Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2005;25:1078-1084
Published online before print February 17, 2005, doi: 10.1161/01.ATV.0000159701.24372.49
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
25/5/1078    most recent
01.ATV.0000159701.24372.49v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dong, J.
Right arrow Articles by Kitabatake, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dong, J.
Right arrow Articles by Kitabatake, A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*LOVASTATIN
Medline Plus Health Information
*Statins
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2005;25:1078.)
© 2005 American Heart Association, Inc.


Thrombosis

Interleukin-6 and Mevastatin Regulate Plasminogen Activator Inhibitor-1 Through CCAAT/Enhancer-Binding Protein-{delta}

Jie Dong; Satoshi Fujii; Hongmei Li; Hidekazu Nakabayashi; Masaharu Sakai; Shinzo Nishi; Daisuke Goto; Tomoo Furumoto; Shogo Imagawa; Tarikuz A.K.M. Zaman; Akira Kitabatake

From the Departments of Cardiovascular Medicine and Molecular Biology, Hokkaido University Graduate School of Medicine, Sapporo, Japan.

Correspondence to Satoshi Fujii, MD, PhD, The Department of Cardiovascular Medicine, Hokkaido University Graduate School of Medicine, Kita 15, Nishi 7, Kitaku, Sapporo, Japan 060-8638. E-mail sfujii{at}med.hokudai.ac.jp


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Objective— We sought to determine the etiologic mechanism of proinflammatory cytokine, interleukin-6 (IL-6), and statin as regulators of synthesis of plasminogen activator inhibitor-1 (PAI-1), the physiological fibrinolysis inhibitor and an acute-phase reactant.

Methods and Results— Transient transfection and luciferase assay in HepG2 human hepatoma-derived cells demonstrated that IL-6 increased PAI-1 promoter activity and mevastatin decreased IL-6–inducible response. Systematic deletion assay of the promoter demonstrated that the region (–239 to –210 bp) containing a putative CCAAT/enhancer-binding protein (C/EBP) binding site was necessary. Point mutation in this site abolished the IL-6–inducible response. Electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that C/EBP{alpha}, C/EBPß, and C/EBP{delta} were involved in protein–DNA complex formation in intact cells. Deoxyribonuclease (DNase) I footprinting analysis revealed that 5' flanking region (–232 to –210 bp) is acute-phase response protein-binding site. C/EBP{delta} binding activity was increased by IL-6 and attenuated by mevastatin. Mevastatin attenuated IL-6–mediated increase of C/EBP{delta} protein in the nuclear extracts. IL-6 also increased PAI-1 and C/EBP{delta} mRNA in mouse primary hepatocytes.

Conclusions— IL-6 increases hepatic PAI-1 expression mediated by the –232- to –210-bp region of the promoter containing a C/EBP{delta} binding site. Vascular protection by statins may be partly mediated through regulation of CEBP{delta} and consequent modulation of PAI-1 expression.

IL-6 increases hepatic PAI-1 expression mediated by the –232- to –210-bp region of the promoter containing a C/EBP{delta} binding site. Mevastatin attenuated IL-6–mediated increase of C/EBP{delta} protein in the nuclear extracts. C/EBP{delta} may be responsible for hepatic PAI-1 expression induced by IL-6 and its attenuation by statins.


Key Words: IL-6 • statins • PAI-1 • C/EBP • thrombosis


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Atherosclerosis is accelerated by acute-phase response, which involves altered hepatic protein synthesis.1 Plasminogen activator inhibitor-1 (PAI-1), the physiological inhibitor of fibrinolysis, is an acute-phase protein that impairs fibrinolysis.2 Increased PAI-1 expression is implicated for atherothrombosis.3 PAI-1 promoter contains transcription factor binding sites responsible for inducible expressions.4–9 Increases of acute-phase proteins including PAI-1 are attributable largely to changes in hepatic productions by proinflammatory cytokines. Interleukin-6 (IL-6) is the principal stimulator of most acute-phase proteins.10 CCAAT/enhancer-binding proteins (C/EBPs) binding motifs are identified in the promoter regions of most acute-phase protein genes.11 However, no classic inflammatory responsive element was found in the PAI-1 promoter, and it is unclear via which mechanism PAI-1 expression is increased by cytokines.

The 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors (statins) exert beneficial effects on coronary diseases beyond cholesterol lowering.12 Statins decrease PAI-1 expression induced by IL-6 in HepG2 cells, highly differentiated human hepatoma-derived cells used as in vitro models of acute-phase response.13 Statins can modify fibrinolytic potential of endothelial cells via inhibition of geranylgeranylated Rho protein14 and act on PAI-1 transcription12 and inhibit inflammatory transcription factors.15 The purpose of this study was to elucidate the mechanism of increased PAI-1 production induced by IL-6 and to investigate inhibitory mechanisms of statins on hepatic PAI-1 expression.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Cultures
HepG2 cells (American Type Culture Collection) were cultured as described previously.13 When cells reached 80% confluence, they were washed with PBS and incubated in serum-free medium for 24 hours. The medium was replaced with fresh serum-free medium containing 1 ng/mL IL-6 or 10 µmol/L mevastatin (Sigma). Hepatocytes were isolated by 2-step collagenase perfusion16 from male ICR mice (Hokkaido University Laboratory Animal Center). The procedures conformed with institutional animal study guidelines. Primary hepatocytes were cultured in Williams medium E containing 10% FBS, 0.1 µmol/L insulin, 1.0 µmol/L dexamethasone, and 20 ng/mL epidermal growth factor. Hepatocytes were incubated in serum-free medium 48 hours after plantation and stimulated with IL-6 72 hours after plantation.

Plasmid Constructs
The human PAI-1 promoter region from –829 to +36 bp was amplified using human genomic DNA as template, with upstream (GGGGTACCCGTTGGTCTCCTGTTTCCTTACCAAGC) and downstream (CCGGCTCGAGGACAGCGCTCTTGGCCCTGCAGCCA) primers incorporating the restriction sites for KpnI and XhoI. After digestion by KpnI and XhoI, polymerase chain reaction (PCR) product was ligated into luciferase reporter plasmid (pGL3-basic; Promega). The produced plasmid was named as PAI (–829). The same method was used to construct deletion mutant plasmids. The primers were: PAI-1 (–663) GGGGTACCT GTATCATCGGAGGCGGCCGGGCACA; PAI-1 (–539) GGGGTACCCTGTTGGGCTGGGCCAGGAGGAGG; PAI-1 (–488) GGGGTACCAGAGCACCGGGTGGACAGCCCTGGGG; PAI-1 (–366) GGGGTACCTCCAAGCTGAACACTAGGGGTCCT; PAI-1 (–308) GGGGTACCAACCTGGCAGGACATCCGGGAGAGAC; PAI-1 (–239) GGG GTACCAAGGCTATTGGGGTTTGCTCAATTG; and PAI-1 (–210) GCGGTACCCCTGAAT GCTCTTACACACGTACA.

Site-directed mutagenesis of putative C/EBP site was performed by overlap-extension PCR strategy (primer GGCTATTGGGGTGCTTTCGCTTGTTCCTGAATGCTC).17 Correct assembly was verified by restriction analysis. Mutated regions generated by PCR were sequenced to identify clones without polymerase errors.

Transient Transfections and Luciferase Assay
HepG2 cells were seeded at 8x105/well on 6-well plates. After 24 hours, 1.5 µg of PAI-1 promoter Firefly luciferase fusion DNA reporter in pGL3-basic construct was cotransfected with 1 µg of Renilla luciferase pRL-TK vector (Promega; for transfection efficiency control) using DNA–calcium phosphate coprecipitation method. Medium was replaced by serum-free medium 6 hours after transfection. Cells were stimulated with IL-6 or mevastatin 24 hours after transfection and harvested 48 hours after transfection. In some experiments, cells were incubated with geranylgeranyl pyrophosphate (GGPP) or farnesyl pyrophosphate (FPP).

Cell lysate luciferase activity was determined using Dual-Luciferase Reporter Assay System (Promega).9 Results for each reporter construct were expressed as fold induction compared with the results in unstimulated cells transfected with the same reporter. For overexpression experiments, wild-type or mutant PAI (–829), the pSV–ß-galactosidase construct (Promega; for transfection efficiency control) and C/EBP{alpha}, C/EBPß, or C/EBP{delta} expression vector18 were cotransfected.

Electrophoretic Mobility Shift Assay
For electrophoretic mobility shift assay (EMSA) of HepG2 cells, probes encompassing putative C/EBP motif and mutant probes were prepared using paired complementary oligonucleotides: PAI-1 C/EBP (AGCTTATTGGGGTTTGCTCAATTGTTCCT); and PAI-1 C/EBP mut (AGCTTATTGGGGTGCTTTCGCTTGTTCCT).

For EMSA of mice hepatocytes, probes encompassing putative C/EBP motif were prepared: mouse PAI-1 C/EBP (TCGAACCAGGGTTTGCTCAATTATCCCC).

Probes end-labeled with [{alpha}-32P]dCTP by Klenow fragment of DNA polymerase I (Takara) were purified. The nuclear extracts were prepared using extraction kit (N-XTRACT; Sigma). DNA-binding reactions were performed with 10 µg nuclear extracts and 6-fmol/L–labeled probe for 15 minutes. In inhibition experiments, cold competitor probe was added at 100-fold molar excess. For EMSA supershift analysis, antibodies (Santa Cruz Biotechnology) against C/EBP{alpha} (sc-61X), C/EBPß (sc-150X), and C/EBP{delta} (sc-636X) were incubated with nuclear extracts for 10 minutes before addition of the probes. DNA–protein complexes were resolved by 6% polyacrylamide gel and autoradiography was performed. Images were analyzed by densitometry (ImageJ software; NIH).

DNase I Footprinting Analysis
A fragment (–272 to –159 bp) of PAI-1 promoter for probe preparation was amplified using primers (upstream: CGTACACACACAGAGCAGCA; downstream: CTCTGGGAGTCCGTCTGAAC) and ligated into T-easy vector (Promega) and restricted by SphI and SalI. The probe was prepared by filling in the 5'-overhang end of the fragment using Klenow DNA polymerase I (Takara) and [{alpha}-32P]dCTP. Nuclear extracts were incubated for 15 minutes at room temperature after adding 32P-labeled probe with the same condition as that of EMSA, and then treated with DNase I (Takara) for 1.5 minutes. After proteinase K treatment, DNA was extracted and analyzed on 6% polyacrylamide gels containing 8 mol/L urea. Adenine and guanine bases of the same probes were modified and digested by Maxam–Gilbert method and loaded as a marker.

RNA Isolation and RT-PCR
Total RNA was extracted using Isogen (Wako). RNA was reverse-transcribed and standard PCR was performed using RNA PCR Kit (AMV; Takara). The following PCR primers were used: for human C/EBP{delta}, upstream (GACTCAGCAACGACCCATACC) and downstream (TGCTCAGTCTTTTCCTCTTAT) primers, and for human ß-actin, upstream (CTGTCTGGCGGCACCACCAT) and downstream (GCAACTAAGTCATAGTCCGC) primers. PCR products with expected length of 317 and 254 bp were electrophoresed in agarose and visualized by ethidium bromide. Mouse PAI-1 and C/EBP{delta} mRNA were determined by quantitative real-time RT-PCR using SYBR Green I kit (Takara) and PRISM 7000 (Applied Biosystems) according to manufacturer instructions. The following PCR primers were used: for mouse PAI-1, upstream (GACACCCTCAGCATGTTCATC) and downstream (AGGGTTGCACTAAACATGTCAG) primers, for mouse C/EBP{delta}, upstream (CTCCCGCACACAACATACTG) and downstream (CTTCGGCAACCACCTAAAAG) primers, and for mouse ß-actin, upstream (TGCGTGACATCAAAGAGAAG) and downstream (GATGCCACAGGATTCCATA) primers. After PCR, melting curve was constructed to ensure elimination of nonspecific products. The amount of mRNA was determined by comparing with the standard curve generated from serial dilutions of T-vector containing cDNA of the gene.

Western Blot Analysis of C/EBP{delta}
Immunologic detection of C/EBP{delta} with rabbit polyclonal C/EBP{delta} antibody (sc-636; Santa Cruz Biotechnology; 1:500 dilution) was performed as described previously.13 In brief, 20-µg extracts were loaded on 8% polyacrylamide gel, electrophoresed, and transferred to polyvinylidene difluoride membranes, which were blocked with Tween-Tris–buffered salt solution (TTBS) containing 5% skim milk. Membranes were incubated overnight at 4°C with rabbit polyclonal C/EBP{delta} antibody. After washing 3x with TTBS, membranes were incubated with anti-rabbit IgG-AP (Santa Cruz Biotechnology) for 1hour at room temperature. Immunologic detection was performed with a ProtoBlot AP System (Promega). Images were analyzed in a densitometer. Antihistone H1 antibody (Santa Cruz Biotechnology) was used to confirm equal sample loading.

Chromatin Immunoprecipitation Assays
Chromatin immunoprecipitation (ChIP) assay was performed according to manufacturer instructions (Upstate Cell Signaling Solutions). Cells were cross-linked with 1% formaldehyde for 10 minutes at 37°C. After washing with ice-cold PBS, cells were lysed for 10 minutes (6x106 cells/300 µL of sodium dodecyl sulfate [SDS] lysis buffer). The chromatin was sheared by sonication to reduce DNA length between 200 bp and 1000 bp and was precleared with salmon sperm DNA/protein A agarose–50% slurry. Antibodies against C/EBP{alpha} (sc-61), C/EBPß (sc-150), C/EBP{delta} (sc-636), or preimmune serum were added with chromatin samples. Samples were incubated overnight at 4°C. Immune complexes were collected with salmon sperm DNA/protein A agarose, washed, and eluted. Cross-linking was reversed at 65°C and digested with proteinase K. DNA was purified and extracted with phenol-chloroform, precipitated with ethanol, dissolved in Tris–EDTA, and used for PCR using upstream (AGGCAAACGTGAGCTGTTTT) and downstream (CTCTGGGAGTCCGTCTGAAC) primers. PCR product spanning from –391 to –86 bp of PAI-1 promoter was generated. PCR products were electrophoresed in agarose gel and visualized by ethidium bromide.

Statistical Analysis
All experiments were conducted in duplicate with independent separate cultures (n=number of independent experiments). Data are expressed as mean±SD. Statistical comparison of control with treated groups was carried by Student’s t test. The accepted level of significance was P<0.05.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Effects of IL-6 and Mapping of IL-6–Responsive Element in PAI-1 Promoter
The effect of IL-6 on PAI-1 promoter activity was studied using the transient transfections and luciferase assay. IL-6 increased PAI-1 promoter activity by 2.4±0.2-fold over control (Figure 1A). To localize the regulatory elements responsible for the induction of PAI-1 transcriptional activity by IL-6, HepG2 cells were transfected with 7 luciferase reporter vectors containing different deletion length of the PAI-1 promoter regions. An effective decrease of PAI-1 promoter activity induced by IL-6 was not observed until up to –239 bp. The deletion of the region from –239 to –210 bp resulted in a significant decrease of IL-6–inducible PAI-1 promoter activity by 85±9%.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. A, Effect of IL-6 on PAI-1 promoter activity. Left, Schematic presentation of PAI (–829) vectors, a series of deletion mutant vectors of PAI-1 promoter. Right, Relative luciferase activity of PAI-1 promoter constructs. #P<0.01 vs PAI (–829) without IL-6 (1 ng/mL; n=6) *P<0.01 vs IL-6–stimulated PAI (–829) (n=6). Values are means±SD of fold increase over controls without IL-6. B, Effect of mevastatin, GGPP, and FPP on PAI-1 promoter activity. HepG2 cells were incubated with IL-6 or mevastatin (10 µmol/L), GGPP (20 µmol/L), or FPP (20 µmol/L). Values are means±SD of fold increase over controls without agents. #P<0.01 vs PAI (–829) without IL-6 (n=6) *P<0.01 vs IL-6–stimulated PAI (–829) (n=6). C, Effect of C/EBP binding site mutation on PAI-1 promoter activity. Wild-type indicates PAI (–829) (closed bars). Mutant indicates PAI-1 promoter containing a mutated C/EBP binding site (open bars). Luciferase activities of PAI-1 promoters were normalized using wild-type control. #P<0.01 vs PAI (–829) without IL-6 (n=6) *P<0.01 vs IL-6–stimulated PAI (–829) (n=6).

Effects of Mevastatin on PAI-1 Promoter Activity
Mevastatin decreased IL-6–inducible PAI-1 promoter activity by 50±6% (Figure 1B). To test whether the inhibitory effects are mediated by protein isoprenylation, mevastatin effect was evaluated in the presence of GGPP or FPP. When acting alone, neither GGPP nor FPP modified promoter activity. GGPP attenuated the mevastatin-mediated reduction of promoter activity. FPP exerted no effects, suggesting that geranylgeranylation can be involved in mevastatin-mediated reduction of promoter activity induced by IL-6. Based on a computer-based transcription factor database analysis, the region from –239 to –210 bp contained a putative C/EBP binding site. The site-directed mutagenesis analysis of this site indicated that basal activity of PAI-1 promoter was reduced and IL-6–inducible promoter activity was essentially abolished (Figure 1C). Mevastatin did not alter baseline or IL-6–induced promoter activity in mutants. The results demonstrated that the region from –239 to –210 bp is critical and necessary for stimulatory effect of IL-6.

Verification of the Putative C/EBP Site of PAI-1 Promoter
To verify the existence of putative C/EBP site in PAI-1 promoter, EMSA, using HepG2 nuclear extract and a fragment of PAI-1 promoter (–233 to –207 bp), was performed (Figure 2A). Three complex bands were detected (lane 2). Competition experiments indicated that the complex bands were competed out exclusively by adding excess unlabeled probe containing the putative C/EBP site (lane 3). No competition occurred when excess unlabeled probe with mutations in the putative C/EBP site was added (lane 4). The complex bands were competed out also by adding the probe containing the C/EBP consensus sequence (TGCAGATTGCGCAATCTGCA; lane 5). The results indicated that the binding reaction of nuclear proteins with the probe was specific and the probe contained a C/EBP binding site. DNA–protein complexes were characterized further with antibodies against 3 major members of the C/EBP family: C/EBP{alpha} (lane 6), C/EBPß (lane 7), and C/EBP{delta} (lane 8). Complex 1 band was supershifted by antibodies against C/EBP{alpha} and C/EBPß. Complex 2 band was supershifted by antibodies against C/EBPß and C/EBP{delta}. Complex 3 band was supershifted by antibody against C/EBPß. The results indicated that C/EBP{alpha}, C/EBPß, and C/EBP{delta} were all involved in DNA–protein complex formation.



View larger version (79K):
[in this window]
[in a new window]
 
Figure 2. A, EMSA on binding of HepG2 nuclear extracts and the probe (–233 to –207 bp; a fragment of PAI-1 promoter; 6 fmol/L) containing putative C/EBP binding site. Lane 1, No nuclear protein; lane 2, 10 µg nuclear protein; lane 3, 100-fold molar excess of unlabeled competitor containing putative C/EBP site (W); lane 4, 100-fold molar excess of unlabeled competitor containing putative C/EBP site mutated (M); lane 5, 100-fold molar excess of unlabeled competitor containing C/EBP consensus sequence (C); lane 6, 2 µg antibody against C/EBP{alpha}; lane 7, 2 µg antibody against C/EBPß; lane 8, 2 µg antibody against C/EBP{delta}. Complexes (C) 1, 2, and 3 indicate the band of DNA–protein complex formation. Vertical line indicates supershift band of C/EBP{alpha}, C/EBPß, and C/EBP{delta}. B, DNase I footprinting analysis of C/EBP binding site in PAI-1 promoter. Probe (–272 to –159 bp) was mixed with HepG2 nuclear proteins, treated with different concentration of DNase I according to the dose of nuclear proteins, and analyzed by denatured polyacrylamide gel electrophoresis. Footprinting regions are indicated by vertical bars and lined under the sequences. Lane 1, marker, the same probe modified and digested by Maxam–Gilbert method; lane 2, control (no nuclear protein). Dose of nuclear proteins used was lane 3, 20 µg; lane 4, 40 µg; lane 5, 80 µg; and lane 6, 160 µg. A representation blot from 3 separate experiments with identical results is shown.

Identification of the C/EBP Binding Site in PAI-1 Promoter
To confirm the C/EBP binding sequence on the promoter DNase I footprinting analysis was performed using a fragment of the PAI-1 5'-flanking region spanning from –272 to –159 bp containing C/EBP binding site and using nuclear extracts. With the increased dose of nuclear proteins, a footprinting region (–232 to –210 bp; 5'-TATTGGGGTTTGCTCAATTGTTC-3') corresponding to the putative C/EBP binding site was observed (Figure 2B). The result indicated that PAI-1 5'-flanking region from –232 to –210 bp is a protein-binding site. The result, together with the EMSA results, gave further evidence that the region contained a C/EBP binding site.

Effects of Overexpression of C/EBP Transcription Factors on PAI-1 Promoter Activity
To further define the role of C/EBP family members in modulating PAI-1 gene transcription, C/EBP expression vectors for {alpha}, ß, and {delta} were transiently cotransfected with the PAI (–829). Overexpression of C/EBPß and C/EBP{delta} increased PAI-1 promoter activity by 7.6±0.3-fold and 2.8±0.2-fold, respectively (Figure 3). In contrast, overexpression of C/EBP{alpha} significantly decreased promoter activity by 33±4%. Mutation of the identified C/EBP binding site of PAI-1 promoter essentially abolished C/EBP-induced increase of promoter activity. The results indicated that C/EBP binding site is essential for PAI-1 promoter regulation, where the C/EBPß and C/EBP{delta} enhanced and C/EBP{alpha} decreased the promoter activity.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Activation of PAI-1 promoter by cotransfection of C/EBP expression vector and its attenuation by mutation of C/EBP binding site. Wild-type indicates PAI(–829) (closed bars). Mutant indicates PAI-1 promoter containing a mutated C/EBP binding site (open bars). Either wild-type or mutant vector (1.5 µg) was transiently cotransfected to HepG2 cells with pSV–ß-galactosidase (1 µg; for transfection efficiency control) and expression vector (0.5 µg) for C/EBP{alpha}, C/EBPß, or C/EBP{delta}. After 48 hours, cells were harvested and luciferase and ß-galactosidase activities were measured. Luciferase activities were normalized using wild-type control that was not cotransfected with C/EBP expression vectors. Values are means±SD (n=3) of fold increase over ß-galactosidase control.

Critical Role of C/EBP{delta} on IL-6 Response in PAI-1 Promoter and Its Attenuation by Mevastatin
To verify whether IL-6 response in PAI-1 promoter is mediated by C/EBP and which member of C/EBP family is involved in the response, the IL-6–induced C/EBP binding activity and the effects of mevastatin were determined by EMSA using antibodies against C/EBP{alpha}, C/EBPß, and C/EBP{delta}. Without antibodies, 3 complex bands were detected (Figure 4A). Complex 2 including C/EBP{delta} was increased by IL-6 and mevastatin attenuated the IL-6 effects. When antibody against C/EBP{alpha} was used, supershift band was decreased slightly by 4 hours of treatment of IL-6, and mevastatin had no effect (Figure 4B). When antibody against C/EBPß was used, supershift band was not significantly changed (Figure 4C). In contrast to C/EBP{alpha} and C/EBPß, C/EBP{delta} binding activity was increased by 2 hours after stimulation with IL-6 and was consistently elevated until 12 hours (P<0.01; Figure 4D and 4E). Mevastatin attenuated the response 4 hours after treatment and the effect continued for 12 hours (P<0.01; Figure 4D and 4E). No significant change of the C/EBP{delta} binding activities was noted in unstimulated cells.



View larger version (44K):
[in this window]
[in a new window]
 
Figure 4. Effects of IL-6 and mevastatin on DNA-binding activities of C/EBP{alpha}, C/EBPß, and C/EBP{delta}. Antibody supershift experiment was performed using 10 µg nuclear extracts of HepG2 cells treated with IL-6 (1 ng/mL) and mevastatin (10 µmol/L) and 6 fmol/L PAI-1 promoter probe (–233 to –207 bp) containing a C/EBP binding site. A, Nuclear protein alone. B, Supershift experiment with antibody against C/EBP{alpha}. C, Supershift experiment with antibody against C/EBPß. D, Supershift experiment with antibody against C/EBP{delta}. At indicated time EMSA was performed with nuclear protein isolated from cells stimulated with IL-6 and mevastatin. "C/EBP{delta}" indicated C/EBP{delta} supershift band. A representative result from 5 separate experiments is shown. E, C/EBP{delta} supershift bands shown in D were analyzed by densitometry. C/EBP{delta} binding activity was dramatically increased by IL-6 (n=5; P<0.01) and mevastatin decreased the response (n=5; P<0.01). Values are means±SD of fold increase over controls without agents at 0 hours.

Effects of IL-6 and Mevastatin on C/EBP{delta} mRNA and Protein in Nuclear Extracts
To determine the effects of mevastatin on the levels of C/EBP{delta} mRNA, total RNA was isolated from HepG2 cells treated with IL-6 or mevastatin for 4 hours and RT-PCR was performed. C/EBP{delta} mRNA was increased by IL-6 and mevastatin decreased the IL-6 response (Figure 5A). To determine the effects of IL-6 and mevastatin on the levels of C/EBP{delta} protein, Western blot analysis was performed in nuclear extracts. C/EBP{delta} protein accumulation was detected in cells treated with IL-6 or mevastatin for 4 hours. C/EBP{delta} protein was increased by IL-6. Mevastatin (5 and 10 µmol/L) significantly decreased C/EBP{delta} protein induced by IL-6 (Figure 5B). Mevastatin alone did not affect C/EBP{delta} protein accumulation. Histone H1 levels were not altered.



View larger version (53K):
[in this window]
[in a new window]
 
Figure 5. Effects of mevastatin on C/EBP{delta} mRNA and protein. A, Effects of mevastatin on C/EBP{delta} mRNA induced by IL-6. RNA isolated from HepG2 cells stimulated with IL-6 (1 ng/mL) or indicated concentration of mevastatin for 4 hours was used for RT-PCR. ß-Actin was used as an internal control. B, Effects of mevastatin on C/EBP{delta} protein induced by IL-6 in nuclear extracts. Nuclear protein (20 µg) isolated from cells stimulated with IL-6 or the indicated concentration of mevastatin for 4 hours was used for Western blot analysis. Values are means±SD of fold increase over controls without agents. *P<0.01 vs control (n=4); #P<0.05 vs IL-6–induced C/EBP{delta} (n=4). Western blot for histone H1 was used as a loading control.

The IL-6–Responsive Binding of C/EBP{delta} to the C/EBP Binding Site in PAI-1 Promoter in Intact Cells
To determine whether C/EBP isoforms are bound to PAI-1 promoter in native chromatin in intact cells, ChIP assays were performed on chromatin obtained from HepG2 cells (Figure 6). When PCRs were run on immunoprecipitates generated using antibodies to C/EBP{alpha}, C/EBPß, and C/EBP{delta} under natural condition, the clear product bands were detected for immunoprecipitates using antibodies to C/EBP{alpha} and C/EBPß (Figure 6A). In contrast, when IL-6–treated cells were used, the clear product bands were detected for immunoprecipitates using antibodies to C/EBPß and C/EBP{delta} (Figure 6B). The results indicated that C/EBP{delta} is involved in the binding to the C/EBP site in PAI-1 promoter in intact cells under IL-6 stimulation.



View larger version (47K):
[in this window]
[in a new window]
 
Figure 6. Effects of IL-6 on binding activity of C/EBP{delta} with PAI-1 promoter in intact unstimulated HepG2 cells (A) or IL-6 (1 ng/mL)–stimulated cells (B) using ChIP assays. Cells were fixed with formaldehyde and lysed with SDS. Lysate was divided into 6 parts. In 1 part, cross-linking was reversed at 65°C and digested with proteinase K. DNA was extracted and precipitated with ethanol (Input). Other samples were immunoprecipitated with antibodies to C/EBP{alpha}, C/EBPß, C/EBP{delta}, or preimmune (PI) serum. Immune complexes were collected with protein A agarose. After cross-linking was reversed, DNA was purified and amplified by PCR using primers corresponding to the region from –391 to –86 bp of the PAI-1 gene. Lanes 1 and 8, 100-bp DNA ladder; lane 2, Input; lane 3, no antibody; lane 4, C/EBP{alpha} antibody; lane 5, C/EBPß antibody; lane 6, C/EBP{delta} antibody; lane 7, PI serum. For A and B, experiments were performed 3x with nearly identical results, and representative results are shown. C, Effects of IL-6 on PAI-1 mRNA and C/EBP{delta} mRNA in mouse hepatocytes. Total RNA was harvested after 4-hour stimulation with IL-6, and real-time PCR was performed. *P<0.01 vs control without IL-6 stimulation (n=3). D, Effects of IL-6 on C/EBP{delta} binding activity in mouse hepatocytes. Supershift experiment with antibody against C/EBP{delta} was performed with 10 µg nuclear extracts of mouse hepatocytes treated with IL-6 for 4 hours and a mouse PAI-1 promoter probe (–215 to –188 bp) containing a putative C/EBP motif identified by computer-based database. "C/EBP{delta}" indicated C/EBP{delta} supershift band. A representative result from 2 separate experiments is shown.

Effects of IL-6 on C/EBP{delta} and PAI-1 mRNA in Primary Hepatocytes
To determine whether IL-6 can modulate PAI-1 expression in liver, hepatocytes isolated from mice were stimulated with IL-6. Total RNA and nuclear extracts were collected at 4 hours. Real-time PCR analysis showed that PAI-1 mRNA was increased by 2.2±0.4-fold and C/EBP{delta} mRNA was increased by 4.6±0.2 by IL-6 (Figure 6C). To verify whether IL-6 response in PAI-1 promoter is mediated by C/EBP{delta}, the IL-6–induced C/EBP binding activity was determined by EMSA using antibody against C/EBP{delta}. C/EBP{delta} binding activity was increased by IL-6 in primary hepatocytes (Figure 6D) in a manner similar to the results obtained in HepG2 cells.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
IL-6 induces PAI-1 mRNA and protein accumulation.13,19 Although several transcription factor binding sites were identified in PAI-1 promoter, no classic inflammatory response element was found. Because promoter activity was increased by IL-6, the IL-6–responsive region was explored. The deletion and site mutation of the region from –239 to –210 bp decreased >80% of the IL-6–inducible promoter activity, indicating that the region is critical for response. A computer-based database analysis indicated there is a putative C/EBP binding site (–226 to –212 bp). The promoters of most IL-6–inducible acute-phase protein genes have been characterized with C/EBP binding motifs.11 Using competition experiments, EMSA supershift analysis, and DNase I footprinting analysis, a C/EBP motif on PAI-1 promoter was verified, and 3 members of C/EBP family including {alpha}, ß, and {delta} were involved in the DNA–protein complex formation. C/EBPß was involved in the formation of 3 complexes because single-copy C/EBPß gene encodes several isoforms that have truncated translation activation domains by alternative splicing or alternative promoters.20

The C/EBP family is a class of basic region/leucine zipper transcriptional factors that recognize the consensus DNA-binding sequence (5'-ATTGCGCAAT-3') as obligate dimers. Six different family members were characterized, all of which contain highly homologous dimerization domains and DNA-binding motifs.11,21 C/EBP{delta} is undetectable under normal condition and rapidly inducible by proinflammatory cytokines, suggesting the importance of C/EBP{delta} in regulating transcription of acute-phase protein genes.11,21,22 Only a weak C/EBP{delta} band was detected at baseline, indicating that unstimulated cells were possibly under mild stress. EMSA experiments detected that the binding activity of C/EBP{delta}, but not C/EBP{alpha} or C/EBPß, was increased by IL-6, demonstrating that C/EBP{delta} is critical for increased PAI-1 transcription. IL-6 increased C/EBP{delta} mRNA and protein consistent with the previous report.23 Because C/EBP family binds to similar DNA-binding motifs, elucidating conditions for transcription factor binding to promoters of interest has been difficult in intact cells.24 In this study, ChIP revealed that C/EBP polypeptides are involved in binding to the C/EBP site of PAI-1 promoter in heterodimeric forms in live HepG2 cells. C/EBP polypeptides bound consisted mainly of C/EBP{alpha} and C/EBPß under natural condition and of C/EBPß and C/EBP{delta} under IL-6 stimulation. PAI-1 promoter activity was decreased by C/EBP{alpha} overexpression and increased by C/EBP{delta} overexpression. These results suggest that PAI-1 promoter activity is increased when C/EBP{alpha} is replaced with C/EBP{delta} on IL-6 stimulation. Functional differences of various C/EBP isoforms on PAI-1 gene expression need further investigation. PAI-1 and C/EBP{delta} mRNA levels were increased by IL-6 in primary mouse hepatocytes. C/EBP{delta} binding activity was also increased by IL-6. These results collectively suggest that IL-6 can increase PAI-1 expression at least partly through C/EBP{delta} in liver. The 2 supershifted C/EBP{delta} bands may be attributable to difference of translation initiation on the same C/EBP{delta} mRNA in a similar manner with C/EBPß.

The 4G/5G polymorphism of the PAI-1 gene may alter PAI-1 expression.25 In this study, 4G/4G polymorphism of PAI-1 promoter construct was used. However, when 5G/5G mutant of PAI-1 promoter was used, no changes in basal or IL-6–inducible activity were found (data not shown), suggesting that this polymorphism may not interact with C/EBP-mediated response through C/EBP motif.

IL-6 mediates activation of Stat3 and Ras pathway, leading to C/EBPß phosphorylation and activation, which triggers induction of acute-phase response genes. Activated Stat3 also induces transcription of C/EBPß and C/EBP{delta} genes.26 Newly synthesized C/EBPs bind in different combination to the promoter of acute-phase response gene, either functionally replacing other factors or synergizing with them depending on promoter composition and duration of stimulus, thus maintaining the induced state. In contrast to C/EBPß, C/EBP{delta}-dependent activation of target acute-phase response genes is secondary to transcriptional activation of its gene.11 After Stat3 in IL-6 pathway is activated, Stat3 may induce C/EBP{delta} gene transcription, not C/EBPß, and C/EBP{delta} protein may accumulate. Then, C/EBP{delta} can bind to the PAI-1 inflammatory responsive element and increase mRNA and protein. This model is consistent with that of other acute-phase response genes, suggesting that C/EBP{delta} may play crucial roles in acute-phase response.

Mevastatin at the dose without cytotoxicity13 attenuated PAI-1 promoter activity induced by IL-6 and decreased the binding activity of C/EBP{delta} to the IL-6–responsive element. Mevastatin also decreased IL-6–induced accumulation of C/EBP{delta} mRNA and protein. Because C/EBP{delta} increases transcription of inflammatory cytokines and acute-phase proteins,22 mevastatin may negatively regulate C/EBP{delta}, hence ameliorating vascular inflammation. Exogenous mevalonic acid can reverse mevastatin-mediated reduction of PAI-1 production inducted by IL-6.13 Pleiotropic effects of statins are mediated by blocking FPP or GGPP, which serve as lipid attachments for intracellular signaling molecules.27 Because GGPP attenuated mevastatin-mediated reduction of PAI-1 promoter activity, small GTP-binding protein of Ras or Stat signaling pathway may be a critical target for mevastatin.

Inflammation plays important roles in atherogenesis. PAI-1 induction by IL-6 may be pivotal for atherothrombosis, and statins may provide cardiovascular protection in part by regulation of C/EBP{delta} and consequent downstream modulation of PAI-1 expression. These data provide principles for therapeutic targeting of pathways central to facilitations of atherothrombosis.


*    Acknowledgments
 
This study was supported by grants-in-aid for scientific research from the Ministry of Education, Culture, Sport, Science, and Technology of Japan. The authors thank Dr Masaki Takiguchi (Chiba University, Japan) for providing C/EBP{alpha}, C/EBPß, and C/EBP{delta} expression vectors. The technical assistance of Miwako Fujii is greatly appreciated.

Received July 26, 2004; accepted January 28, 2005.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Munford RS. Statins and the acute-phase response. N Engl J Med. 2001; 344: 2016–2018.[Free Full Text]

2. Devaraj S, Xu DY, Jialal I. C-reactive protein increases plasminogen activator inhibitor-1 expression and activity in human aortic endothelial cells: implications for the metabolic syndrome and atherothrombosis. Circulation. 2003; 107: 398–404.[Abstract/Free Full Text]

3. Sobel BE. Increased plasminogen activator inhibitor-1 and vasculopathy. A reconcilable paradox. Circulation. 1999; 99: 2496–2498.[Free Full Text]

4. Dennler S, Itoh S, Vivien D, ten Dijke P, Huet S, Gauthier JM. Direct binding of Smad3 and Smad4 to critical TGF ß-inducible elements in the promoter of human plasminogen activator inhibitor-type 1gene. EMBO J. 1998; 17: 3091–3100.[CrossRef][Medline] [Order article via Infotrieve]

5. Motojima M, Ando T, Yoshioka T. Sp1-like activity mediates angiotensin-II-induced plasminogen-activator inhibitor type-1 (PAI-1) gene expression in mesangial cells. Biochem J. 2000; 349: 435–441.[CrossRef][Medline] [Order article via Infotrieve]

6. Chen Y, Billadello JJ, Schneider DJ. Identification and localization of a fatty acid response region in the human plasminogen activator inhibitor-1 gene. Arterioscler Thromb Vasc Biol. 2000; 20: 2696–2701.[Abstract/Free Full Text]

7. Arts J, Grimbergen J, Toet K, Kooistra T. On the role of c-Jun in the induction of PAI-1 gene expression by phorbol ester, serum, and IL-1{alpha} in HepG2 cells. Arterioscler Thromb Vasc Biol. 1999; 19: 39–46.[Abstract/Free Full Text]

8. Fink T, Kazlauskas A, Poellinger L, Ebbesen P, Zachar V. Identification of a tightly regulated hypoxia-response element in the promoter of human plasminogen activator inhibitor-1. Blood. 2002; 99: 2077–2083.[Abstract/Free Full Text]

9. Kaneko T, Fujii S, Matsumoto A, Goto D, Ishimori N, Watano K, Furumoto T, Sugawara T, Sobel BE, Kitabatake A. Induction of plasminogen activator inhibitor-1 in endothelial cells by basic fibroblast growth factor and its modulation by fibric acid. Arterioscler Thromb Vasc Biol. 2002; 22: 855–860.[Abstract/Free Full Text]

10. Blake GJ, Ridker PM. C-reactive protein and other inflammatory risk markers in acute coronary syndromes. J Am Coll Cardiol. 2003; 41: 37S–42S.

11. Poli V. The role of C/EBP isoforms in the control of inflammatory and native immunity functions. J Biol Chem. 1998; 273: 29279–29282.[Free Full Text]

12. Bourcier T, Libby P. HMG-CoA reductase inhibitors reduce plasminogen activator inhibitor-1 expression by human vascular smooth muscle and endothelial cells. Arterioscler Thromb Vasc Biol. 2000; 20: 556–562.[Abstract/Free Full Text]

13. Dong J, Fujii S, Goto D, Furumoto T, Kaneko T, Zaman TA, Nakai Y, Mishima T, Imagawa S, Kitabatake A. Increased expression of plasminogen activator inhibitor-1 by mediators of the acute phase response: a potential progenitor of vasculopathy in hypertensives. Hypertens Res. 2003; 26: 723–729.[CrossRef][Medline] [Order article via Infotrieve]

14. Essig M, Nguyen G, Prie D, Escoubet B, Sraer JD, Friedlander G. 3-Hydroxy-3-methylglutaryl coenzyme A reductase inhibitors increase fibrinolytic activity in rat aortic endothelial cells. Role of geranylgeranylation and Rho proteins. Circ Res. 1998; 83: 683–690.[Abstract/Free Full Text]

15. Dichtl W, Dulak J, Frick M, Alber HF, Schwarzacher SP, Ares MP, Nilsson J, Pachinger O, Weidinger F. HMG-CoA reductase inhibitors regulate inflammatory transcription factors in human endothelial and vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 2003; 23: 58–63.[Abstract/Free Full Text]

16. Seglen PO. Preparation of isolated rat liver cells. Methods Cell Biol. 1975; 13: 29–83.

17. Sawano A, Miyawaki A. Directed evolution of green fluorescent protein by a new versatile PCR strategy for site-directed and semi-random mutagenesis. Nucleic Acids Res. 2000; 28: E78.

18. Gotoh T, Chowdhury S, Takiguchi M, Mori M. The glucocorticoid-responsive gene cascade. Activation of the rat arginase gene through induction of C/EBPß. J Biol Chem. 1997; 272: 3694–3698.[Abstract/Free Full Text]

19. Koike C, Hayakawa Y, Niiya K, Sakuragawa N, Sasaki H. The production of heparin cofactor II is not regulated by inflammatory cytokines in human hepatoma cells: comparison with plasminogen activator inhibitor type-1. Thromb Haemost. 1996; 75: 298–302.[Medline] [Order article via Infotrieve]

20. Xiong W, Hsieh C, Kurtz AJ, Rabek JP, Papaconstantinou J. Regulation of CCAAT/enhancer-binding protein-ß isoform synthesis by alternative translational initiation at multiple AUG start sites. Nucleic Acids Res. 2001; 29: 3087–3098.[Abstract/Free Full Text]

21. Lekstrom-Himes J, Xanthopoulos KG. Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J Biol Chem. 1998; 273: 28545–28548.[Abstract/Free Full Text]

22. Takata Y, Kitami Y, Yang ZH, Nakamura M, Okura T, Hiwada K. Vascular inflammation is negatively autoregulated by interaction between CCAAT/enhancer-binding protein-{delta} and peroxisome proliferator-activated receptor-{gamma}. Circ Res. 2002; 91: 427–433.[Abstract/Free Full Text]

23. Ray A, Ray BK. Serum amyloid A gene expression under acute-phase conditions involves participation of inducible C/EBP-ß and C/EBP-{delta} and their activation by phosphorylation. Mol Cell Biol. 1994; 14: 4324–4332.[Abstract/Free Full Text]

24. Khanna-Gupta A, Zibello T, Sun H, Gaines P, Berliner N. Chromatin immunoprecipitation (ChIP) studies indicate a role for CCAAT enhancer binding proteins alpha and epsilon (C/EBP{alpha} and C/EBP{epsilon}) and CDP/cut in myeloid maturation-induced lactoferrin gene expression. Blood. 2003; 101: 3460–3468.[Abstract/Free Full Text]

25. Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem. 1993; 268: 10739–10745.[Abstract/Free Full Text]

26. Cantwell CA, Sterneck E, Johnson PF. Interleukin-6-specific activation of the C/EBP{delta} gene in hepatocytes is mediated by Stat3 and Sp1. Mol Cell Biol. 1998; 18: 2108–2117.[Abstract/Free Full Text]

27. Takemoto M, Liao JK. Pleiotropic effects of 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibitors. Arterioscler Thromb Vasc Biol. 2001; 11: 1712–1719.




This article has been cited by other articles:


Home page
CLIN APPL THROMB HEMOSTHome page
D. Ozel Demiralp, H. Aktas, and N. Akar
The Effect of Plasminogen Activator Inhibitor-1 -675 4G/5G Polymorphism on PAI-1 Gene Expression and Adipocyte Differentiation
Clinical and Applied Thrombosis/Hemostasis, October 1, 2008; 14(4): 438 - 446.
[Abstract] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Dong, S. Fujii, S. Imagawa, S. Matsumoto, M. Matsushita, S. Todo, H. Tsutsui, and B. E. Sobel
IL-1 and IL-6 induce hepatocyte plasminogen activator inhibitor-1 expression through independent signaling pathways converging on C/EBP{delta}
Am J Physiol Cell Physiol, January 1, 2007; 292(1): C209 - C215.
[Abstract] [Full Text] [PDF]


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
M. D. Sternlicht, A. M. Dunning, D. H. Moore, P. D.P. Pharoah, D. G. Ginzinger, K. Chin, J. W. Gray, F. M. Waldman, B. A.J. Ponder, and Z. Werb
Prognostic Value of PAI1 in Invasive Breast Cancer: Evidence That Tumor-Specific Factors Are More Important Than Genetic Variation in Regulating PAI1 Expression.
Cancer Epidemiol. Biomarkers Prev., November 1, 2006; 15(11): 2107 - 2114.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Imagawa, S. Fujii, J. Dong, T. Furumoto, T. Kaneko, T. Zaman, Y. Satoh, H. Tsutsui, and B. E Sobel
Hepatocyte Growth Factor Regulates E Box-Dependent Plasminogen Activator Inhibitor Type 1 Gene Expression in HepG2 Liver Cells
Arterioscler Thromb Vasc Biol, October 1, 2006; 26(10): 2407 - 2413.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Okamoto, Y. Iwamoto, and Y. Maru
Oxidative Stress-Responsive Transcription Factor ATF3 Potentially Mediates Diabetic Angiopathy
Mol. Cell. Biol., February 1, 2006; 26(3): 1087 - 1097.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
25/5/1078    most recent
01.ATV.0000159701.24372.49v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dong, J.
Right arrow Articles by Kitabatake, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dong, J.
Right arrow Articles by Kitabatake, A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*LOVASTATIN
Medline Plus Health Information
*Statins