Published online before print January 26, 2006, doi: 10.1161/01.ATV.0000205591.88522.d4
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2006 American Heart Association, Inc.
Vascular Biology |
Proangiogenic Effects of Protease-Activated Receptor 2 Are Tumor Necrosis Factor-
and Consecutively Tie2 Dependent
From the Departments of Pediatrics, Ophthalmology, Pharmacology (T.Z., F.S., M.H.B., D.C., S.N., M.S., X.H., M.B., S.C.), Hematology (L.F., G.E.R.), and Biochemistry (N.H.), Research Center of Hôpital Ste-Justine, Montréal, Quebec, Canada; and Departments of Ophthalmology, McGill University (P.L.), Montréal, Quebec, Canada.
Correspondence to Sylvain Chemtob, MD, PhD, Hôpital Ste-Justine, Research Center, 3175 Côte Ste-Catherine, Montréal, Québec, H3T 1C5, Canada. E-mail sylvain.chemtob{at}umontreal.ca
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Objective— Angiogenesis is essential physiologically in growth and pathologically in tumor development, chronic inflammatory disorders, and proliferative retinopathies. Activation of protease-activated receptor 2 (PAR2) leads to a proangiogenic response, but its mechanisms have yet to be specifically described. Here, we investigated the mode of action of PAR2 in retinal angiogenesis.
Methods and Results— PAR2-activating peptide, SLIGRL, increased retinal angiogenesis associated with an induction of vascular endothelial growth factor and angiopoetin-2 and most notably tie2 in the retina in vivo as well as in cultured neuroretinal endothelial cells. SLIGRL also induced release of the proinflammatory and angiogenic mediator tumor necrosis factor-
(TNF-) via the MEK/extracellular signal-regulated kinase (ERK) (MEK/ERK) pathway in these endothelial cells. TNF-, in turn, elicited tie2 expression by activating the MEK/ERK pathway. PAR2-evoked tie2 expression, endothelium proliferation (in vitro), and retinal neovascularization (in vivo) were abrogated by selective TNF- blockers (neutralizing antibody infliximab and soluble TNF- receptor-Fc fusion protein etanercept) as well as the MEK inhibitor PD98059.
Conclusion— The proangiogenic properties of PAR2 are intertwined with its proinflammatory effects, such that in retinal vasculature, they depend on TNF- and subsequent induction of tie2 via the MEK/ERK pathway.
This article investigated PAR2 activation in retinal angiogenesis. TNF- inhibitors (infliximab and etanercept) and the MEK inhibitor PD98059 prevented tie2 upregulation, endothelium proliferation, and retinal neovascularization induced by PAR2 activation. The PAR2 proangiogenic properties are involved in its proinflammatory effects and subsequent induction of tie2 via the MEK/ERK pathway.
Key Words: protease-activated receptor 2 • angiogenesis • TNF- • tie2 receptor • signaling transduction
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Angiogenesis occurs physiologically in growth, wound healing, and during the menstrual cycle. Pathological angiogenesis is critically important in the pathogenesis of tumor growth, chronic inflammatory disorders (eg, rheumatoid arthritis, psoriasis), and ischemic proliferative retinopathy such as diabetic retinopathy.1 At the molecular level, important and intensely studied angiogenic factors include vascular endothelial growth factor (VEGF), angiopoietins (Angs), and the basic fibroblast growth factor.2 VEGF stimulates a broad spectrum of biological responses in endothelial cells, including cell proliferation, migration, survival, differentiation, and permeability.3 The role of the Angs and their receptor tie2 (tyrosine kinase with immunoglobulin and epidermal growth factor homology domains receptor 2) in angiogenesis and vessel maturation is relatively complex. The Ang family is composed of 4 members: Ang1 to Ang4.4 Ang1 and Ang4 stimulate tie2, whereas Ang2 and Ang3 are reported to inhibit Ang1-induced tyrosine phosphorylation of tie24; phosphorylation of tie2 is implicated in maturation and stabilization of the vessel wall.5 On the other hand, it has also been suggested that local upregulation of Ang2 makes the vessel more responsive to other growth factors, notably VEGF,5 and simultaneous upregulation of Ang2 and VEGF leads to neovascularization.5,6 Interestingly, the expressions of Ang2 and tie2 but not Ang1 are increased in areas of neovascularization7,8 and points toward a more active role of Ang2/tie2 signaling in angiogenesis.9,10
Protease-activated receptors (PARs) belong to the G-protein–coupled receptor family and are activated by serine proteases. Four forms of PARs have been reported so far (PAR1 through PAR4). PAR2 can be activated by proteases such as trypsin and the major coagulant factor VIIa (FVIIa). These proteases cleave the N terminus to generate a tethered ligand, which interacts and activates the receptor. PAR2 is expressed in a variety of cells, including neuronal tissue, leukocytes, and vascular endothelial cells as reviewed recently.11 It has been reported to participate in inflammatory and mitogenic processes observed in asthma,11 tumor progression,11 and neovascularization12,13; in this context, FVIIa is a particularly important activator of PAR2 in proliferative retinopathies. However, the signaling mechanisms involved in PAR2-induced angiogenesis have not yet been specifically elucidated. Because primary proinflammatory cytokines are themselves involved in angiogenesis,14,15 we postulated that the inflammatory and mitogenic effects of PAR2 are interlinked in eliciting neovascularization by inducing major proangiogenic genes VEGF or tie2/Ang2. For this purpose, the mode of activation of PAR2 was studied on well-established retinal neovascularization. We hereby reveal for the first time that angiogenic effects of PAR2 are mediated by tumor necrosis factor- (TNF-), signaling via the MEK/extracellular signal-regulated kinase 1/2 (ERK1/2) pathway.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Animals
Newborn Sprague Dawley rats (Charles River; St-Constant, Québec, Canada) were used according to a protocol approved by Ste. Justine Research Center animal care committee.
Cell Culture
Primary cultures of newborn (2 to 4 days) porcine neuroretinal endothelial cells (PNRECs) were grown as described.16
Western Blot
Rat pup retinas were isolated and homogenized in 300 µL lysis buffer (150 mmol/L NaCl, 150 mmol/L KCl, 5 mmol/L MgCl2, 50 mmol/L phosphate sodium, pH 7.0, 1% Triton X-100, and protease inhibitor cocktail [Boehringer Mannheim]). A total of 20 µg of the soluble fraction was used for immunoblot analysis of PAR2 (monoclonal; Santa Cruz Biotechnology), VEGF (polyclonal; Chemicon), Ang1 and Ang2 (N-18, F-18; polyclonal; Santa Cruz Biotechnology), tie2 (C-20; polyclonal; Santa Cruz Biotechnology), ERK1/2 and phospho-ERK (polyclonal; Promega), and ß-actin (C-15; monoclonal; Abcam).17
Reverse Transcriptase–Polymerase Chain Reaction
Total RNA was isolated with RNase TM mini kit (Qiagen). RT-PCR was performed as described previously.17 The downstream primer of pig tie2 was 5'TTCACAAGCCTTCTCACACG3', which is designed across exon 5 and 6 to limit other splicing form. The upstream primer is 5'ACAATGGTGTCTGCCATGAA3'. The primers of pig TNF- are 5'TCCTCACTCACACCATCAGC3' (upstream) and 5'CCAAAATAGACCTGCCCAGA3' (downstream). QuantumRNA universal 18S standard primers (Ambion) were used as internal standard references.
TNF- Measurement
PNRECs (7x105/well) were seeded in a 24-well culture dish and starved for 4 hours. PNRECs in DMEM medium with 0.2% FBS were then treated with 10 µmol/L PD98059 (Calbiochem) or 1 µg/mL tie2 antagonist, recombinant human soluble tie2/Fc chimera (R & D Systems, Inc) with or without 100 µmol/L SLIGRL (Bio Synthesis Inc) for 16 hours. Aliquots (50 µL) of cultured media were used to measure TNF- concentrations. TNF- was assayed with a Quantikine Porcine TNF-/TNFSF2 immunoassay kit (R&D Systems) as described in the manual of the manufacturer.
Calcium Transients
Calcium transients were measured in the human kidney epithelium cell line BOSC23 PAR1-containing cells using the Fura-2AM indicator as described.16
Cell Proliferation Assay
2x104/well PNRECs were starved overnight before stimulation and then treated with PD98059 (10 µmol/L), infliximab (1 µg/mL; Schering), etanercept (1 µg/mL; Amgen), or tie2/Fc (1 µg/mL) with or without SLIGRL (100 µmol/L) for 48 hours, and cell proliferation was assayed based on the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich) by mitochondria.18 Essentially, MTT (0.5 mg/mL in PBS) was incubated with cells for 2 hours (37°C), the media was aspirated, the formazan product solubilized with acidified isopropanol, and optical density measured at 545 nm.
Retinal Neovascularization
Angiogenesis was investigated in vivo by measuring retinal vascular density in newborn Sprague Dawley rats as described previously.18 Briefly, rats were anesthetized and intravitreously injected at postnatal day 3 (P3) with inhibitors, SLIGRL, trypsin, or FVIIa (Novo Nordisk). At P7, retinas were isolated, flat mounted, and stained for endothelial cells using fluorescein isothiocyanate–labeled lectin antibody (Sigma-Aldrich). The retinal vascularization was estimated by microvascularized density and area.17,18
Statistical Analysis
Data were analyzed by 1-way ANOVA factoring for treatments, followed by the Newman–Keuls comparison among means test. Statistical significance was set as P<0.05. Values are presented as means±SEM.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
PAR2 Expression During Physiological Developmental Angiogenesis
Retinal developmental angiogenesis occurs during the first 2 postnatal weeks in the rat and provides a useful model to study neovascularization. PAR2 expression in retina increased from P4 to P15 (Figure 1A; Figure I, available online at http://atvb.ahajournals.org). Similar increases in the expression of VEGF, Ang2, and tie2 were observed during this period, albeit that in Ang2 was transient; Ang1 immunoreactivity decreased slightly over the same period (Figure 1A; Figure I).
|
PAR2 Activation Induces Major Proangiogenic Factors, Notably Tie2
To determine the effects of PAR2 activation on the expression of important retinal angiogenic factors and angiogenesis per se, we stimulated PAR2 by injecting intravitreally the activating peptide SLIGRL at P3 and analyzed protein expression at P4 and vascularization at P4, P7, and P15. PAR2 activation augmented the expression of VEGF, Ang2, and tie2 at P4 but not that of Ang1 (Figure 1A; Figure I). Stimulation of cultured PNRECs with SLIGRL (16 hours) also resulted in a dose-dependent rise in VEGF, Ang2, and tie2 expression, and a concurrent decrease in Ang1 (Figure 1B; Figure I); of relevance, increased VEGF in response to PAR2-dependent stimulation has been reported.19 Because of the robust induction in tie2 expression during developmental angiogenesis and in response to SLIGRL (Figure 1A; Figure I), we focused on its time-course profile; also, based on the dose-response to SLIGRL, we selected the higher concentration (100 µmol/L) for the subsequent experiments.
Tie2 mRNA (detected by RT-PCR) increased sharply at 1 hour of stimulation with SLIGRL (Figure 2A; Figure IIA, available online at http://atvb.ahajournals.org), and this was followed by a sustained rise in tie2 immunoreactive protein levels in PNRECs (Figure 2B; Figure IIB); no changes in tie2 mRNA were detected after 30 minutes of stimulation. The PAR1 activator thrombin11 (0.1 U/mL34; Worthington Biochemical Co.), the specific PAR1 peptide, SFLLRN, (100 µmol/L), as well as the scrambled peptide, LRGILS (100 µmol/L), were ineffective in inducing tie2 mRNA and protein expression (Figure 2; Figure II); however, thrombin and PAR1 peptide were active in eliciting calcium transients in PAR1-expressing cells (data not shown).
|
Upregulation of Tie2 by PAR2 Stimulation Is Mediated by TNF- and Dependent on the ERK1/2 Signaling Pathway
PAR2 exerts proinflammatory effects,11,20 which are at least in part dependent on secretion of the major proinflammatory cytokine TNF-21,22; the latter also exhibits angiogenic properties possibly via tie2.23 We tested these PAR2 properties in PNRECs. TNF- concentration in cultured media of PNRECs was significantly increased by SLIGRL starting 30 minutes after stimulation (Figure 3A), and human recombinant TNF- (BioSource International Inc.) in turn markedly raised expression of the major angiogenic receptor tie2 (Figure 4B; Figure IVB, available online at http://atvb.ahajournals.org). Moreover, PAR2-induced tie2 (mRNA and protein) expression was abrogated for 
24 hours by distinct TNF- receptor blockers, infliximab (specific chimeric IgG1
antibody24,25; Figure 3B and 3C; Figure IIIA and IIIB, available online at http://atvb.ahajournals.org), and etanercept (soluble TNF receptor p75 Fc fusion protein26,27; Figure 4B; Figure IVB), which specifically bind to released TNF- and neutralize its biological activity. As expected, nonspecific isotype-matched IgG1 (control; Ancell Immunology Research Products) was ineffective (Figure 3B; Figure IIIA).
|
|
Signal transduction of PAR2 is reported to be mediated via mitogen-activated protein (MAP) kinases, especially the MEK/ERK pathway.5 We tested whether PAR2 induced tie2 expression via this pathway in PNRECs. SLIGRL induced ERK1/2 phosphorylation (antiactive MAP kinase antibody from Promega; within 5 minutes), and this was blocked by the MEK1/2–ERK1/2 inhibitor PD98059 but not by the MAPK kinase (MKK)3/6–p38 or the MKK4/7–JNK (c-Jun N-terminal kinase) 1/2 pathway inhibitors, respectively SB203580 (Calbiochem) and SP600125 (BIOMOL); a similar paradigm was observed for SLIGRL-induced tie2 expression (Figure 4; Figure IV). Because TNF- appears to be an intermediate in PAR2-induced tie2 expression (Figure 3B and 3C), we surmised that this early PAR2-elicited ERK1/2 activation evokes TNF- release. This was indeed the case because TNF- release by SLIGRL was blocked by PD98059 (Figure 3A); as expected, the rapid ERK1/2 phosphorylation (within 5 minutes) by SLIGRL was not affected by TNF- blockers (Figure 4A; Figure IVA). Moreover, TNF-–induced tie2 expression was itself dependent on the ERK1/2 pathway because the latter was activated in response to TNF-, and inhibition of ERK1/2 prevented TNF-–evoked tie2 induction (Figure 4B; Figure IVB). Hence, collectively, the data suggest a sequential dual activation of ERK1/2 by SLIGRL in the process of inducing tie2: an early one, which elicits TNF- release, followed by one in response to this latter mediator.
PAR2 Activation Induces PNREC Proliferation Through MEK-ERK, TNF-, and Tie2 Pathways
Because PAR2 activation in PNRECs induces signaling pathway-associated expression of the proangiogenic tie2 (Figures 2 through 4
; Figure II through IV), we tested whether these changes are manifested in endothelial cell proliferation, essential for angiogenesis. SLIGRL elicited a robust PNREC proliferation (determined by MTT assay [see Methods] and confirmed by cell counts), consistent with effects of PAR2 agonist in tumor cell proliferation.28 The proliferative effect of SLIGRL was prevented by the MEK1/2–ERK1/2 inhibitor PD98059, TNF- receptor blockers infliximab and etanercept, and tie2 antagonist tie2/Fc (Figure V, available online at http://atvb.ahajournals.org).
Angiogenic Effects of PAR2 Are Dependent on MEK/ERK, TNF-, and Tie2
Finally, we tested the effects of PAR2 activation on retinal angiogenesis and the corresponding role of TNF-, MEK/ERK1/2 pathway, and tie2 in this process. Rat pups were injected intravitreally with PAR2 agonists trypsin (without or with soybean trypsin inhibitor), FVIIa, or SLIGRL, and retinal vascularization was determined at P7. PAR2 activation was associated with a significantly accelerated retinal neovascularization, such that by P7, &75% of the retina was vascularized compared with &60% in control animals (P<0.001; n=5 to 8 retinas per treatment; Figure 5). Specific protein inhibitors of PAR2 are not yet available to test its role in regulating physiological neovascularization, albeit developmental retinal angiogenesis is somewhat dependent of PAR2 based on the knockout mouse,13 consistent with our observations. Angiogenic effects of SLIGRL were inhibited equivalently by PD98059, infliximab, etanercept, and the soluble tie2/Fc chimera (Figure 5); as expected, tie2/Fc alone also affected developmental neovascularization.30
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
PARs are a relatively recently described family of G-protein–coupled receptors that, as the name indicates, are activated by proteases. Of the PARs, PAR1 and 2 have been the most studied. Both PAR1 and 2 have been attributed proinflammatory,29 oncogenic,29 and angiogenic properties.13 PAR1 and PAR2 can both be activated by the major procoagulant esterase FVIIa via tissue factor,31,32 but mitogenic as well as migratory effects of the latter are mostly PAR2 dependent,33,34 as shown in Figure 5. Moreover, PAR2 relative to PAR1 seems to exhibit significant physiological angiogenic properties,12,13 especially in the developing retina.13 However, the signaling mechanisms specifically of PAR2 in this process has not yet been described. We therefore investigated the mode of action of PAR2 in angiogenesis in the developing retina. Our findings reveal a link between the proinflammatory and angiogenic effects of PAR2, which are mediated by TNF-
via activation of MEK/ERK1/2 pathway and ultimately conveyed through tie2 induction.
A major feature of this study is the dominant role played by tie2 in PAR2-induced angiogenesis. Strong evidence supports this claim: (1) tie2, as well as its ligand Ang2, increase concomitantly with PAR2 during developmental retinal neovascularization (Figure 1; Figure I); (2) stimulation of PAR2 induces tie2 expression in vivo (Figure 1; Figure I) and in neuroretinal endothelial cells in vitro (Figures 1 through 4; Figures I through IV); and (3) the soluble extracellular domain of tie2 blocked PAR2-induced PNREC proliferation (Figure V) and retinal angiogenesis (Figure 5). The latter suggests that ligand binding curtails neovascularization. Because Ang1 expression decreases as opposed to Ang2 (Figure 1; Figure I) at the developmental ages of rat in these experiments, one would presume a primary role for Ang2 in angiogenesis. In line with our observations, Ang2 in the presence of VEGF, as currently seen in whole retina (Figure 1; Figure I), promotes new vessel growth5; the reverse is observed in the absence of VEGF. In hypoxia-induced retinopathy, Ang2 is upregulated along with VEGF and its receptor, whereas Ang1 remains unchanged.35 Most important, tie2/Fc chimera interferes with retinal neovascularization in this model.36 Hence, although VEGF is well known to play a pivotal role in developmental and pathologic angiogenesis,37 its actions require and are coordinated with those of other growth factors, notably tie2.8,35 Altogether, our data support a prominent role for tie2 in PAR2-induced angiogenesis.
Induction of tie2 and angiogenesis in response to PAR2 stimulation appears to require the release of TNF- (Figures 3 through 5; Figures III through V). Abundant evidence well described angiogenic properties of proinflammatory cytokines interleukin-6 (IL-6), IL-8, IL-1, and TNF-.14,15 In addition, TNF- and IL-1, the effects of which are intertwined, can induce tie2 expression.38 We hereby demonstrate that tie2-dependent angiogenic effects of PAR2 are mediated via TNF-: (1) PAR2 activation evoked an early release of TNF- (Figure 3A), as documented in other cell types21; (2) SLIGRL elicited a subsequent tie2 expression (Figure 2A; Figure IIA), which was inhibited by distinct TNF- blockers, the specific neutralizing antibody to TNF- infliximab, and the soluble TNF- receptor p75 Fc fusion protein etanercept (Figures 3 and 4; Figures III and IV); (3) stimulation with TNF- reproduced the tie2 induction (Figure 4B; Figure IVB); and (4) more relevantly, both infliximab and etanercept completely prevented SLIGRL-induced PNREC proliferation (Figure V) and retinal neovascularization (Figure 5).
PAR2 stimulation in PNRECs led to a rapid (within 5 minutes) activation (phosphorylation) of ERK1/2 (Figure 4B; Figure IVB), which preceded the induced generation of TNF- (Figure 3A). Accordingly, TNF- blockers infliximab and etanercept did not inhibit SLIGRL-induced ERK1/2 phosphorylation (Figure 4A; Figure IVA), whereas the MEK/ERK1/2 inhibitor PD98059 prevented TNF- formation (Figure 3A); this is consistent with the documented dominant role for ERK1/2 in PAR1/2-induced TNF- secretion.21 In line with these observations, PAR2 stimulation, either physiologically such as in response to its natural ligand esterase trypsin and more important, FVIIa (via tissue factor) or pharmacologically using its agonist peptide, is known to activate MAP kinases.11,20 In addition, TNF- itself activated ERK1/2 (Figure 4A; Figure IVA), which plays a role in TNF-–induced neovascularization;11,20,39 albeit other MAP kinases may also contribute in this process.40 More important, inhibition of the MEK/ERK1/2 pathway abrogated PAR2-induced tie2 expression, cell proliferation, and neovascularization (Figures 4 and 5; Figure V), inferring a major role for the MEK/ERK1/2 pathway in these processes. Thus, PAR2-induced tie2 expression proceeds via 2 sequential cascades of ERK activation, an early one in response to PAR2 stimulation and a delayed one secondary to TNF-.
In conclusion, we hereby present previously undescribed evidence for a concerted proangiogenic mechanism of action of PAR2 intertwined with its proinflammatory effects, mediated by TNF- and dependent on the tie2 receptor. These findings provide significant clinically relevant targets associated with PAR2 activation to modulate pharmacologically in desirable (eg, organ revascularization) and undesirable angiogenesis (eg, pathological neovascularization as seen in ischemic proliferation retinopathy and tumors).
|
Acknowledgments |
|---|
This study was supported by grants from the Canadian Institutes of Health Research (CIHR), the March of Dimes Birth Defects Foundation, the Heart and Stroke Foundation of Québec, the Fonds de la Recherche en Santé du Québec, and Le Réseau de Recherche en Santé de la Vision. F.S. and J.-S.J. are recipients of fellowship awards respectively from CIHR and the Canadian Blood Services as well as the Canadian Child Health Clinician Scientist Program. D.C. is recipient of a studentship from Natural Sciences and Engineering Research Council of Canada and the Foundation Fighting Blindness; M.B. and S.N. are recipients of studentships from CIHR. S.C. holds a Canada research chair (perinatology).
Received October 17, 2005; accepted January 4, 2006.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
1. Hanahan D, Folkman J. Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell. 1996; 86: 353–364.[CrossRef][Medline] [Order article via Infotrieve]
2. Lutsenko SV, Kiselev SM, Severin SE. Molecular mechanisms of tumor angiogenesis. Biochemistry (Mosc). 2003; 68: 286–300.[CrossRef][Medline] [Order article via Infotrieve]
3. Ferrara N. Role of vascular endothelial growth factor in regulation of physiological angiogenesis. Am J Physiol Cell Physiol. 2002; 280: C1358–C1366.
4. Yancopoulos GD, Davis S, Gale NW, Rudge JS, Wiegand SJ, Holash J. Vascular-specific growth factors and blood vessel formation. Nature. 2000; 407: 242–248.[CrossRef][Medline] [Order article via Infotrieve]
5. Ramsauer M, D’Amore PA. Getting Tie(2)d up in angiogenesis. J Clin Invest. 2002; 110: 1615–1617.[CrossRef][Medline] [Order article via Infotrieve]
6. Loughna S, Thomas N, Sato TN. Angiopoietin and Tie signaling pathways in vascular development. Matrix Biol. 2001; 20: 319–325.[CrossRef][Medline] [Order article via Infotrieve]
7. Brown LF, Dezube BJ, Tognazzi K, Dvorak HF, Yancopoulos GD. Expression of Tie1, Tie2, and angiopoietins 1, 2, and 4 in Kaposi’s sarcoma and cutaneous angiosarcoma. Am J Pathol. 2000; 156: 2179–2183.
8. Holash J, Maisonpierre PC, Compton D, Boland P, Alexander CR, Zagzag D, Yancopoulos GD, Wiegand SJ. Vessel cooption, regression, and growth in tumors mediated by angiopoietins and VEGF. Science. 1999; 284: 1994–1998.
9. Kim I, Kim JH. Moon SO, Kwak HJ, Kim NG, Koh GY. Angiopoietin-2 at high concentration can enhance endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Oncogene. 2000; 19: 4549–4552.[CrossRef][Medline] [Order article via Infotrieve]
10. Teichert-Kuliszewska K, Maisonpierre PC, Jones N, Campbell AI, Master Z, Bendeck MP, Alitalo K, Dumont DJ, Yancopoulos GD, Stewart DJ. Biological action of angiopoietin-2 in a fibrin matrix model of angiogenesis is associated with activation of Tie2. Cardiovasc Res. 2001; 49: 659–670.
11. Macfarlane SR, Seatter MJ, Kanke T, Hunter GD, Plevin R. Proteinase-activated receptors. Pharmacol Rev. 2001; 53: 245–282.
12. Milia AF, Salis MB, Stacca T, Pinna A, Madeddu P, Trevisani M, Geppetti P, Emanueli C. Protease-activated receptor-2 stimulates angiogenesis and accelerates hemodynamic recovery in a mouse model of hindlimb ischemia. Circ Res. 2002; 91: 346–352.
13. Belting M, Dorrell MI, Sandgren S, Aguilar E, Ahamed J, Dorfleutner A, Carmeliet P, Mueller BM, Friedlander M, Ruf W. Regulation of angiogenesis by tissue factor cytoplasmic domain signaling. Nat Med. 2004; 10: 502–509.[CrossRef][Medline] [Order article via Infotrieve]
14. Monaco C, Andreakos E, Kiriakidis S, Feldmann M, Paleolog E. T-cell-mediated signaling in immune, inflammatory and angiogenic processes: the cascade of events leading to inflammatory diseases. Curr Drug Targets Inflamm Allergy. 2004; 3: 35–42.[CrossRef][Medline] [Order article via Infotrieve]
15. Bar D, Apte RN, Voronov E, Dinarello CA, Cohen S. A continuous delivery system of IL-1 receptor antagonist reduces angiogenesis and inhibits tumor development. FASEB J. 2004; 18: 161–163.
16. Lahaie I, Hardy P, Hou X, Hasséssian H, Asselin P, Lachapelle P, Almazan G, Varma DR, Morrow JD, Roberts LJ II, Chemtob S. A novel mechanism for vasoconstrictor action of 8-isoprostaglandin F2 alpha on retinal vessels. Am J Physiol. 1998; 274: 1406–1416.
17. Sennlaub F, Valamanesh F, Vazquez-Tello A, El-Asrar AM, Checchin D, Brault S, Gobeil F, Beauchamp MH, Mwaikambo B, Courtois Y, Geboes K, Varma DR, Lachapelle P, Ong H, Behar-Cohen F, Chemtob S. Cyclooxygenase-2 in human and experimental ischemic proliferative retinopathy. Circulation. 2003; 108: 198–204.
18. Beauchamp MH, Sennlaub F, Speranza G, Gobeil F Jr, Checchin D, Kermorvant-Duchemin E, Abran D, Hardy P, Lachapelle P, Varma DR, Chemtob S. Redox-dependent effects of nitric oxide on microvascular integrity in oxygen-induced retinopathy. Free Radic Biol Med. 2004; 37: 1885–1894.[CrossRef][Medline] [Order article via Infotrieve]
19. Ollivier V, Chabbat J, Herbert JM, Hakim J, de Prost D. Vascular endothelial growth factor production by fibroblasts in response to factor VIIa binding to tissue factor involves thrombin and factor Xa. Arterioscler Thromb Vasc Biol. 2000; 20: 1374–1381.
20. Ossovskaya VS, Nigel VS. Protease-activated receptors: contribution to physiology and disease. Physiol Rev. 2004; 84: 579–621.
21. Kim MS, Jo H, Um JY, Yi JM, Kim DK, Choi SC, Kim TH, Nah YH, Kim HM, Lee YM. Agonists of proteinase-activated receptor 2 induce TNF-alpha secretion from astrocytoma cells. Cell Biochem Funct. 2002; 20: 339–345.[CrossRef][Medline] [Order article via Infotrieve]
22. Kim JA, Choi SC, Yun KJ, Kim DK, Han MK, Seo GS, Yeom JJ, Kim TH, Nah YH, Lee YM. Expression of protease-activated receptor 2 in ulcerative colitis. Inflamm Bowel Dis. 2003; 9: 224–229.[CrossRef][Medline] [Order article via Infotrieve]
23. DeBusk LM, Chen Y, Nishishita T, Chen J, Thomas JW, Lin PC. Tie2 receptor tyrosine kinase, a major mediator of tumor necrosis factor alpha-induced angiogenesis in rheumatoid arthritis. Arthritis Rheum. 2003; 48: 2461–2471.[CrossRef][Medline] [Order article via Infotrieve]
24. Olsen NJ, Stein CM. New drugs for rheumatoid arthritis. N Engl J Med. 2004; 50: 2167–2179.
25. Maini SR. Infliximab treatment of rheumatoid arthritis. Rheum Dis Clin North Am. 2004; 30: 329–347.[CrossRef][Medline] [Order article via Infotrieve]
26. Goffe B. Etanercept (Etanercept)—an update. Skin Therapy Lett. 2004; 9: 1–4.[Medline] [Order article via Infotrieve]
27. Sandborn WJ. New concepts in anti-tumor necrosis factor therapy inflammatory bowel disease. Rev Gastroenterol Disord. 2005; 5: 10–18.[Medline] [Order article via Infotrieve]
28. Darmoul D, Marie JC, Devaud H, Gratio V, Laburthe M. Initiation of human colon cancer cell proliferation by trypsin acting at PAR-2. Br J Cancer. 2001; 85: 772–779.[CrossRef][Medline] [Order article via Infotrieve]
29. Coughlin SR, Camerer E. Participation in inflammation. J Clin Invest. 2003; 111: 25–27.[CrossRef][Medline] [Order article via Infotrieve]
30. Hackett SF, Ozaki H, Strauss RW, Wahlin K, Suri C, Maisonpierre P, Yancopoulos G, Campochiaro PA. Angiopoietin 2 expression in the retina: upregulation during physiologic and pathologic neovascularization. J Cell Physiol. 2000; 184: 275–284.[CrossRef][Medline] [Order article via Infotrieve]
31. Ruf W, Dorfleutner A, Riewald M. Specificity of coagulation factor signaling. J Thromb Haemost. 2003; 7: 1495–1503.
32. Chen J, Bierhaus A, Schiekofer S, Andrassy M, Chen B, Stern DM, Nawroth PP. Tissue factor–a receptor involved in the control of cellular properties, including angiogenesis. Thromb Haemost. 2001; 86: 334–345.[Medline] [Order article via Infotrieve]
33. Hjortoe GM, Petersen LC, Albrektsen T, Sorensen BB, Norby PL, Mandal SK, Pendurthi UR, Rao LV. Tissue factor-factor VIIa-specific up-regulation of IL-8 expression in MDA-MB-231 cells is mediated by PAR-2 and results in increased cell migration. Blood. 2004; 103: 3029–3037.
34. Fan L, Yotov WV, Zhu T, Esmailzadeh L, Joyal JS, Sennlaub F, Heveker N, Chemtob S, Rivard GE. Tissue factor enhances protease activated receptor-2-mediated factor VIIa cell proliferative properties. J Thromb Haemost. 2005; 3: 1056–1063.[CrossRef][Medline] [Order article via Infotrieve]
35. Sarlos S, Rizkalla B, Moravski CJ, Cao Z, Cooper ME, Wilkinson-Berka JL. Retinal angiogenesis is mediated by an interaction between the angiotensin type 2 receptor, VEGF, and angiopoietin. Am J Pathol. 2003; 163: 879–887.
36. Takagi H, Koyama S, Seike H, Oh H, Otani A, Matsumura M, Honda Y. Potential role of the angiopoietin/Tie2 system in ischemia-induced retinal neovascularization. Invest Ophthalmol Vis Sci. 2003; 44: 393–402.
37. Ozaki H, Seo MS, Ozaki K, Yamada H, Yamada E, Okamoto N, Hofmann F, Wood JM, Campochiaro PA. Blockade of vascular endothelial cell growth factor receptor signaling is sufficient to completely prevent retinal neovascularization. Am J Pathol. 2000; 56: 697–707.
38. Willam C, Koehne P, Jurgensen JS, Grafe M, Wagner KD, Bachmann S, Frei U, Eckardt KU. Tie2 receptor expression is stimulated by hypoxia and proinflammatory cytokines in human endothelial cells. Circ Res. 2000; 87: 370–377.
39. Kim YM, Kim YM, Lee YM, Kim HS, Kim JD, Choi Y, Kim KW, Lee SY, Kwon YG. TNF-related activation-induced cytokine (TRANCE) induces angiogenesis through the activation of Src and phospholipase C (PLC) in human endothelial cells. J Biol Chem. 2002; 277: 6799–6805.
40. Nakao S, Kuwano T, Ishibashi T, Kuwano M, Ono M. Synergistic effect of TNF-alpha in soluble VCAM-1-induced angiogenesis through alpha 4 integrins. J Immunol. 2003; 170: 5704–5711.
This article has been cited by other articles:
 |
|
 |
|
  B. Li, A. Vincent, J. Cates, D. M. Brantley-Sieders, D. B. Polk, and P. P. Young Low Levels of Tumor Necrosis Factor {alpha} Increase Tumor Growth by Inducing an Endothelial Phenotype of Monocytes Recruited to the Tumor Site Cancer Res., January 1, 2009; 69(1): 338 - 348. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. H. Versteeg, F. Schaffner, M. Kerver, L. G. Ellies, P. Andrade-Gordon, B. M. Mueller, and W. Ruf Protease-Activated Receptor (PAR) 2, but not PAR1, Signaling Promotes the Development of Mammary Adenocarcinoma in Polyoma Middle T Mice Cancer Res., September 1, 2008; 68(17): 7219 - 7227. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Voskas, Y. Babichev, L. S. Ling, J. Alami, Y. Shaked, R. S. Kerbel, B. Ciruna, and D. J. Dumont An eosinophil immune response characterizes the inflammatory skin disease observed in Tie-2 transgenic mice J. Leukoc. Biol., July 1, 2008; 84(1): 59 - 67. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Uusitalo-Jarvinen, T. Kurokawa, B. M. Mueller, P. Andrade-Gordon, M. Friedlander, and W. Ruf Role of Protease Activated Receptor 1 and 2 Signaling in Hypoxia-Induced Angiogenesis Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1456 - 1462. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||