Vascular Biology |
From Anatomic Pathology, Tor Vergata University of Rome, Italy.
Correspondence to Augusto Orlandi, Anatomic Pathology Institute, Department of Biopathology and Image Diagnostics, Tor Vergata University of Rome, Via Montpellier 1, 00133 Rome, Italy. E-mail orlandi{at}uniroma2.it
| Abstract |
|---|
|
|
|---|
Methods and Results Clusterin expression was evaluated by immunohistochemistry and Western blotting in human arteries and rat aortas. In human diffuse myointimal thickening, clusterin was detected in cell cytoplasm and extracellular space, whereas it was practically absent in the media. In rat aortas 15 days after ballooning, intimal cells (IT cells) overexpressed s-CLU and n-CLU, the latter mainly in the inner neointima; clusterin expression decreased at 60 days. In vitro, IT cells maintained high clusterin expression and its antisense markedly reduced proliferation and increased apoptosis. Western blotting showed that all-trans retinoic acid-induced proliferative arrest and increased
-smooth muscle actin expression did associate to s-CLU and B-myb reduction, whereas bax-related apoptosis was associated to a shift from the s-CLU to n-CLU isoform.
Conclusions Clusterin overexpression characterized neointimal SMCs; s-CLU expression decreased in IT cells during all-trans retinoic acid-induced proliferative arrest and redifferentiation, whereas n-CLU overexpression was characteristic of apoptosis.
Clusterin was detected in human arterial myointimal thickening and absent in the underlying media. Rat neointimal cells overexpressed clusterin and clusterin antisense oligonucleotide reduced proliferation and increased apoptosis. All-trans retinoic acid-induced proliferative arrest showed association with s-CLU reduction and n-CLU overexpression with apoptosis, supporting a different biological role of these isoforms.
Key Words: apolipoprotein J smooth muscle cell heterogeneity intimal thickening
-smooth muscle actin
| Introduction |
|---|
|
|
|---|
-smooth muscle actin (
-actin) expression of intimal SMCs.1012 In vitro, intimal cells show increased susceptibility to atRA-induced apoptosis as compared with normal media SMCs,13 confirming the main role of phenotype in determining SMC behavior. Phenotypic heterogeneity depends on the expression of specific gene subsets that are responsible for the different response to microenvironmental changes.9,14 Clusterin/apolipoprotein J (clusterin), an 80-kDa heterodimeric glycoprotein,15 plays a functional role in SMC differentiation.16 Clusterin is found in most physiological fluids17,18 and shows high-sequence conservation.19 Clusterin is implicated in several physiological processes such as sperm maturation, cholesterol transport, tissue remodeling, cell-cell and cell-substratum interactions, and promotion or inhibition of apoptosis.2023 In uninjured rabbit aortas, clusterin mRNA is practically absent, whereas it rapidly increases 24 hours after disendothelialization, returning to normal levels after 24 weeks.24 Clusterin is also detected in atherosclerotic lesions and its expression increases with the progression of atherosclerosis.25 In vitro, clusterin expressed and secreted by vascular SMCs regulates nodule formation and migration.26 Recently, 2 clusterin isoforms with distinct biological roles have been characterized; 76- to 80-kDa fully glycosylated cytoplasmic clusterin is mainly directed to an extracellular milieu as a 32-kDa secreted clusterin isoform (s-CLU) and is related to tumor progression.27,28 A 40- to 42-kDa nuclear clusterin isoform (n-CLU) was identified and its involvement in the induction of apoptosis has been revealed.23,29,30 In the present study, we investigated clusterin expression in different SMC phenotypes in vivo and in vitro. The role of different isoforms in atRA-induced proliferative arrest and apoptosis is also reported and discussed.
| Methods |
|---|
|
|
|---|
Cells, Culture Conditions, and Treatment
Intimal cells (IT cells) 15 days after ballooning and uninjured normal media SMCs were isolated and grown in Dulbecco modified Eagle medium (DMEM; Gibco) supplemented with 10% FCS (Biological Industries).13 Passage 5 cells were seeded at a 5x103 cell/cm2 density and synchronized in DMEM plus 0.1% FCS for 24 hours; for the anti-proliferative investigation, cells were treated with 2.5 µmol/L atRA (Sigma) dissolved in DMSO13 for up to 6 days in the presence of serum; the medium was replaced after 3 days. At this concentration, atRA induces a significant growth arrest of IT cells without significantly reducing viability.13 For the apoptotic studies, IT cells were treated up to 6 days with 5 µmol/L atRA. A dye exclusion test (0.4% Trypan blue) was performed along with cell counting to evaluate viability.13 At higher concentrations, atRA results cytotoxic.11,13 All experiments were repeated in triplicate.
Immunochemical Procedures
Immunohistochemistry of 4-µm-thick sections was performed32 using monoclonal anti-
-actin, anti-BrdUrd (Dako) and anti-
-chain clusterin (Upstate) antibodies. Previous tests demonstrated that the latter detects all isoforms and specifically cross-reacts with rat clusterin (not shown). An anti-clusterin antibody was used at a 1:400 dilution overnight at 4°C with positive and negative controls (goat or mouse IgG). Its specificity was compared with a rabbit polyclonal antibody (Santa Cruz), obtaining the same results. In vitro immunostaining was performed in cells seeded in slide chambers (Nunc) after formalin-fixation using diaminobenzidine as chromogen. The number of positive cells was morphometrically calculated13 and expressed as percentage of total cells. The percentage of positive nuclei was also compared in the inner half and remaining neointima.
Antisense Inhibition of Clusterin
To assess if clusterin expression inhibition directly influences cell proliferation and/or death, an antisense oligonucleotide corresponding to the rat clusterin translation initiation site (alpha chain) was applied. Oligofectamine (Invitrogen) was used to increase oligodeoxynucleotide (ODN) cell uptake. The Phosphorotioate ODN consisted of the rat clusterin sequence (sense, 5'AAGTTCTCCTGCTGTGTGTG3') and its corresponding antisense sequence, near the ATG translation starting site. IT cells were treated with 200 nM antisense oligonucleotide after a 20-minute pre-incubation with 1 µL of the oligofectamine reagent in OPTI-MEM (Invitrogen). Sense and scramble phosphorothioated 20-mer (5'sTsCsTsAsGsTsTsAsGsCsAsCsGsAsAsTsGsCsA3') oligonucleotides were also synthesized (Genset) for comparison. A sequence homology search in the GenBank database with the Nucleotide Blast program revealed that the scramble oligonucleotide sequence did not match or was complementary to the sequence of any known mammalian genes. Cotreatment with 5 µmol/L atRA was also performed. Immunocytochemistry was performed after 2 days of treatment. Experiments were repeated in triplicate.
Chromatin Morphology and DNA Laddering
For apoptosis, the percentage of cells showing chromatin condensation, fragmentation, or shrinkage by Hoechst 33342 staining was evaluated in triplicate.13 To confirm the presence of apoptosis, DNA was extracted after scraping, then quantified and checked. A ligation-mediated polymerase chain reaction was performed.13 The nucleosomal ladder was quantified in 1.2% agarose gels stained with ethidium bromide.13
Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis and Western Blotting
After sodium dodecyl sulfate-polyacrylamide gel electrophoresis33 on a 5% to 20% gradient gel, 2 to 50 µg of proteins were transferred to nitrocellulose filters (0.45 mm; Schleicher & Schuell) for Western blotting,34 incubated with anti-
-actin (DAKO; 1:500), anti-clusterin (Upstate; 1:1000), anti-B-myb (1:200), and anti-bax protein (Santa Cruz; 1:200), followed by a goat anti-mouse IgG (1:105) or donkey anti-goat IgG (Santa Cruz; 1:105). Quantification of Omat-x Kodak film was performed as previously reported.31 Total clusterin expression (total CLU) was densitometrically calculated as the sum of the absorbance of all isoform bands. To consider protein loading, the densitometric value of each protein was normalized to that of ß-actin. All experiments were repeated in triplicate.
Statistical Analysis
All results were expressed as the arithmetical mean±SEM of 3 different experiments. For the statistical evaluation, results were analyzed with the Student t test. The differences were considered statistically significant for values of P<0.05.
| Results |
|---|
|
|
|---|
-actin expression was low (Figure 1F). A small percentage of intimal cells showed distinct nuclear clusterin immunostaining; among these, 83.6±0.9 were present in luminal neointima and only 13.7±0.9 were in remaining neointima (P<0.01). A small number of underlying medial SMCs were still clusterin-positive. After 60 days (Figure 1G), the percentage of clusterin-positive intimal cells was markedly reduced compared with what was observed 15 days after ballooning (P<0.01). Residual positivity was almost cytoplasmic and extracellular. At the same time, intimal cells also expressed a high level of
-actin (Figure 1H), comparable to that of the underlying tunica media.
|
SMC Phenotype and Clusterin Expression In Vitro
Cultured intimal cells appeared characteristically epithelioid, with a tendency to grow in small groups, as previously reported.31 When confluent, their epithelioid appearance was preserved and grew in a single layer, differently from the classic "hill and valley" pattern of medial SMCs.31 In sparse cultures, IT cells proliferated more compared with normal media SMCs. Immunocytochemistry (Figure 2A) showed that in the presence of serum, IT cells presented stronger clusterin staining than medial SMCs. Western blotting (Figure 2B and 2C) demonstrated that IT cells expressed 2.5-fold more clusterin (P<0.01) and less
-actin (28.2±5.4; P<0.01) than medial SMCs.
|
Growth Arrest of IT Cells and Clusterin Expression
To investigate the modulation of clusterin and its isoforms during apoptosis and proliferative arrest of vascular SMCs, we cultured IT cells in the presence of atRA at different concentrations. As previously reported,13 atRA did not significantly reduce cell viability at a 2.5-µmol/L concentration. After 6 days, the counted/seeded ratio of atRA-treated IT cells (10.8±0.6) was less than control (16.7±0.7; P<0.01) and close to that of medial SMCs (9.6±0.3). After 6 days, despite the presence of a lower atRA concentration, Western blot showed an increase of total clusterin expression compared with 2-day treated cultures, mainly represented by s-CLU (Figure 3; P<0.01); n-CLU expression was comparable to that of control cultures but less than the 2-day-treated value (P<0.01). The unglycosylated 50-kDa clusterin isoform was not affected by atRA at different times. After 6 days of treatment, Bax expression was similar to control cultures.
|
AtRA Modulates B-myb Expression
B-myb expression was evaluated by Western blot in the same protein extracts. As shown in Figure 3A, a 2.5-µmol/L atRA treatment for 6 days induced strong downregulation of B-myb expression (2.5 times) in IT cells compared with control (P<0.01), in agreement with the atRA-induced decrease of proliferation rate.
Apoptosis and Nuclear Clusterin Overexpression
To evaluate clusterin and its isoforms during apoptosis, we cultured IT cells in the presence of atRA at a 5-µmol/L concentration.13 After 2 days of treatment, the percentage of apoptotic condensed or fragmented nuclei stained with Hoechst in IT cells (16.7±2.4) increased compared with controls (1.1±0.3; P<0.01). As previously reported,13 at lower atRA concentrations, apoptosis was reduced in a dose-dependent manner (not shown). Western blotting demonstrated that the atRA-induced apoptotic increase was associated to a modulation of clusterin isoform expression. As shown in Figure 3, after 2 days, n-CLU expression markedly increased (
3-fold) compared with control cultures (P<0.01), whereas the s-CLU level was unchanged. Densitometric blot scanning also showed that Bax expression increased in IT cells (129.0±6%) compared with controls. In atRA-treated normal media SMCs, these effects were slight or absent (not shown).13 Quantification of ligation-mediated polymerase chain reaction products after 2 days (Figure 3C) confirmed the increased relative density value of the DNA ladder in 5 µmol/L atRA-treated IT cultures compared with control.
Clusterin Antisense Oligonucleotide Induces Apoptosis and Inhibits Proliferation In Vitro
To assess if clusterin expression inhibition influences cell proliferation and/or death, we treated IT cells with an antisense oligonucleotide corresponding to the rat clusterin translation initiation site. As shown in Figure I (available online at http://atvb.ahajournals.org), the clusterin antisense treatment dramatically affected IT cell proliferation compared with sense oligonucleotide-treated and untreated control cultures (P<0.02 and 0.01 after 3 and 6 days, respectively). After 2 days, clusterin antisense oligonucleotide also induced IT cell death. It is worth noting that IT cell death was similar to that obtained with 5 µmol/L atRA. A synergistic effect of atRA and antisense oligonucleotide on cell death was also detected, and it was much more evident than the effect on proliferative rate. Immunostaining of clusterin expression in these different culture conditions is reported in Figure II (available online at http://atvb.ahajournals.org). Clusterin expression in sense oligonucleotide-treated IT cells was similar to that of control (Figure 2A) and was dramatically reduced with clusterin antisense oligonucleotide. A faint nuclear positivity was left in atRA plus antisense oligonucleotide-treated IT cells, with almost negative cytoplasms. With 5 µmol/L atRA alone, an increase of nuclear staining was easily detectable. In agreement with immunocytochemical data, Western blotting (Figure 4) demonstrated a strong inhibition (80%) of clusterin production after clusterin antisense oligonucleotide treatment with no selective effect on specific isoforms; sense and scramble oligonucleotides had no significant effect on clusterin expression.
|
| Discussion |
|---|
|
|
|---|
Our findings provide new details concerning the role of clusterin in retinoic-induced changes of intimal SMCs. The chronologically regulated shift of isoforms is likely caused by a negative regulation of clusterin transcription by atRA. The clusterin promoter contains a putative RARE sequence at position 2810 from transcription start site.40 We documented that the atRA-induced proliferation reduction was associated to the inhibition of s-CLU and B-myb expression. A B-myb binding site has recently been demonstrated in the human 5' flanking region,41 which could be involved in the transactivation of clusterin expression. As for the presence of the atRA consensus sequence in the clusterin promoter region, B-myb transactivation could also negatively influence clusterin expression.41 These results suggest that atRA and B-myb-induced transcription differentially regulate clusterin expression.40 Antisense oligonucleotide effects confirmed that clusterin expression inhibition significantly affects IT cell proliferation and apoptosis. The atRA-induced downregulation of s-CLU expression is consistent with the strong pro-apoptotic n-CLU increase. The synergistic effects of atRA and antisense oligonucleotide suggest that n-CLU overexpression is not the only pro-apoptotic signal induced by atRA.11,12 The demonstration of a faint nuclear staining in antisense-treated IT cells could be caused by a displacement of the putative reservoir of cytoplasmic inactive n-CLU. Recently, Trougakos et al42 failed to inhibit n-CLU expression with siRNA, assessing that the n-CLU protein is extremely stable.
Our results also pointed out additional data concerning s-CLU involvement in vascular SMC proliferation. The early increase of medial SMC proliferation after disendothelialization and, successively, in the neointima, was associated with s-CLU expression, according to that previously reported.24 In response to injury, medial SMCs undergo a phenotypic transition from the "contractile" to the "synthetic" proliferating state.2,3 The chronologically regulated intimal expression of clusterin accompanies this process and suggests a critical role in the postinjury vessel wall remodeling.16,24 These findings are only apparently in contrast with that reported by Sivamurthy et al,43 who stated that clusterin is a potent inhibitor of SMC migration and growth factor-stimulated proliferation in vitro. It is likely that exogenous administration inhibits endogenous clusterin production, in particular s-CLU, which represents the main isoform, with consequent reduced proliferation and enhanced SMC survival.43 As a matter of fact, increased s-CLU expression has recently been documented in the neoplastic growth process.27 It is likely that the cell stress-induced increased proliferative state correlates to s-CLU overexpression, whose function is mainly involved in membrane recycling and cell-cell adhesion.18,19 Enhanced tumor cell survival has been correlated to s-CLU overexpression and n-CLU loss; this switch of clusterin isoforms confers a more aggressive migratory cell phenotype during cancer progression.28 An increase of s-CLU is also documented with the progression of human atherosclerosis44 and seems to be involved in type II diabetes and myocardial infarction.45
In conclusion, our data confirm that the role of clusterin and its isoforms in SMC behavior is complex and chronologically regulated in response to microenvironmental changes; atRA-induced proliferative arrest and apoptosis of intimal SMCs are associated to a shift of clusterin isoforms, in particular s-CLU reduction, which is associated with proliferative arrest and re-differentiation, whereas Bax-related apoptosis is associated with n-CLU overexpression. Further studies are needed to verify if the modulation of clusterin isoforms may represent a target in the pharmacological control of human vascular diseases, including restenosis.
| Acknowledgments |
|---|
Received July 8, 2004; accepted November 11, 2004.
| References |
|---|
|
|
|---|
2. Clowes AW, Reidy MA, Clowes MM. Mechanisms of stenosis after arterial injury. Lab Invest. 1983; 49: 208215.[Medline] [Order article via Infotrieve]
3. Kocher O, Skalli O, Bloom WS, Gabbiani G. Cytoskeleton of rat aortic smooth muscle cells. Normal conditions and experimental intimal thickening. Lab Invest. 1984; 50: 645652.[Medline] [Order article via Infotrieve]
4. Movat HZ, More RH, Haust MD. The diffuse intimal thickening of the human aorta with aging. Am J Pathol. 1958; 34: 10231031.
5. Bochaton-Piallat ML, Gabbiani F, Redard M, Desmouliere A, Gabbiani G. Apoptosis participates in cellularity regulation during rat aortic intimal thickening. Am J Pathol. 1995; 146: 10591064.[Abstract]
6. Isner MJ, Kearney M, Bortman S, Passeri J. Apoptosis in human atherosclerosis and restenosis. Circulation. 1995; 91: 27032711.
7. Shanahan CM, Weissberg PL. Smooth muscle cell heterogeneity: patterns of gene expression in vascular smooth muscle cells in vitro and in vivo. Arterioscler Thromb Vasc Biol. 1998; 18: 333338.
8. Schwartz SM, deBlois D, OBrien ER. The intima: soil for atherosclerosis and restenosis. Circ Res. 1995; 77: 445465.
9. Ross R. Atherosclerosis, an inflammatory disease. N Engl J Med. 1999; 340: 115126.
10. Neuville P, Yan Z, Gidlöf A, Pepper MS, Hansson GK, Gabbiani G, Sirsjö A. Retinoic acid regulates arterial smooth muscle cell proliferation and phenotypic features in vivo and in vitro through an RAR
-dependent signaling pathway. Arterioscler Thromb Vasc Biol. 1999; 19: 14301436.
11. Neuville P, Bochaton-Piallat ML, Gabbiani G. Retinoids and arterial smooth muscle cells. Arterioscler Thromb Vasc Biol. 2000; 20: 18821888.
12. Miano JM, Topouzis S, Majesky MW, Olson EN. Retinoid receptor expression and all-trans retinoic acid-mediated growth inhibition in vascular smooth muscle cells. Circulation. 1996; 93: 18861895.
13. Orlandi A, Francesconi A, Cocchia D, Corsini A, Spagnoli LG. Phenotypic heterogeneity influences apoptotic susceptibility to retinoic acid and cis-platinum of rat arterial smooth muscle cells in vitro: Implications for the evolution of experimental intimal thickening. Arterioscler Thromb Vasc Biol. 2001; 21: 11181123.
14. Hao H, Ropraz P, Verin V, Camenzind E, Geinoz A, Pepper MS, Gabbiani G, Bochaton-Piallat ML. Heterogeneity of smooth muscle cell populations cultured from pig coronary artery. Arterioscler Thromb Vasc Biol. 2002; 22: 10931099.
15. Watts MJ, Dankert JR, Morgan P. Isolation and characterization of a membrane-attack-complex-inhibiting protein present in human serum and other biological fluids. Biochem J. 1990; 265: 471477.[Medline] [Order article via Infotrieve]
16. Moulson CL, Millis AJ. Clusterin (Apo J) regulates vascular smooth muscle cell differentiation in vitro. J Cell Physiol. 1999; 180: 355364.[CrossRef][Medline] [Order article via Infotrieve]
17. Witte DP, Aronow BJ, Staudeman ML, Stuart WD, Clay MA, Gruppo RA, Jenkins SH, Harmony JA. Platelet activation releases megakaryocyte-synthesized apolipoprotein J, a highly abundant protein in atheromatous lesions. Am J Pathol. 1993; 143: 763773.[Abstract]
18. Jenne DE, Tschopp J. Molecular structure and functional characterization of a human complement cytolysis inhibitor found in blood and seminal plasma: identity to sulphate glycoprotein 2, a constituent of rat testis fluid. Proc Natl Acad Sci U S A. 1989; 86: 71237127.
19. De Silva HV, Harmony JA, Stuart WD, Gil CM, Robbins J. Apolipoprotein J: structure and tissue distribution. Biochemistry. 1990; 29: 53805389.[CrossRef][Medline] [Order article via Infotrieve]
20. Aronow BJ, Lund SD, Brown TL, Harmony JA, Witte DP. Apolipoprotein J expression at fluid-tissue interfaces: potential role in barrier cytoprotection. Proc Natl Acad Sci U S A. 1993; 90: 725729.
21. Fratelli M, Galli G, Minto M, Pasinetti GM. Role of clusterin in cell adhesion during early phases of programmed cell death in P19 embryonic carcinoma cells. Biochim Biophys Acta. 1996; 1311: 7176.[Medline] [Order article via Infotrieve]
22. Ho SM, Leav I, Ghatak S, Merk F, Jagannathan VS, Mallery K. Lack of association between enhanced TRPM-2/clusterin expression and increased apoptotic activity in sex-hormone-induced prostatic dysplasia of the Noble rat. Am J Pathol. 1998; 153: 131139.
23. OSullivan J, Whyte L, Drake J, Tenniswood M. Alterations in the post-translational modification and intracellular trafficking of clusterin in MCF-7 cells during apoptosis. Cell Death Differ. 2003; 10: 914927.[CrossRef][Medline] [Order article via Infotrieve]
24. Miyata M, Biro S, Kaieda H, Eto H, Orihara K, Kihara T, Obata H, Matsushita N, Matsuyama T, Tei C. Apolipoprotein J/clusterin is induced in vascular smooth muscle cells after vascular injury. Circulation. 2001; 104: 14071412.
25. Ishikawa Y, Akasaka Y, Ishii T, Komiyama K, Masuda S, Asuwa N, Choi-Miura NH, Tomita M. Distribution and synthesis of apolipoprotein J in the atherosclerotic aorta. Arterioscler Thromb Vasc Biol. 1998; 18: 665672.
26. Millis AJ, Luciani M, McCue HM, Rosenberg ME, Moulson CL. Clusterin regulates vascular smooth muscle cell nodule formation and migration. J Cell Physiol. 2001; 186: 210219.[CrossRef][Medline] [Order article via Infotrieve]
27. Redondo M, Villar E, Torres-Munoz J, Tellez T, Morell M, Petito CK. Overexpression of clusterin in human breast carcinoma. Am J Pathol. 2000; 157: 393399.
28. Pucci S, Bonanno E, Pichiorri F, Angeloni C, Spagnoli LG. Modulation of different clusterin isoforms in human colon tumorigenesis. Oncogene. 2004; 23: 22982304.[CrossRef][Medline] [Order article via Infotrieve]
29. Leskov KS, Klokov DY, Li J, Kinsella TJ, Boothman DA. Synthesis and functional analyses of nuclear clusterin, a cell death protein. J Biol Chem. 2003; 278: 1159011600.
30. Lakins J, Bennett SA, Chen JH, Arnold JM, Morrissey C, Wong P, OSullivan J, Tenniswood M. Clusterin biogenesis is altered during apoptosis in the regressing rat ventral prostate. J Biol Chem. 1998; 273: 2788727895.
31. Orlandi A, Ehrlich HP, Ropraz P, Spagnoli LG, Gabbiani G. Rat aortic smooth muscle cells isolated from different layers and at different times after endothelial denudation show distinct biological features in vitro. Arterioscler Thromb. 1994; 14: 982989.
32. Orlandi A, Marcellini M, Spagnoli LG. Aging influences development and progression of early aortic atherosclerotic lesions in cholesterol-fed rabbits. Arterioscler Thromb Vasc Biol. 2000; 20: 11231136.
33. Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970; 227: 680685.[CrossRef][Medline] [Order article via Infotrieve]
34. Towbin H, Staehelin T, Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci U S A. 1979; 76: 43504354.
35. Li WG, Miller FJ Jr, Brown MR, Chatterjee P, Aylsworth GR, Shao J, Spector AA, Oberley LW, Weintraub NL. Enhanced H(2)O(2)-induced cytotoxicity in "epithelioid" smooth muscle cells: implications for neointimal regression. Arterioscler Thromb Vasc Biol. 2000; 20: 14731479.
36. Neuville P, Geinoz A, Benzonana G, Redard M, Gabbiani F, Ropraz P, Gabbiani G. Cellular retinol-binding protein-1 is expressed by distinct subsets of rat arterial smooth muscle cells in vitro and in vivo. Am J Pathol. 1997; 150: 509521.[Abstract]
37. Reddy KB, Karode MC, Harmony AK, Howe PH. Interaction of transforming growth factor beta receptors with apolipoprotein J/clusterin. Biochemistry. 1996; 35: 309314.[CrossRef][Medline] [Order article via Infotrieve]
38. Yang CR, Leskov K, Hosley-Eberlein K, Criswell T, Pink JJ, Kinsella TJ, Boothman DA. Nuclear clusterin/XIP8, an x-ray-induced Ku70-binding protein that signals cell death. Proc Natl Acad Sci U S A. 2000; 97: 59075912.
39. Sawada M, Sun W, Hayes P, Leskov K, Boothman DA, Matsuyama S. Ku70 suppresses the apoptotic translocation of Bax to mitochondria. Nat Cell Biol. 2003; 5: 320329.[CrossRef][Medline] [Order article via Infotrieve]
40. Gaemers IC, Van Pelt AM, Themmen AP, De Rooij DG. Isolation and characterization of all-trans-retinoic acid-responsive genes in the rat testis. Mol Reprod Dev. 1998; 50: 16.[CrossRef][Medline] [Order article via Infotrieve]
41. Cervellera M, Raschella G, Santilli G, Tanno B, Ventura A, Mancini C, Sevignani C, Calabretta B, Sala A. Direct transactivation of the anti-apoptotic gene apolipoprotein J (clusterin) by B-MYB. J Biol Chem. 2000; 275: 2105521060.
42. Trougakos IP, So A, Jansen B, Gleave ME, Gonos ES. Silencing expression of the clusterin/apolipoprotein j gene in human cancer cells using small interfering RNA induces spontaneous apoptosis, reduced growth ability, and cell sensitization to genotoxic and oxidative stress. Cancer Res. 2004; 64: 18341842.
43. Sivamurthy N, Stone DH, Logerfo FW, Quist WC. Apolipoprotein J inhibits the migration, adhesion, and proliferation of vascular smooth muscle cells. J Vasc Surg. 2001; 34: 716723.[CrossRef][Medline] [Order article via Infotrieve]
44. Mackness B, Hunt R, Durrington PN, Mackness MI. Increased immunolocalization of paraoxonase, clusterin, and apolipoprotein A-I in the human artery wall with the progression of atherosclerosis. Arterioscler Thromb Vasc Biol. 1997; 17: 12331238.
45. Trougakos IP, Poulakou M, Stathatos M, Chalikia A, Melidonis A, Gonos ES. Serum levels of the senescence biomarker clusterin/apolipoprotein J increase significantly in diabetes type II and during development of coronary heart disease or at myocardial infarction. Exp Gerontol. 2002; 37: 11751187.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
H.-J. Kim, E.-K. Yoo, J.-Y. Kim, Y.-K. Choi, H.-J. Lee, J.-K. Kim, N. H. Jeoung, K.-U. Lee, I.-S. Park, B.-H. Min, et al. Protective Role of Clusterin/Apolipoprotein J Against Neointimal Hyperplasia via Antiproliferative Effect on Vascular Smooth Muscle Cells and Cytoprotective Effect on Endothelial Cells Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1558 - 1564. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Orlandi, A. Ferlosio, G. Arcuri, M. G. Scioli, S. De Falco, and L. G. Spagnoli Flt-1 expression influences apoptotic susceptibility of vascular smooth muscle cells through the NF-{kappa}B/IAP-1 pathway Cardiovasc Res, September 16, 2009; (2009) cvp288v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Moretti, M. M. Marelli, S. Mai, A. Cariboni, M. Scaltriti, S. Bettuzzi, and P. Limonta Clusterin Isoforms Differentially Affect Growth and Motility of Prostate Cells: Possible Implications in Prostate Tumorigenesis Cancer Res., November 1, 2007; 67(21): 10325 - 10333. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Albert, A. Gonzalez, P. P. Massion, H. Chen, S. J. Olson, Y. Shyr, R. Diaz, E. S. Lambright, A. Sandler, D. P. Carbone, et al. Cytoplasmic Clusterin Expression Is Associated with Longer Survival in Patients with Resected Non Small Cell Lung Cancer Cancer Epidemiol. Biomarkers Prev., September 1, 2007; 16(9): 1845 - 1851. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Orlandi, A. Francesconi, M. Marcellini, A. Di Lascio, and L. G. Spagnoli Propionyl-L-carnitine Reduces Proliferation and Potentiates Bax-related Apoptosis of Aortic Intimal Smooth Muscle Cells by Modulating Nuclear Factor-{kappa}B Activity J. Biol. Chem., February 16, 2007; 282(7): 4932 - 4942. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |