Against Early Atherosclerotic Lesion Development in Mice
Arterioscler Thromb Vasc Biol, March 1, 2007; 27(3): 594 - 599.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
J. F. Oram and A. M. Vaughan
ATP-Binding Cassette Cholesterol Transporters and Cardiovascular Disease
Circ. Res., November 10, 2006; 99(10): 1031 - 1043.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. W. Joyce, E. M. Wagner, F. Basso, M. J. Amar, L. A. Freeman, R. D. Shamburek, C. L. Knapper, J. Syed, J. Wu, B. L. Vaisman, et al.
ABCA1 Overexpression in the Liver of LDLr-KO Mice Leads to Accumulation of Pro-atherogenic Lipoproteins and Enhanced Atherosclerosis
J. Biol. Chem., November 3, 2006; 281(44): 33053 - 33065.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
A. M. Vaughan and J. F. Oram
ABCA1 and ABCG1 or ABCG4 act sequentially to remove cellular cholesterol and generate cholesterol-rich HDL
J. Lipid Res., November 1, 2006; 47(11): 2433 - 2443.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. Out, M. Hoekstra, R. B. Hildebrand, J. K. Kruit, I. Meurs, Z. Li, F. Kuipers, T. J.C. Van Berkel, and M. Van Eck
Macrophage ABCG1 Deletion Disrupts Lipid Homeostasis in Alveolar Macrophages and Moderately Influences Atherosclerotic Lesion Development in LDL Receptor-Deficient Mice
Arterioscler Thromb Vasc Biol, October 1, 2006; 26(10): 2295 - 2300.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Ranalletta, N. Wang, S. Han, L. Yvan-Charvet, C. Welch, and A. R. Tall
Decreased Atherosclerosis in Low-Density Lipoprotein Receptor Knockout Mice Transplanted With Abcg1-/- Bone Marrow
Arterioscler Thromb Vasc Biol, October 1, 2006; 26(10): 2308 - 2315.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
26/4/929    most recent
01.ATV.0000208364.22732.16v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Van Eck, M.
Right arrow Articles by Van Berkel, T. J.C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Van Eck, M.
Right arrow Articles by Van Berkel, T. J.C.
Related Collections
Right arrow Animal models of human disease
Right arrow Pathophysiology
Right arrow Genetically altered mice
Right arrow Lipid and lipoprotein metabolism