Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2005;25:1220-1224
Published online before print February 10, 2005, doi: 10.1161/01.ATV.0000159163.52632.1b
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
25/6/1220    most recent
01.ATV.0000159163.52632.1bv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kazemi, M. R.
Right arrow Articles by Feingold, K. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kazemi, M. R.
Right arrow Articles by Feingold, K. R.
Related Collections
Right arrowRelated Article
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2005;25:1220.)
© 2005 American Heart Association, Inc.


Atherosclerosis and Lipoproteins

Adipocyte Fatty Acid–Binding Protein Expression and Lipid Accumulation Are Increased During Activation of Murine Macrophages by Toll-Like Receptor Agonists

Mahmood R. Kazemi; Carol M. McDonald; Judy K. Shigenaga; Carl Grunfeld; Kenneth R. Feingold

From the Metabolism Section, Department of Veterans Affairs Medical Center, San Francisco, Calif; and the Department of Medicine, University of California, San Francisco.

Correspondence to Mahmood R. Kazemi, SFVAMC—Metabolism Section, 4150 Clement St, 111F, San Francisco, CA 94121. E-mail mkazemi{at}medicine.ucsf.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Objective— Toll-like receptors (TLRs) recognize pathogens and mediate signaling pathways important for host defense. Recent studies implicate TLR polymorphisms in atherosclerosis risk in humans. Adipocyte fatty acid–binding protein (aP2) is present in macrophages and has an important role in atherosclerotic plaque development. We investigated aP2 expression in RAW 264.7 cells treated with lipopolysaccharide (LPS) and other TLR agonists and assessed lipid accumulation in these activated murine macrophages.

Methods and Results— Stimulation with LPS, a TLR4 ligand, resulted in a 56-fold increase in aP2 mRNA expression, and zymosan, a TLR2 ligand, induced an {approx}1500-fold increase. Polyinosine: polycytidylic acid (poly I:C), a TLR3 ligand, led to a 9-fold increase. Levels of aP2 protein were significantly increased in LPS or zymosan-treated macrophages compared with control or poly I:C–treated cells. In addition, the cholesteryl ester content of LPS or zymosan-treated macrophages was {approx}5-fold greater in the presence of low-density lipoprotein, and triglyceride content was {approx}2-fold greater in the absence of exogenous lipid than control or poly I:C–treated cells.

Conclusions— Expression of macrophage aP2 is induced on TLR activation and parallels increases in cholesteryl ester and triglyceride levels. These results provide a molecular link between the known roles of TLR and aP2 in foam cell formation.

Given the key role of macrophage aP2 in atherosclerosis, we studied aP2 expression in macrophages stimulated with LPS and 2 other TLR ligands: zymosan and poly I:C. Treatment with LPS or zymosan, but not poly I:C, leads to significant increases in aP2 mRNA and protein, which parallel cholesteryl ester and triglyceride accumulation.


Key Words: atherosclerosis • foam cell • macrophage • toll-like receptor • aP2


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Atherosclerosis is increasingly recognized as an inflammatory disorder.1 Epidemiologic studies have reported an elevated risk of atherosclerosis with a number of infectious agents, including Chlamydia pneumoniae and cytomegalovirus.2,3 Local immune responses to these pathogens initiate inflammatory cascades that can result in atheroma formation.

Macrophages are central mediators of innate immune responses. Like other antigen-presenting cells, macrophages detect pathogen-associated molecular patterns by means of toll-like receptors (TLRs).4,5 At least 10 different TLRs have been identified to date, and each appears to recognize molecules of different microbial origin. For example, TLR4 mediates the cellular response to bacterial lipopolysaccharide (LPS), whereas TLR2 recognizes the fungal cell wall constituent zymosan, and TLR3 binds the double-stranded RNA viral analog polyinosine: polycytidylic acid (poly I:C).6–9 The importance of these receptors to arterial inflammation is highlighted by the decreased atherosclerosis risk in humans with a TLR4 polymorphism that attenuates receptor signaling.10 There has also been recent interest in potential endogenous ligands of the TLRs, such as heat shock proteins and the extra domain A of fibronectin.11,12

See page 1085

Activation of macrophages by TLR ligands such as LPS has been shown previously to increase low-density lipoprotein (LDL) uptake and cholesterol content, leading to foam cell formation.13,14 In addition, our laboratory has reported an increase in intracellular triglyceride with LPS stimulation of murine macrophages in the absence of exogenous lipid.14 In vivo studies have also documented an increase in atherosclerotic lesion size with LPS administration.15

During the course of lipid accumulation, fatty acids present in macrophages associate with cytoplasmic fatty acid–binding proteins (FABPs) for intracellular transport.16 The adipocyte FABP (aP2; also known as FABP4) is a marker of terminal adipocyte differentiation and is under transcriptional regulation by fatty acids in these cells.17,18 Monocytes have been shown to express aP2 after phorbol myristate acetate stimulation of macrophage differentiation.19 Macrophages also show an increase in aP2 expression when treated with dexamethasone or oxidized LDL to induce foam cell formation.20–22

In vivo, the role of aP2 in atherosclerosis has been studied in knockout mouse models. Cholesteryl ester accumulation is reduced in lipid-loaded macrophages from aP2–/– mice compared with wild-type.19 When fed a Western diet, apolipoprotein E–/– (apoE–/–) aP2–/– mice show significant reductions in atherosclerotic lesion size compared with apoE–/– mice.23 Bone marrow transplants have further demonstrated that this reduction is mediated by the absence of macrophage aP2 expression.24

Given the important role of aP2 in atherosclerosis and the increase in macrophage lipid content with LPS stimulation and foam cell formation, we hypothesized that LPS and other TLR ligands would increase the expression of aP2 in murine macrophages. We also postulated that this TLR-mediated enhancement of aP2 expression would be paralleled by an increase in the lipid content of these cells.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Materials
LPS from Escherichia coli strain O55:B5 was purchased from Difco and diluted in sterile normal saline to the desired concentration. DME was purchased from Fisher Scientific. FCS was purchased from Gemini Bioproducts, and human serum albumin was obtained from ZLB Bioplasma. Intralipid, a 10% emulsion of soybean oil, was obtained from Fresenius Kabi Clayton. Human LDL was purchased from Intracel. Tri Reagent, protease inhibitor cocktail, and zymosan were purchased from Sigma. Poly I:C was purchased from InvivoGen. [{alpha}-32P]dCTP (3000 Ci/mmol) was purchased from Perkin–Elmer Life Sciences. Goat anti-mouse aP2 IgG was purchased from R & D Systems.

Cell Culture
RAW 264.7, a murine macrophage cell line, was obtained from American Type Culture Collection. Cells were grown in 75-cm2 flasks in DME supplemented with 10% FCS and incubated at 37°C in 5% CO2. Confluent flasks were trypsinized and used to seed 100-mm dishes or 6-well plates for experiments. When confluent, cells were washed with serum-free DME once and then treated in DME with 2.5% human serum albumin. Cells were treated for 4 to 16 hours before RNA isolation and 16 hours before protein isolation or lipid assay.

RNA Isolation and Northern Blot Analysis
Total RNA was isolated from 100-mm dishes using Tri Reagent. A total of 30 µg of total RNA was denatured and electrophoresed on 1% agarose-formaldehyde gels. The uniformity of sample loading was verified by UV visualization of the ethidium-bromide–stained gel before electrotransfer to Nytran membrane. The cDNA probe for aP2 was a gift from Dr Bruce Spiegelman (Harvard Medical School, Boston, Mass). 32P-labeled cDNA was prepared using the random priming method (Amersham Biosciences). mRNA levels were quantified by means of the Personal FX phosphorimager (Bio-Rad).

Quantitative Polymerase Chain Reaction
One microgram of total RNA from RAW 264.7 cells was reverse transcribed to cDNA using a commercially available kit (BD Biosciences). Quantitative polymerase chain reaction (QPCR) was performed with the MX3000P (Stratagene) using 2X SYBR Green master mix (Stratagene) and 4% of the starting 1 µg RNA with the following primers for aP2 at 450 nmol/L per 20 µL reaction: forward 5' TCACCATCCGGTCAGAGAGTA 3' and reverse 5' CACATTCCACCACCAGCTT 3'. Forty cycles were conducted as follows: 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, preceded by 10 minutes at 95°C for polymerase activation. Products were electrophoresed to confirm specificity of the reaction. Quantification was performed by the comparative CT method, with 36B4 used for normalization.

Protein Isolation
Cells grown in 100-mm dishes were washed twice with ice-cold PBS and scraped into 2 mL per dish of chilled PBS with protease inhibitor cocktail added. Cells were pelleted at 1000 rpm for 5 minutes at 4°C, and pellets were resuspended in cell lysis buffer containing 1% Triton X-100, 0.5% deoxycholate, 2 mmol/L sodium vanadate, and 100 mmol/L sodium fluoride with protease inhibitor cocktail added. After incubation on ice for 30 minutes, the suspension was centrifuged at 10000 rpm for 30 minutes at 4°C. The supernatant was collected and assayed for protein concentration by the Bradford method (Bio-Rad).

Western Blot Analysis
SDS-PAGE was performed on 100-µg aliquots of protein under reducing conditions. Samples were electrophoresed on a 10% to 20% gradient gel using a minigel apparatus (Bio-Rad). Proteins were electrotransferred to a polyvinylidene fluoride membrane (Amersham), followed by blocking with 5% nonfat dry milk in PBS. After washing with PBS containing 0.1% Tween 20, the membrane was incubated with goat anti-mouse aP2 primary antibody (1:100 dilution) in 1% milk for 1 hour at room temperature. After repeat washing, the membrane was incubated with the appropriate secondary antibody and signal was detected with ECL Plus (Amersham).

Lipid Assays
Cells grown in 6-well plates were washed twice with ice-cold PBS and scraped into 100 µL of doubly distilled water. The resulting suspension was kept on ice and sonicated for 15 seconds with a Branson Sonifier 350. Aliquots of 10 µL were assayed separately for total cholesterol and free cholesterol using a kit from Wako. A 20-µL aliquot of each sample was assayed for total triglyceride and corrected for free glycerol using a kit from Sigma. Protein concentration was determined by the Bradford method.

Statistics
Data are presented as mean±SEM. Student’s t test was used for comparisons between groups. A P value <0.05 was considered significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
LPS stimulation of RAW cells results in a dose-dependent increase in aP2 mRNA levels (Figure 1A). There is a substantial increase even at 1 ng/mL (8-fold greater than control), demonstrating the sensitivity of the response to LPS. Half-maximal response is at {approx}10 ng/mL, and maximal increase is at 100 ng/mL (56-fold greater than control), with no appreciable further increase at 1000 ng/mL. Levels of aP2 mRNA rise within 8 hours after RAW cells are treated with LPS (Figure 1B). No significant induction is apparent at 4 hours (Figure 1B), and there is no further increase at 24 hours (data not shown).



View larger version (41K):
[in this window]
[in a new window]
 
Figure 1. A, Dose-response curve of the effect of LPS on aP2 mRNA levels measured by QPCR in RAW 264.7 macrophages. Cells were treated with LPS at the indicated concentration in serum-free media for 16 hours. Data are presented as percent change of control (Ctrl; mean±SEM). B, Northern blot of the time course of LPS effect on aP2 expression in RAW cells. Cells were treated with LPS at 100 ng/mL for the indicated time periods. **P<0.01; ***P<0.001.

Because aP2 is an FABP involved in the intracellular transport of lipid, it is possible that the magnitude of the response to LPS stimulation may be modulated by extracellular or intracellular lipid concentration. RAW cells treated with a triglyceride emulsion (Intralipid) showed no increase in aP2 expression (Figure 2A), despite having a 5-fold increase in triglyceride content compared with control (Figure 2B). When RAW cells are treated with LPS and Intralipid, cells showed a substantial increase in aP2 expression from baseline (36-fold increase over Intralipid alone). However, this increase is not greater than with LPS alone (Figure 2A), even with higher triglyceride levels (Figure 2B), indicating that TLR4 activation, per se, provides a specific signal for regulation of aP2 gene expression in the macrophage, independent of an increase in lipid content. This is further supported by the rise in aP2 with LPS stimulation despite the lack of cholesteryl ester accumulation in the absence of exogenous LDL (data not shown).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. Effect of LPS and Intralipid treatment on aP2 mRNA measured by QPCR (A) and triglyceride (B) levels in RAW cells. Cells were treated with LPS at 100 ng/mL, Intralipid at 150 µg triglyceride/mL, or LPS and Intralipid in serum-free media for 16 hours. Data are presented as percent change of control (mean±SEM). **P<0.01; ***P<0.001.

We next studied macrophage activation by 2 other TLR ligands: zymosan as a model for fungal infection, and poly I:C as a model for viral infection (Figure 3). At doses comparable to that used for LPS stimulation, zymosan increases aP2 mRNA levels {approx}1500-fold (Figure 3, inset; note logarithmic scale), whereas poly I:C shows an {approx}9-fold increase. Activation of each TLR results in a different magnitude of change in aP2 expression, with a particularly robust response after TLR2 activation. This is especially notable in light of the unique microbial origins for each class of TLR agonist.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3. Effect of zymosan, poly I:C, and LPS treatment on aP2 mRNA levels measured by QPCR in RAW cells. Cells were treated with zymosan (TLR2 ligand), poly I:C (TLR3 ligand), or LPS (TLR4 ligand) at the indicated doses in serum-free media for 16 hours. Data are presented as percent change of control (mean±SEM). ***P<0.001.

A significant increase in macrophage aP2 protein is also apparent on stimulation with LPS or zymosan but not poly I:C (Figure 4). Therefore, the enhanced expression of aP2 mRNA leads to an increase in protein level. Because baseline expression of aP2 protein in macrophages is quite low and difficult to detect, the strong signal found on Western blotting of LPS or zymosan-treated cell lysates suggests a significant change in the cellular program for lipid metabolism. Given the low level of expression in control cells, we cannot rule out a small increase induced by poly I:C.



View larger version (19K):
[in this window]
[in a new window]
 
Figure 4. Western blot of aP2 protein expression. Cells were exposed to serum-free media with zymosan at 500 µg/mL, poly I:C at 50 µg/mL, or LPS at 100 ng/mL for 16 hours. The visualized bands were at 15 kDa, the expected size for aP2.

Consistent with the change in aP2, a considerable accumulation of triglyceride is seen in RAW cells treated with LPS or zymosan in the absence of serum or exogenous lipid when compared with control or poly I:C–treated cells (Figure 5A). Approximately twice the triglyceride content is found in the LPS or zymosan-treated cells. Notably, cells treated with Intralipid and LPS also show an {approx}2.2-fold increase in triglyceride content compared with Intralipid treatment alone (Figure 2B). This suggests a specific effect of TLR signaling on macrophage triglyceride content.



View larger version (22K):
[in this window]
[in a new window]
 
Figure 5. Effect of zymosan, poly I:C, and LPS treatment on triglyceride (A) and cholesteryl ester (B) accumulation in RAW cells. Cells were treated with LPS at 100 ng/mL, zymosan at 500 µg/mL, or poly I:C at 50 µg/mL in serum-free media for 16 hours. LDL concentration was 100 µg protein/mL (B). Data are presented as micrograms of triglyceride or cholesteryl ester per milligram of protein±SEM. **P<0.01; ***P<0.001.

No significant change is seen in macrophage cholesteryl ester content with LPS, zymosan, or poly I:C in the absence of exogenous LDL (data not shown), consistent with previously published observations for LPS.14 However, in the presence of LDL, cholesteryl ester content increases 5-fold in LPS- or zymosan-treated cells (Figure 5B). This increase is not seen with poly I:C–treated cells, further supporting a specific role for certain TLRs in macrophage lipid accumulation and foam cell formation.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Macrophages play an essential role in the development of atherosclerotic plaque by accumulating and storing lipid particles in the arterial wall.1 Activation of macrophages by TLR ligands has been shown to induce foam cell formation in murine macrophages by our laboratory and others.13,14 We now extend these findings to show LPS-mediated increases in mRNA and protein levels of aP2, an FABP found in macrophages that has been shown recently to have an important role in atherosclerosis. This intracellular transport protein is present at extremely low levels in macrophages at baseline, and its expression is dramatically increased on exposure to LPS and zymosan. Notably, this change in gene expression is paralleled by a substantial increase in intracellular cholesteryl ester and triglyceride levels consistent with foam cell formation but is not regulated by increased lipid concentration alone.

LPS has been shown to regulate a number of macrophage genes thought to have key roles in atherosclerosis. One of the early studies by Werb et al demonstrated reductions in apoE synthesis and secretion on exposure to low doses of LPS.25 Decreases in 2 important high-density lipoprotein (HDL) receptors, scavenger receptor B1 and ATP-binding cassette A1 (ABCA1), are also regulated in an LPS dose–dependent fashion.26,27 These changes contribute to decreased cholesterol efflux from macrophages and enhanced foam cell formation. Of note, induction of gene expression with LPS stimulation in macrophage models, such as that shown for aP2 here, has been reported less frequently in the literature than suppression of macrophage genes.

One proposed mechanism for the decrease in cholesterol efflux on LPS stimulation is the inhibition of liver X receptor (LXR) transcriptional activity in macrophages activated by TLR agonists. Castrillo et al have shown that this inhibition in RAW cells leads to decreases in the expression of LXR target genes, such as ABCA1.28 However, LPS also downregulates ABCA1 by a non-LXR–dependent mechanism in J774 murine macrophages.27 Nevertheless, a reciprocal relationship may exist between the regulation of inflammation and lipid metabolism in RAW cells such that LXR agonists inhibit expression of genes that mediate the inflammatory response in LPS-treated cells.29 This hypothesis provides an intriguing explanation for the cholesterol accumulation seen in this study with TLR activation under specific conditions.

The response of macrophage aP2 to LPS stimulation is exquisitely sensitive to LPS dose and occurs rapidly. Effects can be seen with as little as 1 ng/mL of LPS and as early as 8 hours after treatment. For comparison, the LD50 of LPS in mice is {approx}15 mg/kg or {approx}300 µg for a 20-g mouse. Previous studies have shown that expression of the aP2 gene is enhanced in macrophage cell lines treated with low levels of oxidized LDL, HDL, or peroxisome proliferator-activated receptor-{gamma} agonists.20,30,31 Induction of aP2 mRNA and protein expression under these conditions has a similar time course to that shown for LPS here. During infection, the presence of higher concentrations of LPS would be expected to lead to significant increases in the aP2 expression of participating macrophages. In fact, recent studies of periodontitis in human subjects have shown a correlation between the area of inflammation in the oral cavity and macrophage cytokine production and LDL cholesteryl ester uptake.32 These proatherogenic changes are thought to be mediated by increases in serum LPS during periodontal infection and have been postulated to augment the risk of vascular disease in affected individuals.33

Another novel finding here is that ligands for other TLRs also induce macrophage aP2 expression. Zymosan, a TLR2 ligand, and LPS, a TLR4 ligand, dramatically increase aP2 mRNA and protein levels, whereas poly I:C, a TLR3 ligand, shows much smaller increases. These data suggest that foam cell formation is part of an immune program activated by the TLR-mediated recognition of molecules associated with potentially harmful pathogens.34,35 However, the class of TLR activated is key to the changes seen in the regulation of lipid metabolism. In fact, it has been proposed that C pneumoniae, a microorganism associated with increased atherosclerosis risk, may stimulate cytokine production by means of non-LPS components recognized by TLR2, the same TLR that mediates the potent response to zymosan.36

Although there is a 5-fold increase in cholesteryl ester and 2-fold increase in triglyceride content of cells treated with either LPS or zymosan, neither accumulate to a significant extent in poly I:C–stimulated cells compared with control. These results parallel the enhanced expression of aP2 with LPS or zymosan treatment. Given the significant role of aP2 in atheroma formation that has been shown in knockout mouse models, this parallel increase is highly suggestive of a key role for aP2 in macrophage lipid accumulation. The increase in aP2 expression likely assists with the transport of fatty acids needed for esterification of cholesterol and accumulation of triglyceride. The data with Intralipid demonstrate that it is the TLR ligand that induces aP2 expression, not the increase in lipid concentration.

Thus, aP2 is induced during the innate immune response of macrophages in which stored lipid likely plays a role in host defense. Notably, the growth of C pneumoniae in lipid-loaded macrophages is inhibited.37 This metabolic shift may serve as an effective method for neutralization of intracellular pathogens in the short term. However, chronic activation of macrophage TLRs can lead to plaque formation and clinical atherosclerosis.


*    Acknowledgments
 
This work was supported by grants from the Research Service of the Department of Veterans Affairs and by National Institutes of Health Grant AR 39639.

Received January 5, 2005; accepted February 2, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 

  1. Ross R. Atherosclerosis–an inflammatory disease. N Engl J Med. 1999; 340: 115–126.[Free Full Text]
  2. Hendrix MG, Salimans MM, van Boven CP, Bruggeman CA. High prevalence of latently present cytomegalovirus in arterial walls of patients suffering from grade III atherosclerosis. Am J Pathol. 1990; 136: 23–28.[Abstract]
  3. Jackson LA, Campbell LA, Schmidt RA, Kuo CC, Cappuccio AL, Lee MJ, Grayston JT. Specificity of detection of Chlamydia pneumoniae in cardiovascular atheroma: evaluation of the innocent bystander hypothesis. Am J Pathol. 1997; 150: 1785–1790.[Abstract]
  4. Rock FL, Hardiman G, Timans JC, Kastelein RA, Bazan JF. A family of human receptors structurally related to Drosophila Toll. Proc Natl Acad Sci U S A. 1998; 95: 588–593.[Abstract/Free Full Text]
  5. Beutler B. Inferences, questions and possibilities in Toll-like receptor signaling. Nature. 2004; 430: 257–263.[CrossRef][Medline] [Order article via Infotrieve]
  6. Poltorak A, He X, Smirnova I, Liu MY, Van Huffel C, Du X, Birdwell D, Alejos E, Silva M, Galanos C, Freudenberg M, Ricciardi-Castagnoli P, Layton B, Beutler B. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science. 1998; 282: 2085–2088.[Abstract/Free Full Text]
  7. Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, Akira S. A Toll-like receptor recognizes bacterial DNA. Nature. 2000; 408: 740–745.[CrossRef][Medline] [Order article via Infotrieve]
  8. Sato M, Sano H, Iwaki D, Kudo K, Konishi M, Takahashi H, Takahashi T, Imaizumi H, Asai Y, Kuroki Y. Direct binding of Toll-like receptor 2 to zymosan, and zymosan-induced NF-kappa B activation and TNF-alpha secretion are down-regulated by lung collectin surfactant protein A. J Immunol. 2003; 171: 417–425.[Abstract/Free Full Text]
  9. Lund JM, Alexopoulou L, Sato A, Karow M, Adams NC, Gale NW, Iwasaki A, Flavell RA. Recognition of single-stranded RNA viruses by Toll-like receptor 7. Proc Natl Acad Sci U S A. 2004; 101: 5598–5603.[Abstract/Free Full Text]
  10. Kiechl S, Lorenz E, Reindl M, Wiedermann CJ, Oberhollenzer F, Bonora E, Willeit J, Schwartz DA. Toll-like receptor 4 polymorphisms and atherogenesis. N Engl J Med. 2002; 347: 185–192.[Abstract/Free Full Text]
  11. Ohashi K, Burkart V, Flohe S, Kolb H. Cutting edge: heat shock protein 60 is a putative endogenous ligand of the Toll-like receptor-4 complex. J Immunol. 2000; 164: 558–561.[Abstract/Free Full Text]
  12. Okamura Y, Watari M, Jerud ES, Young DW, Ishizaka ST, Rose J, Chow JC, Strauss JF III. The extra domain A of fibronectin activates Toll-like receptor 4. J Biol Chem. 2001; 276: 10229–10233.[Abstract/Free Full Text]
  13. Oiknine J, Aviram M. Increased susceptibility to activation and increased uptake of low-density lipoprotein by cholesterol-loaded macrophages. Arterioscler Thromb. 1992; 12: 745–753.[Abstract/Free Full Text]
  14. Funk JL, Feingold KR, Moser AH, Grunfeld C. Lipopolysaccharide stimulation of RAW 264.7 macrophages induces lipid accumulation and foam cell formation. Atherosclerosis. 1993; 98: 67–82.[CrossRef][Medline] [Order article via Infotrieve]
  15. Ostos MA, Recalde D, Zakin MM, Scott-Algara D. Implication of natural killer T cells in atherosclerosis development during a LPS-induced chronic inflammation. FEBS Lett. 2002; 519: 23–29.[CrossRef][Medline] [Order article via Infotrieve]
  16. Boord JB, Fazio S, Linton MF. Cytoplasmic fatty acid-binding proteins: emerging roles in metabolism and atherosclerosis. Curr Opin Lipidol. 2002; 13: 141–147.[CrossRef][Medline] [Order article via Infotrieve]
  17. Distel RJ, Robinson GS, Spiegelman BM. Fatty acid regulation of gene expression. Transcriptional and post-transcriptional mechanisms. J Biol Chem. 1992; 267: 5937–5941.[Abstract/Free Full Text]
  18. Amri EZ, Bertrand B, Ailhaud G, Grimaldi P. Regulation of adipose cell differentiation. I. Fatty acids are inducers of the aP2 gene expression. J Lipid Res. 1991; 32: 1449–1456.[Abstract]
  19. Makowski L, Boord JB, Maeda K, Babaev VR, Uysal KT, Morgan MA, Parker RA, Suttles J, Fazio S, Hotamisligil GS, Linton MF. Lack of macrophage fatty-acid-binding protein aP2 protects mice deficient in apolipoprotein E against atherosclerosis. Nat Med. 2001; 7: 699–705.[CrossRef][Medline] [Order article via Infotrieve]
  20. Fu Y, Luo N, Lopes-Virella MF. Oxidized LDL induces the expression of ALBP/aP2 mRNA and protein in human THP-1 macrophages. J Lipid Res. 2000; 41: 2017–2023.[Abstract/Free Full Text]
  21. Fu Y, Luo N, Lopes-Virella MF, Garvey WT. The adipocyte lipid binding protein (ALBP/aP2) gene facilitates foam cell formation in human THP-1 macrophages. Atherosclerosis. 2002; 165: 259–269.[CrossRef][Medline] [Order article via Infotrieve]
  22. Sun L, Nicholson AC, Hajjar DP, Gotto AM Jr, Han J. Adipogenic differentiating agents regulate expression of fatty acid binding protein and CD36 in the J744 macrophage cell line. J Lipid Res. 2003; 44: 1877–1886.[Abstract/Free Full Text]
  23. Boord JB, Maeda K, Makowski L, Babaev VR, Fazio S, Linton MF, Hotamisligil GS. Adipocyte fatty acid-binding protein, aP2, alters late atherosclerotic lesion formation in severe hypercholesterolemia. Arterioscler Thromb Vasc Biol. 2002; 22: 1686–1691.[Abstract/Free Full Text]
  24. Layne MD, Patel A, Chen YH, Rebel VI, Carvajal IM, Pellacani A, Ith B, Zhao D, Schreiber BM, Yet SF, Lee ME, Storch J, Perrella MA. Role of macrophage-expressed adipocyte fatty acid binding protein in the development of accelerated atherosclerosis in hypercholesterolemic mice. FASEB J. 2001; 15: 2733–2735.[Free Full Text]
  25. Werb Z, Chin JR. Endotoxin suppresses expression of apoprotein E by mouse macrophages in vivo and in culture. A biochemical and genetic study. J Biol Chem. 1983; 258: 10642–10648.[Abstract/Free Full Text]
  26. Baranova I, Vishnyakova T, Bocharov A, Chen Z, Remaley AT, Stonik J, Eggerman TL, Patterson AP. Lipopolysaccharide down regulates both scavenger receptor B1 and ATP binding cassette transporter A1 in RAW cells. Infect Immun. 2002; 70: 2995–3003.[Abstract/Free Full Text]
  27. Khovidhunkit W, Moser AH, Shigenaga JK, Grunfeld C, Feingold KR. Endotoxin down-regulates ABCG5 and ABCG8 in mouse liver and ABCA1 and ABCG1 in J774 murine macrophages: differential role of LXR. J Lipid Res. 2003; 44: 1728–1736.[Abstract/Free Full Text]
  28. Castrillo A, Joseph SB, Vaidya SA, Haberland M, Fogelman AM, Cheng G, Tontonoz P. Crosstalk between LXR and Toll-like receptor signaling mediates bacterial and viral antagonism of cholesterol metabolism. Mol Cell. 2003; 12: 805–816.[CrossRef][Medline] [Order article via Infotrieve]
  29. Joseph SB, Castrillo A, Laffitte BA, Mangelsdorf DJ, Tontonoz P. Reciprocal regulation of inflammation and lipid metabolism by liver X receptors. Nat Med. 2003; 9: 213–219.[CrossRef][Medline] [Order article via Infotrieve]
  30. Cabrero A, Cubero M, Llaverias G, Jove M, Planavila A, Alegret M, Sanchez R, Laguna JC, Carrera MV. Differential effects of peroxisome proliferator-activated receptor activators on the mRNA levels of genes involved in lipid metabolism in primary human monocyte-derived macrophages. Metabolism. 2003; 52: 652–657.[CrossRef][Medline] [Order article via Infotrieve]
  31. Han J, Hajjar DP, Zhou X, Gotto AM Jr, Nicholson AC. Regulation of peroxisome proliferator-activated receptor-gamma-mediated gene expression. A new mechanism of action for high-density lipoprotein. J Biol Chem. 2002; 277: 23582–23586.[Abstract/Free Full Text]
  32. Pussinen PJ, Vilkuna-Rautiainen T, Alfthan G, Palosuo T, Jauhiainen M, Sundvall J, Vesanen M, Mattila K, Asikainen S. Severe periodontitis enhances macrophage activation via increased serum lipopolysaccharide. Arterioscler Thromb Vasc Biol. 2004; 24: 2174–2180.[Abstract/Free Full Text]
  33. Mattila KJ, Valtonen VV, Nieminen MS, Asikainen S. Role of infection as a risk factor for atherosclerosis, myocardial infarction, and stroke. Clin Infect Dis. 1998; 26: 719–734.[Medline] [Order article via Infotrieve]
  34. Michelsen KS, Doherty TM, Shah PK, Arditi M. TLR signaling: an emerging bridge from innate immunity to atherogenesis. J Immunol. 2004; 173: 5901–5907.[Abstract/Free Full Text]
  35. Vink A, De Kleijn DP, Pasterkamp G. Functional role for Toll-like receptors in atherosclerosis and arterial remodeling. Curr Opin Lipidol. 2004; 15: 515–521.[CrossRef][Medline] [Order article via Infotrieve]
  36. Netea MG, Kullberg BJ, Galama JM, Stalenhoef AF, Dinarello CA, Van der Meer JW. Non-LPS components of Chlamydia pneumoniae stimulate cytokine production through Toll-like receptor 2-dependent pathways. Eur J Immunol. 2002; 32: 1188–1195.[CrossRef][Medline] [Order article via Infotrieve]
  37. Blessing E, Kuo CC, Lin TM, Campbell LA, Bea F, Chesebro B, Rosenfeld ME. Foam cell formation inhibits growth of Chlamydia pneumoniae but does not attenuate Chlamydia pneumoniae–induced secretion of proinflammatory cytokines. Circulation. 2002; 105: 1976–1982.[Abstract/Free Full Text]

Related Article:

Toll To Be Paid at the Gateway to the Vessel Wall
Göran K. Hansson and Kristina Edfeldt
Arterioscler. Thromb. Vasc. Biol. 2005 25: 1085-1087. [Full Text] [PDF]



This article has been cited by other articles:


Home page
J. Lipid Res.Home page
C. Grunfeld and K. R. Feingold
HDL and innate immunity: a tale of two apolipoproteins
J. Lipid Res., August 1, 2008; 49(8): 1605 - 1606.
[Full Text] [PDF]


Home page
J. Lipid Res.Home page
P. M. Hutchins, R. M. Barkley, and R. C. Murphy
Separation of cellular nonpolar neutral lipids by normal-phase chromatography and analysis by electrospray ionization mass spectrometry
J. Lipid Res., April 1, 2008; 49(4): 804 - 813.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Niessner, M. S. Shin, O. Pryshchep, J. J. Goronzy, E. L. Chaikof, and C. M. Weyand
Synergistic Proinflammatory Effects of the Antiviral Cytokine Interferon-{alpha} and Toll-Like Receptor 4 Ligands in the Atherosclerotic Plaque
Circulation, October 30, 2007; 116(18): 2043 - 2052.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
A. Xu, Y. Wang, J. Y. Xu, D. Stejskal, S. Tam, J. Zhang, N. M.S. Wat, W. K. Wong, and K. S.L. Lam
Adipocyte Fatty Acid-Binding Protein Is a Plasma Biomarker Closely Associated with Obesity and Metabolic Syndrome
Clin. Chem., March 1, 2006; 52(3): 405 - 413.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. R. Bornstein, H. Morawietz, M. R. Kazemi, C. Grunfeld, and K. R. Feingold
Toll-Like Receptors, Endocrine Stress Response, and Arteriosclerosis
Arterioscler. Thromb. Vasc. Biol., September 1, 2005; 25(9): e135 - e135.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
G. K. Hansson and K. Edfeldt
Toll To Be Paid at the Gateway to the Vessel Wall
Arterioscler. Thromb. Vasc. Biol., June 1, 2005; 25(6): 1085 - 1087.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
25/6/1220    most recent
01.ATV.0000159163.52632.1bv1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kazemi, M. R.
Right arrow Articles by Feingold, K. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kazemi, M. R.
Right arrow Articles by Feingold, K. R.
Related Collections
Right arrowRelated Article