| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Thrombosis |
From the Departments of Cardiovascular Medicine and Molecular Biology, Hokkaido University Graduate School of Medicine, Sapporo, Japan.
Correspondence to Satoshi Fujii, MD, PhD, The Department of Cardiovascular Medicine, Hokkaido University Graduate School of Medicine, Kita 15, Nishi 7, Kitaku, Sapporo, Japan 060-8638. E-mail sfujii{at}med.hokudai.ac.jp
| Abstract |
|---|
|
|
|---|
Methods and Results Transient transfection and luciferase assay in HepG2 human hepatoma-derived cells demonstrated that IL-6 increased PAI-1 promoter activity and mevastatin decreased IL-6inducible response. Systematic deletion assay of the promoter demonstrated that the region (239 to 210 bp) containing a putative CCAAT/enhancer-binding protein (C/EBP) binding site was necessary. Point mutation in this site abolished the IL-6inducible response. Electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrated that C/EBP
, C/EBPß, and C/EBP
were involved in proteinDNA complex formation in intact cells. Deoxyribonuclease (DNase) I footprinting analysis revealed that 5' flanking region (232 to 210 bp) is acute-phase response protein-binding site. C/EBP
binding activity was increased by IL-6 and attenuated by mevastatin. Mevastatin attenuated IL-6mediated increase of C/EBP
protein in the nuclear extracts. IL-6 also increased PAI-1 and C/EBP
mRNA in mouse primary hepatocytes.
Conclusions IL-6 increases hepatic PAI-1 expression mediated by the 232- to 210-bp region of the promoter containing a C/EBP
binding site. Vascular protection by statins may be partly mediated through regulation of CEBP
and consequent modulation of PAI-1 expression.
IL-6 increases hepatic PAI-1 expression mediated by the 232- to 210-bp region of the promoter containing a C/EBP
binding site. Mevastatin attenuated IL-6mediated increase of C/EBP
protein in the nuclear extracts. C/EBP
may be responsible for hepatic PAI-1 expression induced by IL-6 and its attenuation by statins.
Key Words: IL-6 statins PAI-1 C/EBP thrombosis
| Introduction |
|---|
|
|
|---|
The 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors (statins) exert beneficial effects on coronary diseases beyond cholesterol lowering.12 Statins decrease PAI-1 expression induced by IL-6 in HepG2 cells, highly differentiated human hepatoma-derived cells used as in vitro models of acute-phase response.13 Statins can modify fibrinolytic potential of endothelial cells via inhibition of geranylgeranylated Rho protein14 and act on PAI-1 transcription12 and inhibit inflammatory transcription factors.15 The purpose of this study was to elucidate the mechanism of increased PAI-1 production induced by IL-6 and to investigate inhibitory mechanisms of statins on hepatic PAI-1 expression.
| Methods |
|---|
|
|
|---|
Plasmid Constructs
The human PAI-1 promoter region from 829 to +36 bp was amplified using human genomic DNA as template, with upstream (GGGGTACCCGTTGGTCTCCTGTTTCCTTACCAAGC) and downstream (CCGGCTCGAGGACAGCGCTCTTGGCCCTGCAGCCA) primers incorporating the restriction sites for KpnI and XhoI. After digestion by KpnI and XhoI, polymerase chain reaction (PCR) product was ligated into luciferase reporter plasmid (pGL3-basic; Promega). The produced plasmid was named as PAI (829). The same method was used to construct deletion mutant plasmids. The primers were: PAI-1 (663) GGGGTACCT GTATCATCGGAGGCGGCCGGGCACA; PAI-1 (539) GGGGTACCCTGTTGGGCTGGGCCAGGAGGAGG; PAI-1 (488) GGGGTACCAGAGCACCGGGTGGACAGCCCTGGGG; PAI-1 (366) GGGGTACCTCCAAGCTGAACACTAGGGGTCCT; PAI-1 (308) GGGGTACCAACCTGGCAGGACATCCGGGAGAGAC; PAI-1 (239) GGG GTACCAAGGCTATTGGGGTTTGCTCAATTG; and PAI-1 (210) GCGGTACCCCTGAAT GCTCTTACACACGTACA.
Site-directed mutagenesis of putative C/EBP site was performed by overlap-extension PCR strategy (primer GGCTATTGGGGTGCTTTCGCTTGTTCCTGAATGCTC).17 Correct assembly was verified by restriction analysis. Mutated regions generated by PCR were sequenced to identify clones without polymerase errors.
Transient Transfections and Luciferase Assay
HepG2 cells were seeded at 8x105/well on 6-well plates. After 24 hours, 1.5 µg of PAI-1 promoter Firefly luciferase fusion DNA reporter in pGL3-basic construct was cotransfected with 1 µg of Renilla luciferase pRL-TK vector (Promega; for transfection efficiency control) using DNAcalcium phosphate coprecipitation method. Medium was replaced by serum-free medium 6 hours after transfection. Cells were stimulated with IL-6 or mevastatin 24 hours after transfection and harvested 48 hours after transfection. In some experiments, cells were incubated with geranylgeranyl pyrophosphate (GGPP) or farnesyl pyrophosphate (FPP).
Cell lysate luciferase activity was determined using Dual-Luciferase Reporter Assay System (Promega).9 Results for each reporter construct were expressed as fold induction compared with the results in unstimulated cells transfected with the same reporter. For overexpression experiments, wild-type or mutant PAI (829), the pSVß-galactosidase construct (Promega; for transfection efficiency control) and C/EBP
, C/EBPß, or C/EBP
expression vector18 were cotransfected.
Electrophoretic Mobility Shift Assay
For electrophoretic mobility shift assay (EMSA) of HepG2 cells, probes encompassing putative C/EBP motif and mutant probes were prepared using paired complementary oligonucleotides: PAI-1 C/EBP (AGCTTATTGGGGTTTGCTCAATTGTTCCT); and PAI-1 C/EBP mut (AGCTTATTGGGGTGCTTTCGCTTGTTCCT).
For EMSA of mice hepatocytes, probes encompassing putative C/EBP motif were prepared: mouse PAI-1 C/EBP (TCGAACCAGGGTTTGCTCAATTATCCCC).
Probes end-labeled with [
-32P]dCTP by Klenow fragment of DNA polymerase I (Takara) were purified. The nuclear extracts were prepared using extraction kit (N-XTRACT; Sigma). DNA-binding reactions were performed with 10 µg nuclear extracts and 6-fmol/Llabeled probe for 15 minutes. In inhibition experiments, cold competitor probe was added at 100-fold molar excess. For EMSA supershift analysis, antibodies (Santa Cruz Biotechnology) against C/EBP
(sc-61X), C/EBPß (sc-150X), and C/EBP
(sc-636X) were incubated with nuclear extracts for 10 minutes before addition of the probes. DNAprotein complexes were resolved by 6% polyacrylamide gel and autoradiography was performed. Images were analyzed by densitometry (ImageJ software; NIH).
DNase I Footprinting Analysis
A fragment (272 to 159 bp) of PAI-1 promoter for probe preparation was amplified using primers (upstream: CGTACACACACAGAGCAGCA; downstream: CTCTGGGAGTCCGTCTGAAC) and ligated into T-easy vector (Promega) and restricted by SphI and SalI. The probe was prepared by filling in the 5'-overhang end of the fragment using Klenow DNA polymerase I (Takara) and [
-32P]dCTP. Nuclear extracts were incubated for 15 minutes at room temperature after adding 32P-labeled probe with the same condition as that of EMSA, and then treated with DNase I (Takara) for 1.5 minutes. After proteinase K treatment, DNA was extracted and analyzed on 6% polyacrylamide gels containing 8 mol/L urea. Adenine and guanine bases of the same probes were modified and digested by MaxamGilbert method and loaded as a marker.
RNA Isolation and RT-PCR
Total RNA was extracted using Isogen (Wako). RNA was reverse-transcribed and standard PCR was performed using RNA PCR Kit (AMV; Takara). The following PCR primers were used: for human C/EBP
, upstream (GACTCAGCAACGACCCATACC) and downstream (TGCTCAGTCTTTTCCTCTTAT) primers, and for human ß-actin, upstream (CTGTCTGGCGGCACCACCAT) and downstream (GCAACTAAGTCATAGTCCGC) primers. PCR products with expected length of 317 and 254 bp were electrophoresed in agarose and visualized by ethidium bromide. Mouse PAI-1 and C/EBP
mRNA were determined by quantitative real-time RT-PCR using SYBR Green I kit (Takara) and PRISM 7000 (Applied Biosystems) according to manufacturer instructions. The following PCR primers were used: for mouse PAI-1, upstream (GACACCCTCAGCATGTTCATC) and downstream (AGGGTTGCACTAAACATGTCAG) primers, for mouse C/EBP
, upstream (CTCCCGCACACAACATACTG) and downstream (CTTCGGCAACCACCTAAAAG) primers, and for mouse ß-actin, upstream (TGCGTGACATCAAAGAGAAG) and downstream (GATGCCACAGGATTCCATA) primers. After PCR, melting curve was constructed to ensure elimination of nonspecific products. The amount of mRNA was determined by comparing with the standard curve generated from serial dilutions of T-vector containing cDNA of the gene.
Western Blot Analysis of C/EBP
Immunologic detection of C/EBP
with rabbit polyclonal C/EBP
antibody (sc-636; Santa Cruz Biotechnology; 1:500 dilution) was performed as described previously.13 In brief, 20-µg extracts were loaded on 8% polyacrylamide gel, electrophoresed, and transferred to polyvinylidene difluoride membranes, which were blocked with Tween-Trisbuffered salt solution (TTBS) containing 5% skim milk. Membranes were incubated overnight at 4°C with rabbit polyclonal C/EBP
antibody. After washing 3x with TTBS, membranes were incubated with anti-rabbit IgG-AP (Santa Cruz Biotechnology) for 1hour at room temperature. Immunologic detection was performed with a ProtoBlot AP System (Promega). Images were analyzed in a densitometer. Antihistone H1 antibody (Santa Cruz Biotechnology) was used to confirm equal sample loading.
Chromatin Immunoprecipitation Assays
Chromatin immunoprecipitation (ChIP) assay was performed according to manufacturer instructions (Upstate Cell Signaling Solutions). Cells were cross-linked with 1% formaldehyde for 10 minutes at 37°C. After washing with ice-cold PBS, cells were lysed for 10 minutes (6x106 cells/300 µL of sodium dodecyl sulfate [SDS] lysis buffer). The chromatin was sheared by sonication to reduce DNA length between 200 bp and 1000 bp and was precleared with salmon sperm DNA/protein A agarose50% slurry. Antibodies against C/EBP
(sc-61), C/EBPß (sc-150), C/EBP
(sc-636), or preimmune serum were added with chromatin samples. Samples were incubated overnight at 4°C. Immune complexes were collected with salmon sperm DNA/protein A agarose, washed, and eluted. Cross-linking was reversed at 65°C and digested with proteinase K. DNA was purified and extracted with phenol-chloroform, precipitated with ethanol, dissolved in TrisEDTA, and used for PCR using upstream (AGGCAAACGTGAGCTGTTTT) and downstream (CTCTGGGAGTCCGTCTGAAC) primers. PCR product spanning from 391 to 86 bp of PAI-1 promoter was generated. PCR products were electrophoresed in agarose gel and visualized by ethidium bromide.
Statistical Analysis
All experiments were conducted in duplicate with independent separate cultures (n=number of independent experiments). Data are expressed as mean±SD. Statistical comparison of control with treated groups was carried by Students t test. The accepted level of significance was P<0.05.
| Results |
|---|
|
|
|---|
|
Effects of Mevastatin on PAI-1 Promoter Activity
Mevastatin decreased IL-6inducible PAI-1 promoter activity by 50±6% (Figure 1B). To test whether the inhibitory effects are mediated by protein isoprenylation, mevastatin effect was evaluated in the presence of GGPP or FPP. When acting alone, neither GGPP nor FPP modified promoter activity. GGPP attenuated the mevastatin-mediated reduction of promoter activity. FPP exerted no effects, suggesting that geranylgeranylation can be involved in mevastatin-mediated reduction of promoter activity induced by IL-6. Based on a computer-based transcription factor database analysis, the region from 239 to 210 bp contained a putative C/EBP binding site. The site-directed mutagenesis analysis of this site indicated that basal activity of PAI-1 promoter was reduced and IL-6inducible promoter activity was essentially abolished (Figure 1C). Mevastatin did not alter baseline or IL-6induced promoter activity in mutants. The results demonstrated that the region from 239 to 210 bp is critical and necessary for stimulatory effect of IL-6.
Verification of the Putative C/EBP Site of PAI-1 Promoter
To verify the existence of putative C/EBP site in PAI-1 promoter, EMSA, using HepG2 nuclear extract and a fragment of PAI-1 promoter (233 to 207 bp), was performed (Figure 2A). Three complex bands were detected (lane 2). Competition experiments indicated that the complex bands were competed out exclusively by adding excess unlabeled probe containing the putative C/EBP site (lane 3). No competition occurred when excess unlabeled probe with mutations in the putative C/EBP site was added (lane 4). The complex bands were competed out also by adding the probe containing the C/EBP consensus sequence (TGCAGATTGCGCAATCTGCA; lane 5). The results indicated that the binding reaction of nuclear proteins with the probe was specific and the probe contained a C/EBP binding site. DNAprotein complexes were characterized further with antibodies against 3 major members of the C/EBP family: C/EBP
(lane 6), C/EBPß (lane 7), and C/EBP
(lane 8). Complex 1 band was supershifted by antibodies against C/EBP
and C/EBPß. Complex 2 band was supershifted by antibodies against C/EBPß and C/EBP
. Complex 3 band was supershifted by antibody against C/EBPß. The results indicated that C/EBP
, C/EBPß, and C/EBP
were all involved in DNAprotein complex formation.
|
Identification of the C/EBP Binding Site in PAI-1 Promoter
To confirm the C/EBP binding sequence on the promoter DNase I footprinting analysis was performed using a fragment of the PAI-1 5'-flanking region spanning from 272 to 159 bp containing C/EBP binding site and using nuclear extracts. With the increased dose of nuclear proteins, a footprinting region (232 to 210 bp; 5'-TATTGGGGTTTGCTCAATTGTTC-3') corresponding to the putative C/EBP binding site was observed (Figure 2B). The result indicated that PAI-1 5'-flanking region from 232 to 210 bp is a protein-binding site. The result, together with the EMSA results, gave further evidence that the region contained a C/EBP binding site.
Effects of Overexpression of C/EBP Transcription Factors on PAI-1 Promoter Activity
To further define the role of C/EBP family members in modulating PAI-1 gene transcription, C/EBP expression vectors for
, ß, and
were transiently cotransfected with the PAI (829). Overexpression of C/EBPß and C/EBP
increased PAI-1 promoter activity by 7.6±0.3-fold and 2.8±0.2-fold, respectively (Figure 3). In contrast, overexpression of C/EBP
significantly decreased promoter activity by 33±4%. Mutation of the identified C/EBP binding site of PAI-1 promoter essentially abolished C/EBP-induced increase of promoter activity. The results indicated that C/EBP binding site is essential for PAI-1 promoter regulation, where the C/EBPß and C/EBP
enhanced and C/EBP
decreased the promoter activity.
|
Critical Role of C/EBP
on IL-6 Response in PAI-1 Promoter and Its Attenuation by Mevastatin
To verify whether IL-6 response in PAI-1 promoter is mediated by C/EBP and which member of C/EBP family is involved in the response, the IL-6induced C/EBP binding activity and the effects of mevastatin were determined by EMSA using antibodies against C/EBP
, C/EBPß, and C/EBP
. Without antibodies, 3 complex bands were detected (Figure 4A). Complex 2 including C/EBP
was increased by IL-6 and mevastatin attenuated the IL-6 effects. When antibody against C/EBP
was used, supershift band was decreased slightly by 4 hours of treatment of IL-6, and mevastatin had no effect (Figure 4B). When antibody against C/EBPß was used, supershift band was not significantly changed (Figure 4C). In contrast to C/EBP
and C/EBPß, C/EBP
binding activity was increased by 2 hours after stimulation with IL-6 and was consistently elevated until 12 hours (P<0.01; Figure 4D and 4E). Mevastatin attenuated the response 4 hours after treatment and the effect continued for 12 hours (P<0.01; Figure 4D and 4E). No significant change of the C/EBP
binding activities was noted in unstimulated cells.
|
Effects of IL-6 and Mevastatin on C/EBP
mRNA and Protein in Nuclear Extracts
To determine the effects of mevastatin on the levels of C/EBP
mRNA, total RNA was isolated from HepG2 cells treated with IL-6 or mevastatin for 4 hours and RT-PCR was performed. C/EBP
mRNA was increased by IL-6 and mevastatin decreased the IL-6 response (Figure 5A). To determine the effects of IL-6 and mevastatin on the levels of C/EBP
protein, Western blot analysis was performed in nuclear extracts. C/EBP
protein accumulation was detected in cells treated with IL-6 or mevastatin for 4 hours. C/EBP
protein was increased by IL-6. Mevastatin (5 and 10 µmol/L) significantly decreased C/EBP
protein induced by IL-6 (Figure 5B). Mevastatin alone did not affect C/EBP
protein accumulation. Histone H1 levels were not altered.
|
The IL-6Responsive Binding of C/EBP
to the C/EBP Binding Site in PAI-1 Promoter in Intact Cells
To determine whether C/EBP isoforms are bound to PAI-1 promoter in native chromatin in intact cells, ChIP assays were performed on chromatin obtained from HepG2 cells (Figure 6). When PCRs were run on immunoprecipitates generated using antibodies to C/EBP
, C/EBPß, and C/EBP
under natural condition, the clear product bands were detected for immunoprecipitates using antibodies to C/EBP
and C/EBPß (Figure 6A). In contrast, when IL-6treated cells were used, the clear product bands were detected for immunoprecipitates using antibodies to C/EBPß and C/EBP
(Figure 6B). The results indicated that C/EBP
is involved in the binding to the C/EBP site in PAI-1 promoter in intact cells under IL-6 stimulation.
|
Effects of IL-6 on C/EBP
and PAI-1 mRNA in Primary Hepatocytes
To determine whether IL-6 can modulate PAI-1 expression in liver, hepatocytes isolated from mice were stimulated with IL-6. Total RNA and nuclear extracts were collected at 4 hours. Real-time PCR analysis showed that PAI-1 mRNA was increased by 2.2±0.4-fold and C/EBP
mRNA was increased by 4.6±0.2 by IL-6 (Figure 6C). To verify whether IL-6 response in PAI-1 promoter is mediated by C/EBP
, the IL-6induced C/EBP binding activity was determined by EMSA using antibody against C/EBP
. C/EBP
binding activity was increased by IL-6 in primary hepatocytes (Figure 6D) in a manner similar to the results obtained in HepG2 cells.
| Discussion |
|---|
|
|
|---|
, ß, and
were involved in the DNAprotein complex formation. C/EBPß was involved in the formation of 3 complexes because single-copy C/EBPß gene encodes several isoforms that have truncated translation activation domains by alternative splicing or alternative promoters.20
The C/EBP family is a class of basic region/leucine zipper transcriptional factors that recognize the consensus DNA-binding sequence (5'-ATTGCGCAAT-3') as obligate dimers. Six different family members were characterized, all of which contain highly homologous dimerization domains and DNA-binding motifs.11,21 C/EBP
is undetectable under normal condition and rapidly inducible by proinflammatory cytokines, suggesting the importance of C/EBP
in regulating transcription of acute-phase protein genes.11,21,22 Only a weak C/EBP
band was detected at baseline, indicating that unstimulated cells were possibly under mild stress. EMSA experiments detected that the binding activity of C/EBP
, but not C/EBP
or C/EBPß, was increased by IL-6, demonstrating that C/EBP
is critical for increased PAI-1 transcription. IL-6 increased C/EBP
mRNA and protein consistent with the previous report.23 Because C/EBP family binds to similar DNA-binding motifs, elucidating conditions for transcription factor binding to promoters of interest has been difficult in intact cells.24 In this study, ChIP revealed that C/EBP polypeptides are involved in binding to the C/EBP site of PAI-1 promoter in heterodimeric forms in live HepG2 cells. C/EBP polypeptides bound consisted mainly of C/EBP
and C/EBPß under natural condition and of C/EBPß and C/EBP
under IL-6 stimulation. PAI-1 promoter activity was decreased by C/EBP
overexpression and increased by C/EBP
overexpression. These results suggest that PAI-1 promoter activity is increased when C/EBP
is replaced with C/EBP
on IL-6 stimulation. Functional differences of various C/EBP isoforms on PAI-1 gene expression need further investigation. PAI-1 and C/EBP
mRNA levels were increased by IL-6 in primary mouse hepatocytes. C/EBP
binding activity was also increased by IL-6. These results collectively suggest that IL-6 can increase PAI-1 expression at least partly through C/EBP
in liver. The 2 supershifted C/EBP
bands may be attributable to difference of translation initiation on the same C/EBP
mRNA in a similar manner with C/EBPß.
The 4G/5G polymorphism of the PAI-1 gene may alter PAI-1 expression.25 In this study, 4G/4G polymorphism of PAI-1 promoter construct was used. However, when 5G/5G mutant of PAI-1 promoter was used, no changes in basal or IL-6inducible activity were found (data not shown), suggesting that this polymorphism may not interact with C/EBP-mediated response through C/EBP motif.
IL-6 mediates activation of Stat3 and Ras pathway, leading to C/EBPß phosphorylation and activation, which triggers induction of acute-phase response genes. Activated Stat3 also induces transcription of C/EBPß and C/EBP
genes.26 Newly synthesized C/EBPs bind in different combination to the promoter of acute-phase response gene, either functionally replacing other factors or synergizing with them depending on promoter composition and duration of stimulus, thus maintaining the induced state. In contrast to C/EBPß, C/EBP
-dependent activation of target acute-phase response genes is secondary to transcriptional activation of its gene.11 After Stat3 in IL-6 pathway is activated, Stat3 may induce C/EBP
gene transcription, not C/EBPß, and C/EBP
protein may accumulate. Then, C/EBP
can bind to the PAI-1 inflammatory responsive element and increase mRNA and protein. This model is consistent with that of other acute-phase response genes, suggesting that C/EBP
may play crucial roles in acute-phase response.
Mevastatin at the dose without cytotoxicity13 attenuated PAI-1 promoter activity induced by IL-6 and decreased the binding activity of C/EBP
to the IL-6responsive element. Mevastatin also decreased IL-6induced accumulation of C/EBP
mRNA and protein. Because C/EBP
increases transcription of inflammatory cytokines and acute-phase proteins,22 mevastatin may negatively regulate C/EBP
, hence ameliorating vascular inflammation. Exogenous mevalonic acid can reverse mevastatin-mediated reduction of PAI-1 production inducted by IL-6.13 Pleiotropic effects of statins are mediated by blocking FPP or GGPP, which serve as lipid attachments for intracellular signaling molecules.27 Because GGPP attenuated mevastatin-mediated reduction of PAI-1 promoter activity, small GTP-binding protein of Ras or Stat signaling pathway may be a critical target for mevastatin.
Inflammation plays important roles in atherogenesis. PAI-1 induction by IL-6 may be pivotal for atherothrombosis, and statins may provide cardiovascular protection in part by regulation of C/EBP
and consequent downstream modulation of PAI-1 expression. These data provide principles for therapeutic targeting of pathways central to facilitations of atherothrombosis.
| Acknowledgments |
|---|
, C/EBPß, and C/EBP
expression vectors. The technical assistance of Miwako Fujii is greatly appreciated. Received July 26, 2004; accepted January 28, 2005.
| References |
|---|
|
|
|---|
2. Devaraj S, Xu DY, Jialal I. C-reactive protein increases plasminogen activator inhibitor-1 expression and activity in human aortic endothelial cells: implications for the metabolic syndrome and atherothrombosis. Circulation. 2003; 107: 398404.
3. Sobel BE. Increased plasminogen activator inhibitor-1 and vasculopathy. A reconcilable paradox. Circulation. 1999; 99: 24962498.
4. Dennler S, Itoh S, Vivien D, ten Dijke P, Huet S, Gauthier JM. Direct binding of Smad3 and Smad4 to critical TGF ß-inducible elements in the promoter of human plasminogen activator inhibitor-type 1gene. EMBO J. 1998; 17: 30913100.[CrossRef][Medline] [Order article via Infotrieve]
5. Motojima M, Ando T, Yoshioka T. Sp1-like activity mediates angiotensin-II-induced plasminogen-activator inhibitor type-1 (PAI-1) gene expression in mesangial cells. Biochem J. 2000; 349: 435441.[CrossRef][Medline] [Order article via Infotrieve]
6. Chen Y, Billadello JJ, Schneider DJ. Identification and localization of a fatty acid response region in the human plasminogen activator inhibitor-1 gene. Arterioscler Thromb Vasc Biol. 2000; 20: 26962701.
7. Arts J, Grimbergen J, Toet K, Kooistra T. On the role of c-Jun in the induction of PAI-1 gene expression by phorbol ester, serum, and IL-1
in HepG2 cells. Arterioscler Thromb Vasc Biol. 1999; 19: 3946.
8. Fink T, Kazlauskas A, Poellinger L, Ebbesen P, Zachar V. Identification of a tightly regulated hypoxia-response element in the promoter of human plasminogen activator inhibitor-1. Blood. 2002; 99: 20772083.
9. Kaneko T, Fujii S, Matsumoto A, Goto D, Ishimori N, Watano K, Furumoto T, Sugawara T, Sobel BE, Kitabatake A. Induction of plasminogen activator inhibitor-1 in endothelial cells by basic fibroblast growth factor and its modulation by fibric acid. Arterioscler Thromb Vasc Biol. 2002; 22: 855860.
10. Blake GJ, Ridker PM. C-reactive protein and other inflammatory risk markers in acute coronary syndromes. J Am Coll Cardiol. 2003; 41: 37S42S.
11. Poli V. The role of C/EBP isoforms in the control of inflammatory and native immunity functions. J Biol Chem. 1998; 273: 2927929282.
12. Bourcier T, Libby P. HMG-CoA reductase inhibitors reduce plasminogen activator inhibitor-1 expression by human vascular smooth muscle and endothelial cells. Arterioscler Thromb Vasc Biol. 2000; 20: 556562.
13. Dong J, Fujii S, Goto D, Furumoto T, Kaneko T, Zaman TA, Nakai Y, Mishima T, Imagawa S, Kitabatake A. Increased expression of plasminogen activator inhibitor-1 by mediators of the acute phase response: a potential progenitor of vasculopathy in hypertensives. Hypertens Res. 2003; 26: 723729.[CrossRef][Medline] [Order article via Infotrieve]
14. Essig M, Nguyen G, Prie D, Escoubet B, Sraer JD, Friedlander G. 3-Hydroxy-3-methylglutaryl coenzyme A reductase inhibitors increase fibrinolytic activity in rat aortic endothelial cells. Role of geranylgeranylation and Rho proteins. Circ Res. 1998; 83: 683690.
15. Dichtl W, Dulak J, Frick M, Alber HF, Schwarzacher SP, Ares MP, Nilsson J, Pachinger O, Weidinger F. HMG-CoA reductase inhibitors regulate inflammatory transcription factors in human endothelial and vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 2003; 23: 5863.
16. Seglen PO. Preparation of isolated rat liver cells. Methods Cell Biol. 1975; 13: 2983.
17. Sawano A, Miyawaki A. Directed evolution of green fluorescent protein by a new versatile PCR strategy for site-directed and semi-random mutagenesis. Nucleic Acids Res. 2000; 28: E78.
18. Gotoh T, Chowdhury S, Takiguchi M, Mori M. The glucocorticoid-responsive gene cascade. Activation of the rat arginase gene through induction of C/EBPß. J Biol Chem. 1997; 272: 36943698.
19. Koike C, Hayakawa Y, Niiya K, Sakuragawa N, Sasaki H. The production of heparin cofactor II is not regulated by inflammatory cytokines in human hepatoma cells: comparison with plasminogen activator inhibitor type-1. Thromb Haemost. 1996; 75: 298302.[Medline] [Order article via Infotrieve]
20. Xiong W, Hsieh C, Kurtz AJ, Rabek JP, Papaconstantinou J. Regulation of CCAAT/enhancer-binding protein-ß isoform synthesis by alternative translational initiation at multiple AUG start sites. Nucleic Acids Res. 2001; 29: 30873098.
21. Lekstrom-Himes J, Xanthopoulos KG. Biological role of the CCAAT/enhancer-binding protein family of transcription factors. J Biol Chem. 1998; 273: 2854528548.
22. Takata Y, Kitami Y, Yang ZH, Nakamura M, Okura T, Hiwada K. Vascular inflammation is negatively autoregulated by interaction between CCAAT/enhancer-binding protein-
and peroxisome proliferator-activated receptor-
. Circ Res. 2002; 91: 427433.
23. Ray A, Ray BK. Serum amyloid A gene expression under acute-phase conditions involves participation of inducible C/EBP-ß and C/EBP-
and their activation by phosphorylation. Mol Cell Biol. 1994; 14: 43244332.
24. Khanna-Gupta A, Zibello T, Sun H, Gaines P, Berliner N. Chromatin immunoprecipitation (ChIP) studies indicate a role for CCAAT enhancer binding proteins alpha and epsilon (C/EBP
and C/EBP
) and CDP/cut in myeloid maturation-induced lactoferrin gene expression. Blood. 2003; 101: 34603468.
25. Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem. 1993; 268: 1073910745.
26. Cantwell CA, Sterneck E, Johnson PF. Interleukin-6-specific activation of the C/EBP
gene in hepatocytes is mediated by Stat3 and Sp1. Mol Cell Biol. 1998; 18: 21082117.
27. Takemoto M, Liao JK. Pleiotropic effects of 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibitors. Arterioscler Thromb Vasc Biol. 2001; 11: 17121719.
This article has been cited by other articles:
![]() |
D. Ozel Demiralp, H. Aktas, and N. Akar The Effect of Plasminogen Activator Inhibitor-1 -675 4G/5G Polymorphism on PAI-1 Gene Expression and Adipocyte Differentiation Clinical and Applied Thrombosis/Hemostasis, October 1, 2008; 14(4): 438 - 446. [Abstract] [PDF] |
||||
![]() |
J. Dong, S. Fujii, S. Imagawa, S. Matsumoto, M. Matsushita, S. Todo, H. Tsutsui, and B. E. Sobel IL-1 and IL-6 induce hepatocyte plasminogen activator inhibitor-1 expression through independent signaling pathways converging on C/EBP{delta} Am J Physiol Cell Physiol, January 1, 2007; 292(1): C209 - C215. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Sternlicht, A. M. Dunning, D. H. Moore, P. D.P. Pharoah, D. G. Ginzinger, K. Chin, J. W. Gray, F. M. Waldman, B. A.J. Ponder, and Z. Werb Prognostic Value of PAI1 in Invasive Breast Cancer: Evidence That Tumor-Specific Factors Are More Important Than Genetic Variation in Regulating PAI1 Expression. Cancer Epidemiol. Biomarkers Prev., November 1, 2006; 15(11): 2107 - 2114. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Imagawa, S. Fujii, J. Dong, T. Furumoto, T. Kaneko, T. Zaman, Y. Satoh, H. Tsutsui, and B. E Sobel Hepatocyte Growth Factor Regulates E Box-Dependent Plasminogen Activator Inhibitor Type 1 Gene Expression in HepG2 Liver Cells Arterioscler Thromb Vasc Biol, October 1, 2006; 26(10): 2407 - 2413. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Okamoto, Y. Iwamoto, and Y. Maru Oxidative Stress-Responsive Transcription Factor ATF3 Potentially Mediates Diabetic Angiopathy Mol. Cell. Biol., February 1, 2006; 26(3): 1087 - 1097. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |