Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2006;26:787-793
Published online before print February 9, 2006, doi: 10.1161/01.ATV.0000209500.15801.4e
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
26/4/787    most recent
01.ATV.0000209500.15801.4ev1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, Z.
Right arrow Articles by King, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, Z.
Right arrow Articles by King, G. L.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2006;26:787.)
© 2006 American Heart Association, Inc.


Vascular Biology

Regulation of Vascular Endothelial Growth Factor Expression and Vascularization in the Myocardium by Insulin Receptor and PI3K/Akt Pathways in Insulin Resistance and Ischemia

Zhiheng He; Darren M. Opland; Kerrie J. Way; Kohjiro Ueki; Natalya Bodyak; Peter M. Kang; Seigo Izumo; Rohit N. Kulkarni; Bo Wang; Ronglih Liao; C. Ronald Kahn; George L. King

From the Research Division (Z.H., D.M.O., K.J.W., K.U., R.N.K., R.K., G.L.K.), Joslin Diabetes Center, Harvard Medical School, the Cardiovascular Division (N.B., P.M.K., S.I.), Beth Israel Deaconess Medical Center, Harvard Medical School, and theWhitaker Cardiovascular Institute (B.W., R.L.), Boston University Medical School, Boston, Mass. Current affiliation for B.W. and R.L.: Cardiovascular Division, Brigham and Women’s Hospital, Harvard Medical School, Boston, Mass.

Correspondence to George L. King, MD, Vascular Cell Biology & Complications, Joslin Diabetes Center, 1 Joslin Place, Boston, MA 02215. E-mail george.king{at}joslin.harvard.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Objective— This study characterized the role of insulin receptors and resistance on vascular endothelial growth factor (VEGF) expression and myocardial vascularization in physiological conditions and after ischemia.

Methods and Results— Cardiac microvascular density was reduced by 30% in insulin-resistant Zucker fatty rats versus lean controls. This was associated with a parallel 40% inhibition of insulin-stimulated activation of both Akt and VEGF expression in the myocardium and cardiomyocytes. In contrast, the activation of Erk1/2 by insulin remained unchanged. In cultured cardiomyocytes, insulin or insulin-like growth factor (IGF)-1 increased VEGF mRNA and protein expression by 2-fold. Inhibition of PI3K/Akt, especially Akt2-mediated cascades but not the Ras/MEK/Erk pathway, using chemical inhibitors, dominant negative adenoviral constructs, or siRNA approaches suppressed VEGF mRNA expression by insulin. Ventricular tissues from muscle insulin receptor knockout (MIRKO) mice, which lack insulin receptors in the myocardium, have significant reductions in insulin but not IGF-1 signaling, VEGF expression, and vascular density before and after ischemia versus controls.

Conclusions— Insulin regulates VEGF gene expression and vascularization in the myocardium specifically via insulin receptors and the activation of PI3K/Akt pathway. Selective inhibition of this pathway may lead to the decreases in VEGF expression and capillary density in the myocardium of patients with insulin resistance.

We have shown that insulin stimulate the expression of VEGF in cardiomyocytes primarily via a PI3K/Akt2 activation-dependent pathway. Selective inhibition of this cascade results in the reduction of cardiomyocyte-derived VEGF expression and impaired vascularization at both basal and pathological conditions such as myocardial infarction.


Key Words: cardiomyocyte • collateral circulation • diabetes • insulin resistance • vascularization • VEGF


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMaterials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Patients with type 2 diabetes and insulin resistance have high morbidity and mortality rates, caused mainly by ischemic heart disease (IHD),1 partly caused by reduced collateral vessel formation in response to ischemia in the myocardium.2,3 Patients with concomitant IHD and diabetes have reduced microvessel density in the myocardium as compared with those with IHD alone or healthy subjects.4 Microvessel homeostasis is determined by multiple factors, including the expression and actions of vascular endothelial growth factor (VEGF), a potent angiogenic factor.5 Ventricular cardiomyocytes are a rich source of VEGF production that significantly affects the development and function of cardiac vasculature.6 We and others have previously shown that diabetes and insulin resistance are associated with attenuated cardiac VEGF expression, which may decrease capillary density in the myocardium in diabetic and insulin resistant states,7 leading to cardiac dysfunction8.

Induction of VEGF expression by insulin has been reported in several cell types including vascular smooth muscle cells,9 epithelial cells,10 and fibroblasts,11 but not in cardiomyocytes or in vivo. We have reported that there is a selective loss of insulin’s signaling via PI3K/Akt pathway in the vascular endothelium in insulin-resistant states, which can cause abnormalities in gene expression such as the decreased expression of endothelial nitric oxide synthase.12 However, insulin has not been reported to regulate the vascularization of myocardium directly. We propose that insulin’s signaling and actions may also be decreased in the myocardium and contribute to the reduced expression of VEGF in insulin resistance. Furthermore, we have assessed the importance of insulin receptor and signaling on VEGF expression and vascularization in the myocardium using both insulin resistant and insulin receptor-deficient animals in basal and ischemic states.


*    Materials and Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Materials and Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Isolation and Culture of Rat Cardiomyocyte
Neonatal rat cardiomyocytes (NRCM) and adult rat cardiomyoctes (ARCM) were harvested and cultured as previously described.7,13

Insulin and Insulin-Like Growth Factor-1 Stimulation
Cells were serum-deprived for 16 hours and incubated with 100 nmol/L insulin (Humulin R; Lilly Laboratories, Indianapolis, Ind) or 100 ng/mL (&13.5 nmol/L) insulin-like growth factor (IGF)-1 (Calbiochem, La Jolla, Calif) with or without a 30-minute pretreatment with PD98059 (20 µmol/L) or wortmannin (100 nmol/L) dissolved in 0.01% DMSO (Calbiochem).

Infection of NRCM With Recombinant Adenovirus
Adenoviruses containing cDNA of the LacZ gene or dominant-negative isoforms of Akt, K-Ras, and p85 {alpha}-subunit of PI3K were used to infect cardiomyocytes at 30 to 300 multiplicity of infection as described.14

Transfection of siRNA
Reduction of Akt1 and 2 isoform expressions were achieved by using siRNA approaches developed by Jiang et al.15 Briefly, NRCM was transfected with 20 nmol scrambled siRNA (5'-CGUGCAAUCACGGAAAGCCCA-3'), with the siRNA targeting to either rat Akt1 (5'-AACCAGGACCAUGAGAAGCUG-3') or Akt2 (5'-AACCAGGACCACGAGCGCCUC-3') using lipofectamin2000 (Invitrogen). Cells were assayed 48 hours after transfection.

Animals
Male Zucker fatty rats and age-matched lean controls (Harlan, Indianapolis, Ind) at 14 to 22 weeks of age were used. Insulin resistance was manifested by increases in body weight (567.0±8.2 g in fatty versus 368.3±4.2 g in lean, P<0.0001) and hyperinsulinemia (1.21±0.24 ng/mL in fatty versus 0.12±0.007 ng/mL in lean, P<0.0001) but without diabetes (random blood glucose <250 mg/dL). Characterization of muscle-specific insulin receptor knockout (MIRKO) mice has been described previously.16 Animals were housed in the Joslin animal facility. The Joslin Institutional Animal Care and Use Committee approved all procedures involving animals.

Euglycemic Hyperinsulinemic Clamp
Both Zucker fatty rats and their lean controls were randomly divided into control and insulin infusion (10 mU/kg per minute) groups that were subjected to 1-hour euglycemic insulin clamp17 and then euthanized with CO2. The ventricular tissue was snap-frozen with liquid N2 and immediately stored at –80°C until analysis.

Myocardium Infarction and Ischemia-Reperfusion in Mice and Rats
Mice at 3 months of age were anesthetized by intraperitoneal injection of pentobarbital (25 to 30 µg/g, intraperitoneal) and the coronary artery was ligated after thoracotomy.18 Mice were kept in animal facility for 7 days after surgery and had free access to food and water. Ischemia-reperfusion was performed in lean and fatty rats at 12 weeks of age.19 Left descending coronary artery was blocked for 1 hour and released. Rats were kept for an additional 7 days and euthanized. Heart tissues were obtained in dilated phase and processed for histological analysis.

TaqMan RT-PCR
Quantitative real-time polymerase chain reaction (PCR) was performed using the ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, Calif). Primers for VEGF (Forward: 5'-CGCAAGAAATCCCGGTTTAA-3' and Reverse: 5'-CAAATGCTTTCTCCGCTCTGA-3') were used at a concentration of 1 µmol/L and probes (6-FAM)TCCTGGAGCGTTCACTGTGAGCCTT(TAMRA) were used at a concentration of 250 nmol/L. Reverse-transcription PCR was performed using the following parameters: 48°C for 30 minutes, 95°C for 10 minutes, 40 cycles of 95°C for 15 seconds, and 60°C for 1 minute. Relative quantifications of gene expression were calculated using internal control normalization to 18S ribosomal RNA (Applied Biosystems).

VEGF Enzyme-Linked Immunosorbent Assay
VEGF in the conditioned media was determined using Quantikine M mouse VEGF immunoassay (R&D system).

Immunoblot Assay
Proteins were collected from cultured cells or frozen tissue lysates, electrophoresed, and blotted with antibodies against phospho-Akt, phospho-Erk1/2 (Cell Signaling), total Erk1/2, total Akt (Santa Cruz), and Akt1 and 2 (UpState). Densitometric quantification was performed using ImageQuant software (Biosciences, Sunnyvale Calif).7

Immunohistochemical Staining
Ventricles were fixed in 4% paraformaldehyde, paraffin embedded, and then sectioned at 5-µm thickness (Histology Core, JDC, Boston, Mass). Endothelial cells were stained by Griffonia Simplicifolia Lectin I (GSL-I) (Vector Laboratories) or Ki67 (BD Bioscience) and evaluated using ImagePro Plus 5.18

Statistical Analysis
All results are expressed as mean±standard deviation (SD). Differences among groups were analyzed by 1-way analysis of variance (ANOVA) followed by Student-Newman-Keuls test. Comparisons between the mean values of 2 groups were performed using Student t test with P<0.05 considered to be significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
*Results
down arrowDiscussion
down arrowReferences
 
Insulin Stimulates VEGF Expression in Cardiomyocytes Via a PI3K/Akt-Dependent Pathway
Insulin-induced VEGF mRNA expression in cultured NRCM after 12 hours of incubation in a concentration-dependent manner (Figure 1A). VEGF mRNA levels were elevated at all concentrations but were significantly higher at 50 (2-fold) and 100 (2.3-fold) nmol/L of insulin above control (both P<0.001). At concentrations >100 nmol/L, insulin did not further increase VEGF expression. A 2-fold increase (P<0.05) in VEGF protein was detected by ELISA assay in conditioned media from NRCM stimulated with 100 nmol/L insulin as compared with controls (Figure 1B).


Figure 1
View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Effects of insulin on VEGF mRNA and protein expression in NRCM. A, Concentration-dependent effect of insulin after 12 hours. B, Effect of insulin on VEGF protein levels in media conditioned from cells treated with insulin (100 nmol/L) (n=6).

Because insulin stimulated the phosphorylation of Akt and Erk-1/2 in both adult and neonatal cardiomyocytes (data not shown), we further characterized the signaling pathway mediating insulin’s effects on VEGF expression. In cultured NRCM, insulin-increased VEGF expression by 2.3-fold, which was inhibited by PI3K inhibitor, wortmannin, but was not changed by MEK inhibitor PD98059 (Figure 2A). Similarly, IGF-1 induced a 1.8-fold increase in VEGF mRNA expression at 100 ng/mL (&13.5nmol/L) that was also blocked by wortmannin but not by PD98059 (Figure 2A). Infection with a control adenovirus containing the LacZ gene did not affect VEGF expression in NRCM at either basal or insulin-stimulated states (Figure 2B). Consistent with results from the pharmacological inhibitor studies, suppression of PI3K/Akt pathway using either dominant negative p85 (DN-p85) or Akt (DN-Akt)14,20 completely blocked insulin-stimulated VEGF mRNA expression (Figure 2B). Inhibition of Ras/MEK/Erk-1/2 pathway by dominant-negative Ras (DN-Ras)14,20 had no effect on insulin-stimulated VEGF expression (Figure 2B). To further characterize the isoform-specific action of Akt, we decreased the expression of different Akt isoforms selectively using siRNA gene silencing approaches.15 Because cardiomyocytes do not express significant levels of Akt3 isoform,21 we focused on Akt1 and 2 isoforms. As shown in Figure 2C, transfection of siRNA targeting Akt1 or Akt2 selectively decreased the protein expression of Akt1 and 2 isoforms by 40% and 60%, respectively. Reduction of Akt2 isoform expression clearly and selectively inhibited insulin-induced VEGF expression by 79% (Figure 2D). Inhibition of Akt1, however, increased basal VEGF expression by 5-fold, and the addition of insulin failed to increase VEGF mRNA levels further (Figure 2D).


Figure 2
View larger version (35K):
[in this window]
[in a new window]
 
Figure 2. Effect of PI3K/Akt and Ras/MEK/Erk1/2 pathway inhibition on insulin and IGF-1-induced VEGF mRNA expression in NRCM. A, Insulin (100 nmol/L) or IGF-1 (13.5 nmol/L) stimulation with or without wortmannin (PI3K inhibitor) and PD98059 (MEK inhibitor). B, Effects of infection with adenoviral vectors containing LacZ, dominant-negative isoforms of p85 (DN-p85), Akt (DN-Akt), and Ras (DN-Ras) on VEGF mRNA expression stimulated by insulin (100 nmol/L) for 12 hours. n=5 experiments. N.S. indicates not significant. C, Transfection of Akt isoform-specific siRNA reduces protein expression of Akt isoform expression. D, Insulin-induced VEGF mRNA expression was inhibited by the reduction of protein expression of Akt isoforms.

Activation of Akt, Erk, and JNK-1 by Insulin in Cardiomyocytes from Zucker Lean and Fatty Rats In Vitro and In Vivo
To characterize insulin’s actions in control and insulin resistant states, cardiomyocytes were isolated from adult Zucker lean and fatty rats and evaluated for insulin-mediated activation of PI3K/Akt and MEK/Erk pathways using phosphorylation of Akt serine473 and Erk-1/2 threonine202/tyrosine204 as surrogate markers for their activation, respectively. Insulin (100 nmol/L) increased mRNA expression of VEGF by 2.3-fold (P<0.05) in cultured cardiomyocytes from Zucker lean control rats, which was not observed in cells from insulin resistant Zucker fatty rats (Figure 3A). In addition, basal VEGF expression was decreased by 40% in cardiomyocytes cultured from fatty rats as compared with the lean controls (Figure 3A). This finding is similar to previous results in ventricular tissues,7 suggesting that cultured cardiomyocytes retained their in vivo phenotype. Stimulation by insulin (100 nmol/L) for 10 minutes significantly increased the phosphorylation of Akt (4.3 fold, P<0.05) in cardiomyocytes from lean control rats but failed to activate Akt significantly in cells from the fatty rats (Figure 3B). In contrast, insulin stimulated phosphorylation of Erk-1/2 to a similar extent in cardiomyocytes from both lean (2.8 fold, P<0.001) and fatty (2.4 fold, P<0.05) rats (Figure 3C). The potential role of JNK-1 activation in the selective inhibition of Akt phosphorylation by insulin was evaluated by the expression of phospho-JNK-1, p-jun and c-fun, which were the same in Zucker lean and fatty rats. (Figure 3D).


Figure 3
View larger version (41K):
[in this window]
[in a new window]
 
Figure 3. Insulin’s effect on VEGF mRNA expression, Akt and Erk1/2 activation in cardiomyocytes isolated from lean (Lean) and fatty (Fatty) Zucker rats. A, VEGF mRNA expression after the addition of insulin (100 nmol/L) for 12 hours. B, Stimulation of Akt phosphorylation (p-Akt) with or without insulin for 10 minutes. C, Erk1/2 phosphorylation (p-Erk) after 10 minutes of insulin stimulation. D, Expression of JNK-1, p-jun and c-jun in cardiomyocytes from lean and fatty rats with or without insulin stimulation. n=3 to 5. N.S. indicates not significant.

In vivo stimulation with a bolus of insulin (10 U) for 10 minutes increased Akt phosphorylation by 3.5-fold (P<0.01) in the ventricular tissues of Zucker lean rats but not in the Zucker fatty rats (Figure 4A). Euglycemic insulin clamp was performed at an insulin infusion rate of 10 mU/kg per minute for 1 hour and induced a 2.3-fold increase in Akt phosphorylation (P<0.05) in the myocardium of healthy Zucker lean rats (Figure 4B). In contrast, insulin’s effect was significantly inhibited in the ventricles of insulin resistant Zucker fatty rats (Figure 4B).


Figure 4
View larger version (34K):
[in this window]
[in a new window]
 
Figure 4. Comparison of Akt phosphorylation in the myocardium of lean (Lean) and obese (Fatty) Zucker rats. Analysis of insulin-induced Akt phosphorylation in the myocardium in vivo after (A) a 10-minute bolus injection of insulin (10 U) or (B) 1-hour euglycemic insulin clamp in lean and obese Zucker rats (n=5 in both groups). Signals of the phospho-Akt (p-Akt) were quantitated by densitometric scanning and normalized to Akt. N.S. indicates not significant.

Blood Vessel Density in the Myocardium of Lean and Obese Rats at Basal State and After Ischemia-Reperfusion
The effect of myocardial insulin resistance on blood vessel density was examined in the ventricles of Zucker obese and lean rats by immunohistochemical staining using endothelial cell-specific marker Griffonia Simplicifolia Lectin I (GSL-I).18 Insulin resistant fatty rats demonstrated a 30% reduction (P<0.01) in vessel density compared with their age matched lean controls (Figure IA and IB, available online at http://atvb.ahajournals.org). To assess reactive vessel formation, the left coronary descending artery (LCD) was occluded for 1 hour before the removal of the suture and the rats were allowed to recover for 7 more days. Obvious tissue damages were noted in the regions irrigated by LCD (data not shown). Blood vessel density was quantified by measuring the signal of GSL-I over the peri-infarction. This revealed a 40% decrease in capillary density in the fatty rats versus the lean rats, although both groups had increased vessel density in the peri-infarcted zone when compared with basal states (data not shown). Morphologically, lean rats displayed a substantial number of dilated vessels in the peri-infarcted zone and this phenotype was absent in the insulin resistant fatty rats (Figure IC and ID).

Effect of Insulin Receptors on Cardiac VEGF Expression and Vascularization
The physiological significance of insulin receptors and their signaling pathways in cardiac VEGF expression and vascularization were directly investigated using hearts from muscle-specific insulin receptor knockout (MIRKO) mice.16 Insulin injection (5 U/kg) into LoxP controls via the inferior vena cava increased the phosphorylation of Akt in the myocardium. This effect of insulin on Akt activation however was decreased by 68% in MIRKO mice (Figure 5). In contrast, infusion of IGF-1 in vivo increased p-Akt expression in both LoxP and MIRKO mice to a similar extent (Figure 5). MIRKO mice at the age of 6 months showed a 45% reduction of VEGF mRNA expression (P<0.05) in the myocardium compared with LoxP controls (Figure 6A). Protein expression of VE-Cadherin (VE-Cad), a marker of endothelial cells, indicated a reduction of 20%±25% in the ventricular tissue from MIRKO mice versus LoxP mice, which was not statistically significant (Figure 6B). To support the finding that capillary density may also be decreased in parallel with changes in VEGF mRNA and VE-Cad, we measured blood vessel density by GSL-I staining (Figure IIA, IIB, and IIC, available online at http://atvb.ahajournals.org), which was decreased by 24%±12% (P<0.05) at basal state.


Figure 5
View larger version (41K):
[in this window]
[in a new window]
 
Figure 5. VEGF mRNA expression in the myocardium of MIRKO mice and lox control (LoxP) littermates. Insulin and IGF-1-induced p-Akt expression in cardiac tissue from MIRKO mice.


Figure 6
View larger version (20K):
[in this window]
[in a new window]
 
Figure 6. Expression of VEGF mRNA is decreased in the myocardial from MIRKO mice. A, VEGF mRNA expression in the myocardium. n=3. B, Expression of VE-cadherin protein in the myocardium (n=4).

Characterization of Vascularization in MIRKO Mice After Ischemia
We further evaluated vascularization in the peri-infarcted zone in ventricular tissues from MIRKO and LoxP mice 7 days after coronary artery ligation. Mortality due to cardiac rupture is similar in MIRKO mice (57%; 4/7) and LoxP controls (50%; 2/4). These hearts were processed for GSL-I staining and revealed a 41% reduction (P<0.05) of blood vessels in the peri-infarcted zone in MIRKO mice as compared with LoxP control mice (Figure IID, IIE, and IIF). Costaining of the sections for Ki67 expression, a nuclear marker of active cellular proliferation, and GSL-I showed that the proliferation rate of the endothelial cells from LoxP and MIRKO mice was not significantly different (Figure IIIA to IIIG, available online at http://atvb.ahajournals.org).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
*Discussion
down arrowReferences
 
We have reported previously that in insulin resistant or diabetic states, the expression of VEGF and its receptors in the myocardium is decreased, although it can be normalized by insulin treatment.7 Our current findings show that insulin can regulate VEGF expression in the myocardium, which is inhibited in insulin resistance. We have demonstrated that insulin at physiological levels induced significant increases in VEGF expression in cardiomyocytes. The results from MIRKO mice provide strong evidence that insulin receptors are critical in the maintenance of VEGF expression at physiological concentrations in the cardiomyocytes. Furthermore, loss of this signaling cascade impaired reactive angiogenesis in pathological conditions such as ischemia-reperfusion damage or myocardial infarction. It is interesting to note that the expression of VEGF and the capillary density in the MIRKO mice are abnormal, even though the IGF-1/PI3K/Akt axis was intact. These results suggest that insulin and IGF-1 may have different signaling mechanisms to regulate VEGF expression in the myocardium, even though both can induce VEGF expression via the activation of PI3K/Akt pathway.

This study showed for the first time that insulin signaling and its effects on VEGF mRNA expression are similar in neonatal and adult rat cardiomyocytes. Insulin binds to insulin receptors and activates IRS proteins to recruit multiple signaling molecules including PI3K, Nck, Grb2, and others, resulting in the activation of Akt and Erk1/2 pathways.22 Although both the PI3K/Akt and MEK/Erk cascades are critical in the mediation of insulin’s action, insulin’s effect on VEGF expression in the myocardium is mediated mainly through the Akt pathway and not mediated by MAPK activation. This finding differs from our previous report that insulin regulates VEGF production via both PI3K/Akt and Erk pathways in aortic smooth muscle cells.9 However, our current findings are similar to those in skeletal muscle, which exhibits increased VEGF expression and capillary density when the constitutive active form of Akt is overexpressed.23

These results demonstrate that insulin signaling via PI3K/Akt pathway in the myocardium, especially in cardiomyocytes, is selectively inhibited in obesity-induced insulin resistant states, whereas the Ras/MEK/Erk-1/2 signaling cascade remains fully responsive. Similar findings have been reported in the microvasculature9 and skeletal muscles.24 We have proposed that the selective inhibition of insulin’s action via the PI3K/Akt pathway in vascular tissues may induce a pro-atherogenic state in insulin resistance, because this pathway mediates insulin’s effects on endothelial nitric oxide synthase expression and activation in the endothelium.12 These findings provide the first direct evidence that insulin signaling is selectively inhibited in cardiomyocytes of Zucker rats. At the biochemical level, selective insulin resistance could be caused by metabolic derangements such as hyperglycemia, dyslipidemia, or elevation of free fatty acids that alter intracellular signaling cascades. In this study, cardiomyocytes from Zucker obese rats retain insulin resistance even in culture, suggesting that the inhibition of insulin’s action can persist for days even when the metabolic derangements have been removed. The mechanisms underlying persistent insulin resistance could be multiple, for example, the activation of PKC12 and JNK-125 pathways. In Zucker fatty rats, it is unlikely that JNK-1 activation is involved because no changes in either expression or activation were observed in cardiomyocytes from lean and fatty rats (Figure 3D). Another possibility is the activation of JAK2 by angiotensin II in cardiac tissue which may be responsible for the selective inhibition of the insulin-mediated activation of the PI3K/Akt pathway.26 Further studies are in progress to determine whether persistent activation of PKC, especially the ß isoforms, is mediating the selective inhibition of PI3K/Akt pathways in the myocardium of animals with obesity-induced insulin resistance, because activation of PKCß isoforms has been suggested to mediate angiotensin II-induced JAK phosphorylation in vascular smooth muscle cells.27 This is possible because PKC activation induced by diabetes has been shown to persist for many years28 and could be caused by enhanced PKCß activity caused by diabetes or glucose.

Selectively inhibiting PI3K/Akt pathway could impede myocardial function in several ways. Suppression of insulin-induced Akt activation in the myocardium can affect cardiac function by decreasing glucose transport and utilization, which will increase the myocardium’s dependence on free fatty acids for fuel consumption, as has been reported in both diabetic and insulin resistant states.29 Our results from MIRKO mice and insulin resistant Zucker rats demonstrate that insulin receptor and its action via the PI3K/Akt pathway play an important role in the expression of VEGF and vascularization of the myocardium at basal and ischemic states. This is most likely not caused by systemic metabolic disorders in the MIRKO mice,16 given that the activation of PI3K/Akt pathway is normal in the myocardium of MIRKO mice in response to IGF-1 infusion (Figure 5). The results from the MIRKO mice and Zucker obese rats clearly showed that selective inhibition of the PI3K/Akt cascade in insulin-resistant states is likely responsible for the reduction in VEGF expression and vascularization in the myocardium. It is possible that the inhibition of the PI3K/Akt pathway, which mediates the anti-apoptotic actions of many growth factors and the decrease in angiogenic factors such as VEGF in the insulin-resistant state, may increase endothelial cell apoptosis and decrease angiogenic response to ischemia. These alterations would result in lowering of capillary density at basal level and postischemia in insulin resistance. Further, it appears that insulin-induced VEGF expression in cardiomyocytes is mediated mainly by the Akt2 isoform activation-dependent pathway because siRNA inhibition of Akt2 expression significantly reduced VEGF expression. It is very surprising that IGF-1 was not able to compensate for the loss of insulin’s actions in the MIRKO mice, even though it can also activate the PI3K/Akt pathway and induced VEGF expression. In MIRKO mice, cardiac VEGF expression is decreased although IGF-1/PI3K/Akt axis is intact, suggesting that insulin receptor-mediated cascade plays a unique role that cannot be substituted by IGF-1 axis. Further studies using direct overexpression of VEGF in cardiac tissues of Zucker fatty rats and MIRKO mice are required to define the role of insulin resistance as the cause of the decrease of VEGF expression and impairment of reactive myocardial vascularization after ischemia.

The role of Akt1, however, is still ambiguous because of the significant increase of VEGF expression at basal states induced by reduction of AKT1. Thus, it is unlikely that AKT1 has a major effect on insulin’s stimulatory action on VEGF expression in cardiomyocytes. We cannot determine from these studies which of the stages in the insulin receptor/IRS/PI3K/Akt cascade are specifically inhibited in the insulin-resistant state. However, we and others have suggested that the elevation of endothelin-1 or angiotensin II, or the activation of PKCß isoform can increase the Thr/ser phosphorylation of insulin receptors, IRS, and p85/PI3K, which will all decrease the phosophorylation of Akt, and inhibit insulin’s actions.12,30,31 Further studies are needed to pinpoint the sites of the inhibition in the myocardium.

The results from the ischemia studies indicated that the lack of insulin’s specific actions via the PI3K/Akt pathway results in decreases in capillary density. However, DNA synthesis of the capillary cells in the myocardium after ischemia did not differ between control and insulin-resistant rats. These results suggest that proliferative responses, in concordance with Erk1/2 activation, are unchanged. The decrease may be related to an increase in the level of apoptosis, which is consistent with the findings of reduction in Akt activation and lowering of VEGF expression, known regulators of cell survival.5 Further studies are needed to determine whether the decrease in VEGF expression and capillary density exhibited by the Zucker rats and MIRKO mice will result in decreases in survival or increases in myocardial infarction after ischemia.

In summary, this study has provided a comprehensive analysis of the insulin signaling pathway both in cultured cardiomyocytes and in the myocardium in vivo. A specific and direct role for insulin receptors has been demonstrated on the expression of VEGF and vascularization in the myocardium in vivo. In addition, we found that selective inhibition of PI3K/Akt pathway in the resistant state provides a potential biochemical explanation for the decreased utilization of glucose as a source of fuel and the reduced vascularization of myocardium observed in diabetic and insulin-resistant states but paradoxically preserves the mitogenic actions of insulin. We speculate that the loss of insulin’s action could blunt the upregulation of VEGF expression and vascularization in the myocardium in response to ischemia, contributing to the poor outcome after myocardium infarction observed in diabetic and insulin resistant patients.


*    Acknowledgments
 
This work is supported by National Institutes of Health grants R01 DK53105 and R01 DK59725 to G.L.K.; a Mary K. Iacocca fellowship to Z.H.; and a Juvenile Diabetes Research Foundation fellowship to Z.H., K.J.W., and E.A. R.N.K. is supported by a KO8 Clinician Scientist Award (DK02885–03). The authors thank Sarah Twichell for the preparation of the manuscript.

Received December 14, 2005; accepted January 20, 2006.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMaterials and Methods
up arrowResults
up arrowDiscussion
*References
 

  1. Haffner SM, Lehto S, Ronnemaa T, Pyorala K, Laakso M. Mortality from coronary heart disease in subjects with type 2 diabetes and in nondiabetic subjects with and without prior myocardial infarction. N Engl J Med. 1998; 339: 229–234.[Abstract/Free Full Text]
  2. Abaci A, Oguzhan A, Kahraman S, Eryol NK, Unal S, Arinc H, Ergin A. Effect of diabetes mellitus on formation of coronary collateral vessels. Circulation. 1999; 99: 2239–2242.[Abstract/Free Full Text]
  3. Smith SC, Jr., Faxon D, Cascio W, Schaff H, Gardner T, Jacobs A, Nissen S, Stouffer R. Prevention Conference VI: Diabetes and Cardiovascular Disease: Writing Group VI: revascularization in diabetic patients. Circulation. 2002; 105: e165–9.[Free Full Text]
  4. Yarom R, Zirkin H, Stammler G, Rose AG. Human coronary microvessels in diabetes and ischaemia. Morphometric study of autopsy material. J Pathol. 1992; 166: 265–270.[CrossRef][Medline] [Order article via Infotrieve]
  5. Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nat Med. 2003; 9: 669–676.[CrossRef][Medline] [Order article via Infotrieve]
  6. Giordano FJ, Gerber HP, Williams SP, VanBruggen N, Bunting S, Ruiz-Lozano P, Gu Y, Nath AK, Huang Y, Hickey R, Dalton N, Peterson KL, Ross J, Jr., Chien KR, Ferrara N. A cardiac myocyte vascular endothelial growth factor paracrine pathway is required to maintain cardiac function. Proc Natl Acad Sci U S A. 2001; 98: 5780–5785.[Abstract/Free Full Text]
  7. Chou E, Suzuma I, Way KJ, Opland D, Clermont AC, Naruse K, Suzuma K, Bowling NL, Vlahos CJ, Aiello LP, King GL. Decreased cardiac expression of vascular endothelial growth factor and its receptors in insulin-resistant and diabetic States: a possible explanation for impaired collateral formation in cardiac tissue. Circulation. 2002; 105: 373–379.[Abstract/Free Full Text]
  8. Yoon YS, Uchida S, Masuo O, Cejna M, Park JS, Gwon HC, Kirchmair R, Bahlman F, Walter D, Curry C, Hanley A, Isner JM, Losordo DW. Progressive attenuation of myocardial vascular endothelial growth factor expression is a seminal event in diabetic cardiomyopathy: restoration of microvascular homeostasis and recovery of cardiac function in diabetic cardiomyopathy after replenishment of local vascular endothelial growth factor. Circulation. 2005; 111: 2073–2085.[Abstract/Free Full Text]
  9. Jiang ZY, He Z, King BL, Kuroki T, Opland DM, Suzuma K, Suzuma I, Ueki K, Kulkarni RN, Kahn CR, King GL. Characterization of multiple signaling pathways of insulin in the regulation of vascular endothelial growth factor expression in vascular cells and angiogenesis. J Biol Chem. 2003; 278: 31964–31971.[Abstract/Free Full Text]
  10. Poulaki V, Qin W, Joussen AM, Hurlbut P, Wiegand SJ, Rudge J, Yancopoulos GD, Adamis AP. Acute intensive insulin therapy exacerbates diabetic blood-retinal barrier breakdown via hypoxia-inducible factor-1alpha and VEGF. J Clin Invest. 2002; 109: 805–815.[CrossRef][Medline] [Order article via Infotrieve]
  11. Miele C, Rochford JJ, Filippa N, Giorgetti-Peraldi S, Van Obberghen E. Insulin and insulin-like growth factor-I induce vascular endothelial growth factor mRNA expression via different signaling pathways. J Biol Chem. 2000; 275: 21695–21702.[Abstract/Free Full Text]
  12. Kuboki K, Jiang ZY, Takahara N, Ha SW, Igarashi M, Yamauchi T, Feener EP, Herbert TP, Rhodes CJ, King GL. Regulation of endothelial constitutive nitric oxide synthase gene expression in endothelial cells and in vivo : a specific vascular action of insulin. Circulation. 2000; 101: 676–681.[Abstract/Free Full Text]
  13. Satoh N, Suter TM, Liao R, Colucci WS. Chronic alpha-adrenergic receptor stimulation modulates the contractile phenotype of cardiac myocytes in vitro. Circulation. 2000; 102: 2249–2254.[Abstract/Free Full Text]
  14. Suzuma K, Naruse K, Suzuma I, Takahara N, Ueki K, Aiello LP, King GL. Vascular endothelial growth factor induces expression of connective tissue growth factor via KDR, Flt1, and phosphatidylinositol 3-kinase- akt-dependent pathways in retinal vascular cells. J Biol Chem. 2000; 275: 40725–40731.[Abstract/Free Full Text]
  15. Jiang ZY, Zhou QL, Coleman KA, Chouinard M, Boese Q, Czech MP. Insulin signaling through Akt/protein kinase B analyzed by small interfering RNA-mediated gene silencing. Proc Natl Acad Sci U S A. 2003; 100: 7569–7574.[Abstract/Free Full Text]
  16. Bruning JC, Michael MD, Winnay JN, Hayashi T, Horsch D, Accili D, Goodyear LJ, Kahn CR. A muscle-specific insulin receptor knockout exhibits features of the metabolic syndrome of NIDDM without altering glucose tolerance. Mol Cell. 1998; 2: 559–569.[CrossRef][Medline] [Order article via Infotrieve]
  17. Jiang ZY, Lin YW, Clemont A, Feener EP, Hein KD, Igarashi M, Yamauchi T, White MF, King GL. Characterization of selective resistance to insulin signaling in the vasculature of obese Zucker (fa/fa) rats. J Clin Invest. 1999; 104: 447–457.[Medline] [Order article via Infotrieve]
  18. Lindsey ML, Gannon J, Aikawa M, Schoen FJ, Rabkin E, Lopresti-Morrow L, Crawford J, Black S, Libby P, Mitchell PG, Lee RT. Selective matrix metalloproteinase inhibition reduces left ventricular remodeling but does not inhibit angiogenesis after myocardial infarction. Circulation. 2002; 105: 753–758.[Abstract/Free Full Text]
  19. Jain M, DerSimonian H, Brenner DA, Ngoy S, Teller P, Edge AS, Zawadzka A, Wetzel K, Sawyer DB, Colucci WS, Apstein CS, Liao R. Cell therapy attenuates deleterious ventricular remodeling and improves cardiac performance after myocardial infarction. Circulation. 2001; 103: 1920–1927.[Abstract/Free Full Text]
  20. Ueki K, Yamamoto-Honda R, Kaburagi Y, Yamauchi T, Tobe K, Burgering BM, Coffer PJ, Komuro I, Akanuma Y, Yazaki Y, Kadowaki T. Potential role of protein kinase B in insulin-induced glucose transport, glycogen synthesis, and protein synthesis. J Biol Chem. 1998; 273: 5315–5322.[Abstract/Free Full Text]
  21. Yang ZZ, Tschopp O, Hemmings-Mieszczak M, Feng J, Brodbeck D, Perentes E, Hemmings BA. Protein kinase B alpha/Akt1 regulates placental development and fetal growth. J Biol Chem. 2003; 278: 32124–32131.[Abstract/Free Full Text]
  22. Van Obberghen E, Baron V, Delahaye L, Emanuelli B, Filippa N, Giorgetti-Peraldi S, Lebrun P, Mothe-Satney I, Peraldi P, Rocchi S, Sawka-Verhelle D, Tartare-Deckert S, Giudicelli J. Surfing the insulin signaling web. Eur J Clin Invest. 2001; 31: 966–977.[CrossRef][Medline] [Order article via Infotrieve]
  23. Takahashi A, Kureishi Y, Yang J, Luo Z, Guo K, Mukhopadhyay D, Ivashchenko Y, Branellec D, Walsh K. Myogenic Akt signaling regulates blood vessel recruitment during myofiber growth. Mol Cell Biol. 2002; 22: 4803–4814.[Abstract/Free Full Text]
  24. Cusi K, Maezono K, Osman A, Pendergrass M, Patti ME, Pratipanawatr T, DeFronzo RA, Kahn CR, Mandarino LJ. Insulin resistance differentially affects the PI 3-kinase- and MAP kinase-mediated signaling in human muscle. J Clin Invest. 2000; 105: 311–320.[Medline] [Order article via Infotrieve]
  25. Hirosumi J, Tuncman G, Chang L, Gorgun CZ, Uysal KT, Maeda K, Karin M, Hotamisligil GS. A central role for JNK in obesity and insulin resistance. Nature. 2002; 420: 333–336.[CrossRef][Medline] [Order article via Infotrieve]
  26. Carvalheira JB, Calegari VC, Zecchin HG, Nadruz W, Jr., Guimaraes RB, Ribeiro EB, Franchini KG, Velloso LA, Saad MJ. The cross-talk between angiotensin and insulin differentially affects phosphatidylinositol 3-kinase- and mitogen-activated protein kinase-mediated signaling in rat heart: implications for insulin resistance. Endocrinology. 2003; 144: 5604–5614.[Abstract/Free Full Text]
  27. Shaw S, Wang X, Redd H, Alexander GD, Isales CM, Marrero MB. High glucose augments the angiotensin II-induced activation of JAK2 in vascular smooth muscle cells via the polyol pathway. J Biol Chem. 2003; 278: 30634–30641.[Abstract/Free Full Text]
  28. Xia P, Inoguchi T, Kern TS, Engerman RL, Oates PJ, King GL. Characterization of the mechanism for the chronic activation of diacylglycerol-protein kinase C pathway in diabetes and hypergalactosemia. Diabetes. 1994; 43: 1122–1129.[Abstract]
  29. Rodrigues B, Cam MC, McNeill JH. Metabolic disturbances in diabetic cardiomyopathy. Mol Cell Biochem. 1998; 180: 53–57.[CrossRef][Medline] [Order article via Infotrieve]
  30. Toblli JE, Cao G, DeRosa G, Di Gennaro F, Forcada P. Angiotensin-converting enzyme inhibition and angiogenesis in myocardium of obese Zucker rats. Am J Hypertens. 2004; 17: 172–180.[CrossRef][Medline] [Order article via Infotrieve]
  31. Toblli JE, DeRosa G, Rivas C, Cao G, Piorno P, Pagano P, Forcada P. Cardiovascular protective role of a low-dose antihypertensive combination in obese Zucker rats. J Hypertens. 2003; 21: 611–620.[CrossRef][Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. Rask-Madsen and G. L. King
Differential Regulation of VEGF Signaling by PKC-{alpha} and PKC-{epsilon} in Endothelial Cells
Arterioscler. Thromb. Vasc. Biol., May 1, 2008; 28(5): 919 - 924.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. Rask-Madsen and G. L. King
More Sugar, Less Blood Vessels: Another Piece in the Puzzle of Increased Cardiovascular Risk in Diabetes
Arterioscler. Thromb. Vasc. Biol., April 1, 2008; 28(4): 608 - 610.
[Full Text] [PDF]


Home page
Physiol. Rev.Home page
E. D. Abel, S. E. Litwin, and G. Sweeney
Cardiac Remodeling in Obesity
Physiol Rev, April 1, 2008; 88(2): 389 - 419.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
R. Muniyappa, M. Montagnani, K. K. Koh, and M. J. Quon
Cardiovascular Actions of Insulin
Endocr. Rev., August 1, 2007; 28(5): 463 - 491.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
W. Hsueh, E. D. Abel, J. L. Breslow, N. Maeda, R. C. Davis, E. A. Fisher, H. Dansky, D. A. McClain, R. McIndoe, M. K. Wassef, et al.
Recipes for Creating Animal Models of Diabetic Cardiovascular Disease
Circ. Res., May 25, 2007; 100(10): 1415 - 1427.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
26/4/787    most recent
01.ATV.0000209500.15801.4ev1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, Z.
Right arrow Articles by King, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, Z.
Right arrow Articles by King, G. L.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH