| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Atherosclerosis and Lipoproteins |
From the Department of Cardiology (J.G., A. Abashidze, H.S., H.M., G.K.), Tel Aviv Sourasky Medical Center Affiliated to the Sackler Faculty of Medicine, Tel Aviv University, Israel; Institute of Pathology (A. Afek, J.K.), Sheba Medical Center, Tel Aviv University, Israel; and the Institute of Hematology (V.D.), Tel Aviv Medical Center, Israel.
Reprint requests to Jacob George, MD, The Department of Cardiology, Tel Aviv Sourasky Medical Center, 6 Weizmann St, Tel Aviv, Israel. E-mail jacobg{at}post.tau.ac.il
| Abstract |
|---|
|
|
|---|
Methods and Results ApoE KO mice aged 10 weeks served as recipients. Labeled BM cells and spleen cellderived EPCs from age-matched apoE KO mice were injected intravenously to 2 groups of recipient mice each. Additional mice served as controls receiving saline. Both protocols were repeated 3 times at 2 weekly intervals. On killing, plaque size and character were studied, lipid profile analyzed, and serum and aortic cytokines assayed. Spleen cellderived cells contained a significantly larger number of endothelial cell precursors. Labeled EPCs and BM cells were found abundantly in the spleens, yet also in the lesions of the recipient mice. Aortic sinus lesion size was significantly increased in mice receiving BM cells (n=10) in the EPC-treated group (n=10) compared with controls (n=10; a 54% and a 34% increase in aortic sinus plaque area, respectively). Mice receiving EPCs exhibited plaques with larger lipid cores and thinner fibrous caps and a higher number of infiltrating CD3 cells. RT-PCR analysis of aortas revealed reduced expression of mRNA for interleukin-10 (IL-10) in both cell transfer groups. Higher serum concentrations of IL-6 and monocyte chemoattractant protein-1 were found in sera from BM recipients, whereas lower IL-10 levels were found in mice transfused with spleen-derived EPCs.
Conclusions Transfer of BM cells and EPCs may result in an increase in atherosclerotic lesion size, whereas EPC transfer could also potentially influence plaque stability.
Transfer of EPCs and BM cells significantly increased plaque size in apoE KO mice, whereas only the former treatment was associated with destabilization of the lesions. BM cell and EPC transfer reduced aortic expression of IL-10. Thus, cell therapy with BM cells should be used with caution in clinical trials.
Key Words: stem cells cell therapy atherosclerosis inflammation endothelial progenitor cells
| Introduction |
|---|
|
|
|---|
In both these processes, ECs have been proposed to play a major role forming the attachment surface on which monocytes role and adhere. ECs participate in the early fatty streak formation and in constituting the vasa vasorum network that acts to supply the inner growing neointima in more advanced lesions. These actions are regulated by expression of a set of adhesion molecules on the EC surface and by synthesis and secretion of regulatory humoral factors.1,2
Apparently, confounding data have been provided with regard to the effect of EC on plaque progression and phenotype. Atherosclerosis is a disorder with endothelial dysfunction, and it is thus conceivable that replenishment of ECs would result in attenuated EC activation with consequent inflammation. These findings are supported by a study by Rauscher et al3 showing that transfer of bone marrow (BM) cells from young apolipoprotein E knockout (apoE KO) mice reduces atherosclerotic plaque size. However, it appears that the angiogenesis inhibitor TNP-470 and angiostatin acting to inhibit plaque neovascularization were found to suppress atherosclerotic lesion development,4,5 whereas vascular endothelial growth factor promoted plaque growth.6 These findings support the hypothesis that vasa vasorum provides a delivery conduit through which inflammatory cells can gain access to the growing neointima and to further perpetuate lesion progression.
Endothelial progenitor cells (EPCs) have attracted major interest in recent years, particularly when found to be present as a subpopulation of peripheral mononuclear cells.7,8 They have been demonstrated to support postnatal angiogenesis and vasculogenesis in experimental models.912 Moreover, their number and functional properties are compromised in patients with atherosclerotic risk factors13,14 and restenosis,15 whereas tissue ischemia and growth factors have been shown to promote their mobilization from the BM cells,1517 possibly as a compensatory mechanism. The convincing findings with regard to the therapeutic potential of EPC transfer were followed by recent small-scale trials in patients with myocardial infarction in which BM cell and EPC transfer was used for improving cardiac performance with promising initial findings.1821
In the current study, we investigated the effects of transfer of spleen cellderived EPC and BM cells on the extent and nature of spontaneously arising atherosclerotic plaques of apoE KO mice.
| Materials and Methods |
|---|
|
|
|---|
Preparation and Labeling of Cells for Transfer
Spleen-derived cells were loaded on ficoll, after which recovered mononuclear cells were seeded on 24-well plates (106 per well) coated with fibronectin (Sigma) in 0.5 mL endothelial basal medium (CellSystems) supplemented with 1 µg/mL hydrocortisone, 3 µg/mL bovine brain extract, 30 µg/mL gentamicin, 50 µg/mL amphotericin B, and 10% FCS. After 5 days in culture, cells were washed with normal saline and resuspended. For transfusion experiments, 1x106 DiI-labeled cells were resuspended in 500 µL PBS for intravenous injection. BM cells were freshly prepared from tibias and femurs of donor age matched male apoE KO mice and suspended in PBS before labeling and injections. For long-term cultures, 1.5x106 spleen-derived EPCs or BM cells were cultured for 14 days in medium 199, with change of medium every third day.
Characterization of Cells Employed for Transfer
Fourteen days after culture in EC conditions, colonies with EC morphology were evident in both cultures (EPCs and BM cells). Immunofluorescence studies using rabbit polyclonal antiTie-2 (C-20), rat monoclonal antiflk-1 (A-3) goat polyclonal anti-CD31 (platelet EC adhesion molecule-1; M-20), and rabbit monoclonal antivon Willebrand factor (vWF; all from Santa Cruz Biotechnology) confirmed the EC-like identity of the colonies. EC lineage was further confirmed by indirect immunostaining with the use of DiIacetylated low-density lipoprotein (AcLDL) and costaining with BS-1 lectin (Sigma).
Fluorescence-Activated Cell Sorter Analysis of Cells Used for Transfer
To determine the phenotype of cells used for transfer, the following antibodies were used: phycoeryhtrin rat anti-mouse Flk-1 (PharMingen), fluorescein isothiocyanate rat antiSca-1 (Southern Biotechnology Associates, Inc.), and activated protein C rat antic-Kit (eBioscience), and read using a double-color FACSCalibur flow cytometer (Becton Dickinson).
Determination of Circulating Inflammatory Cytokines by Flow Cytometry
Serum cytokines were measured serially by cytometric bead array (CBA) using a 4-color FACSCalibur flow cytometer (Becton Dickinson). In CBA, 6 bead populations with distinct fluorescence intensities had been coated with capturing antibodies specific for the respective cytokines. These bead populations could be resolved in the fluorescence channels of the flow cytometer. After beads were incubated with 50 µL of serum, cytokines were captured by their corresponding beads. The cytokine-captured beads were then mixed with phycoerythrin-conjugated detection antibodies to form sandwich complexes. After incubation, washing, and acquisition of fluorescence data, the results were generated in graphical format using the BD CBA software. The concentrations of interferon-
(IFN-
) IFN-ß, interleukin-6 (IL-6), IL-10, monocyte chemoattractant protein-1 (MCP-1), tumor necrosis factor-
(TNF-
), and IL-12p70 were measured using the inflammatory cytokine CBA kits (BD PharMingen). The coefficients of variation for all cytokine assays were <10%.
Determination of Serum-Antioxidized LDL Antibodies
Ninety-sixwell plates were coated with either oxidized LDL (oxLDL; at concentration of 10 µg/mL in PBS) or native LDL overnight at 4°C. The next steps were performed as described previously.22
RT-PCR of Aortas
Aortas from all groups, obtained on killing, were removed and cleaned of the surrounding tissues after perfusion with RNase-free PBS. Total RNA was obtained using the RNeasy Kit (Qiagen Ltd.) and primed with oligo(dT) according to protocol provided with the Titan one-tube RT-PCR kit (Roche Molecular Diagnostics). The PCR (40 cycles) was performed using the ReddyMix PCR Master Mix (ABgene). The following primers were used: IFN-
(sense) CTTCTTCAGCAACAGCAAGGCGAAAA; IFN-
(antisense) CCCCCAGA TACAACCCCGCAATCA; IL-4 (sense) GAGCCATATCCACGGATGCGACAA; IL-4 (antisense) CATGGTGGCTCAGTACTACGAGTA; IL-10 (sense) CTGGACAACATACTGCT AACCGAC; IL-10 (antisense) ATTCA TTCATGGCCTTGT AGACACC; transforming growth factor-ß (TGF-ß; sense) AGACGGAATACAGGGCTTTCGATTCA; TGF-ß (antisense) CTTGGGCTTGCGACCCACGTAGTA; matrix metalloproteinase-2 (MMP-2; sense) GAGATCTGCAAACAGGACA; MMP-2 (antisense) TTACCTGAAGCTGGAGA; MMP-9 (sense) CGACGAGTTGTGGTCGC; MMP-9 (antisense) GCACTGAAGAATGATCT; tissue inhibitors of metalloproteinase-1 (TIMP-1; sense) CTGTGCCCCACCCCACC; TIMP-1 (antisense) AAGGCTTCAGGTCATCG; TIMP-2 (sense) TGCAGCTGCTCCCCGGTG; and TIMP-2 (antisense) TTATGGGTCCTCGATGTC.
Assessment of Atherosclerosis
Quantification of atherosclerotic lesions was done by calculating the lesion size in the aortic sinus as described previously.21
Assessment of Plaque Stability Markers by Histochemistry and Immunohistochemistry
Staining with Massons trichrome was used to determine fibrous cap to lipid core ratio determined by quantitative morphometry. CD3 lymphocytes and macrophage staining were performed as described previously.21
Statistical Analysis
Antibody and cytokine levels as well as plaque sizing and features were compared between the 3 groups using a 1-way ANOVA. P<0.05 was accepted as statistically significant. Results are expressed as mean±SEM.
| Results |
|---|
|
|
|---|
|
We further pursued comparatively the ability of BM cells and spleen cellderived EPCs to differentiate into ECs by monitoring their ability to form colony-forming units (cfu) after 14 days of culture in EC medium on fibronectin-coated surfaces. Indeed, cfu were formed by both cell populations and stained positive for several mature EC markers, namely: Tie-2, vascular endothelial growth factor receptor 2, CD31, and vWF (Figure 1B).
Transfer of either BM cells or EPCs did not alter the general health of the recipient apoE KO mice, nor were there differences evident in their weight on killing (data not shown). No differences were evident between the 3 experimental groups with regard to total cholesterol levels (data not shown).
Next, we explored whether fluorescently labeled cells used for transfer were homing to the atherosclerotic plaques, spleens, lungs, and liver. We observed that intravenously injected cells were present in all plaques, BM cells more abundantly populating the lesions compared with EPCs, although not statistically significant (2.9±0.3 versus 2.4±0.4 labeled cells per plaque). Similar numbers of labeled cells were also found in the spleen (28±7 versus 31±6 labeled cells per high-power field, respectively), in the lungs (9±3 versus 11±5 labeled cells per high-power field, respectively), and in the liver (5±3 versus 5±2 labeled cells per high-power field, respectively). The injected cells were found predominantly within the lipid core of the plaques and not in the endothelial or subendothelial regions.
We then evaluated a panel of serum cytokines thought to be involved in the pathogenesis of atherosclerotic plaques in apoE KO mice. No significant differences between the 3 experimental groups were evident with respect to serum IFN-
, TNF-
, MCP-1, or IL-12 (data not shown). However, we found that a significantly increased level of IL-6 was present in the BM celltreated mice (144±6 pg/mL) compared with EPC-treated mice (128±2 pg/mL; P<0.05) or controls (132±2 pg/mL; P<0.05). A similar trend was evident with regard to MCP-1. However, IL-10 serum levels were reduced in EPC-treated mice (123±10 pg/mL) compared with BM celltreated mice (198±28 pg/mL; P<0.01) or controls (212±42 pg/mL; P<0.05).
Next, we studied cytokine expression in the atherosclerotic aortas by RT-PCR. We found that expression of mRNA for IL-10, but not IL-4, IFN-
, TGF-ß, or MMPs, was significantly decreased in the aortas of mice receiving EPCs and BM cells (Figure 2).
|
Atherosclerotic aortic sinus lesion size was increased in EPC-treated and BM celltreated apoE KO mice compared with controls (Figure 3). Assessment of plaque stability by evaluating fibrous cap and lipid core using Massons trichrome staining demonstrated a significant decrease in fibrous cap area in mice receiving EPCs (mean collagen content 39±3.1%) compared with BM celltreated mice (51±3%; P<0.05) or controls (54±4%; P<0.05; Figure 3).
|
|
We then explored the presence of antibodies to oxLDL in the 3 recipient groups and found that IgG levels significantly increased in EPC-treated mice (mean OD 0.44±0.1) compared with controls (OD 0.21±0.09; P<0.05) and BM celltreated animals (0.16±0.01; P<0.05; Figure 4A).
We then further studied plaques immunohistochemically and found that plaques from EPC-infused animals were more abundantly infiltrated by CD3 cells compared with lesions from BM celltreated and control animals (Figure 4). No differences were observed in the number of macrophages infiltrating the plaques from the 3 groups (Figure 4).
| Discussion |
|---|
|
|
|---|
Analysis of BM cells and spleen cellderived EPCs demonstrated their in vitro ability to form colonies that stained positive for several mature EC markers such as Flk-1, Tie-2, vWF, and CD31, supporting their endothelial progenitor properties. When studied by FACS, we found that spleen cellderived EPCs were more abundantly expressing several markers that are attributed to endothelial progenitors such as Sca-1, Flk-1, and both. This is consistent with the ex vivo culture and positive selection of spleen cellderived mononuclear cells on fibronectin and EC medium for 5 days, similar to the conditions used by Werner et al.12 We used a 3-injection transfer protocol based on the realization that an intravenous administration of 106 cells per mouse is unlikely to simulate intracoronary administration because most of the cells are likely to be trapped within the spleen before reaching the plaque.12 Most of the clinical trials in patients with acute myocardial infarction and ischemic heart disease used a single dose of 107109 cells per injection.21 However, the nature of the administered cells is different in each of the studies as well as the mode of delivery, preventing an accurate comparative analysis. In mice, it is extremely difficult to achieve selective intracoronary injection as has been done in humans, and therefore, the systemic route was used. This represents a potential confounder because it is expected that systemic cell delivery would achieve a less efficient mode of access to the target tissues. Nevertheless, based on the weight ratio between mice and humans, it is unlikely that delivery of a total of 3 million cells represent a number that is exaggerated and thus proatherogenic.
Next, to ensure that transferred cells were homing to the lesions, we studied the plaques and found the DiI-labeled cells were present at a density of 2 to 3 cells per plaque in the BM cell and EPC-infused groups. In this respect, is noteworthy that this number may represent an underestimation because quenching of the DiI cannot be completely excluded.
Interestingly, transfer of BM cells and EPCs significantly increased atherosclerotic lesion size in the apoE KO mice. These results are apparently contrasting those obtained by Silvestre et al,23 which showed increased atherosclerosis but no change in plaque composition when BM cellendothelial progenitors were transferred from young to old apoE KO mice. However, unlike both of these studies, we used a protocol with a larger number of cells, partially accounting for the possible proatherogenic effect. To exclude a possible confounding effect of age of the donor mice, animals from which cells were harvested were always age matched with the recipients. We also used a group of spleen cellderived EPCs that were containing a larger number of endothelial progenitors compared with the BM cell group evident by a higher number of Ac-DiILDL/BS-1positive cells and a larger population of Sca-1enriched, Flk-1-positive, and Sca-1/Flk-1 double-positive cells. It is noteworthy that despite a higher "angiogenic efficiency" evident by a significantly larger number of endothelial progenitors in spleen cellderived EPCs compared with BM cells, both were similarly proatherogenic in vivo. This finding may appear surprising in view of the antiatherogenic effects attributed to endothelial progenitors and the protective role of EC in atherogenesis. We have thus reasoned that proinflammatory properties harbored by the transferred cells may contribute to enhanced atherogenesis. Indeed, we found that serum levels of IL-6 and MCP-1 were significantly increased in BM celltreated recipients, whereas serum IL-10 concentrations were reduced in the EPC-infused mice. Analysis of atherosclerotic aortas disclosed a significantly reduced expression of mRNA for IL-10 in the EPC and BM celltreated mice compared with the controls, suggesting that a proinflammatory state and perhaps partial skewing of T-helper 2 to T-helper 1 may occur in the context cell transfer. These 3 cytokines were shown in several studies2326 to influence atherosclerotic lesion size and could have thus partially mediated the proatherogenic effects.
An additional intriguing finding in this study was a destabilizing effect of EPC transfer. We found that plaques from apoE KO mice infused with spleen cellderived EPCs contained smaller fibrous caps and larger lipid cores. These results were also consistent with a larger number of CD3 cells within these lesions that may have contributed to plaque softening and vulnerability. In this context, 2 studies should be mentioned: the MAGIC Trial,19 in which recruitment of BM cells by granulocyte/macrophage colony-stimulating factor injections to humans was followed by increased rate of restenosis, an effect proposed to be caused by proinflammatory properties of the injected cells. Additionally, Yoon et al27 recently observed intramyocardial calcification in rats transferred with BM cells by the intracoronary route, suggesting a direct involvement of the injected cells in this process. It is also consistent with the findings of Saha et al,28 which showed that BM-derived cells form a significant number of smooth muscle cells that constitute the atherosclerotic plaque in experimental models.
In this study, the EPC-treated mice were also found to have an increased levels of anti-oxLDL antibodies suggestive of a heightened state of oxidative stress that may be related to the proinflammatory properties of the transferred cells. These anti-oxLDL antibodies and the decreased levels of IL-1029 in the EPC-treated mice could have contributed not only to the accelerated atherosclerotic process but also to plaque destabilization.
In conclusion, we found that transfer of spleen cellderived EPCs and BM cells accelerated atherosclerosis in apoE KO mice, whereas EPC transfer reduced markers associated with plaque stability. These findings call for caution in the dosing and scheduling protocols of cell therapy in future studies.
| Footnotes |
|---|
Received December 10, 2004; accepted April 11, 2005.
| References |
|---|
|
|
|---|
2. Libby P. Inflammation in atherosclerosis. Nature. 2002; 420: 868874.[CrossRef][Medline] [Order article via Infotrieve]
3. Rauscher FM, Goldschmidt-Clermont PJ, Davis BH, Wang T, Gregg D, Ramaswami P, Pippen AM, Annex BH, Dong C, Taylor DA. Aging, progenitor cell exhaustion, and atherosclerosis. Circulation. 2003; 108: 457463.
4. Moulton KS, Heller E, Konerding MA, Flynn E, Palinski W, Folkman J. Angiogenesis inhibitors endostatin or TNP-470 reduce intimal neovascularization and plaque growth in apolipoprotein E-deficient mice. Circulation. 1999; 99: 17261732.
5. Moulton KS, Vakili K, Zurakowski D, Soliman M, Butterfield C, Sylvin E, Lo KM, Gillies S, Javaherian K, Folkman J. Inhibition of plaque neovascularization reduces macrophage accumulation and progression of advanced atherosclerosis. Proc Natl Acad Sci U S A. 2003; 100: 47364741.
6. Celletti FL, Waugh JM, Amabile PG, Brendolan A, Hilfiker PR, Dake MD. Vascular endothelial growth factor enhances atherosclerotic plaque progression. Nat Med. 2001; 7: 425429.[CrossRef][Medline] [Order article via Infotrieve]
7. Asahara T, Murohara T, Sullivan A, Silver M, van der Zee R, Li T, Witzenbichler B, Schatteman G, Isner JM. Isolation of putative progenitor endothelial cells for angiogenesis. Science. 1997; 275: 964967.
8. Rafii S, Lyden D. Therapeutic stem and progenitor cell transplantation for organ vascularization and regeneration. Nat Med. 2003; 9: 702712.[CrossRef][Medline] [Order article via Infotrieve]
9. Takahashi T, Kalka C, Masuda H, Chen D, Silver M, Kearney M, Magner M, Isner JM, Asahara T. Ischemia- and cytokine-induced mobilization of bone marrow-derived endothelial progenitor cells for neovascularization. Nat Med. 1999; 5: 434438.[CrossRef][Medline] [Order article via Infotrieve]
10. Kawamoto A, Gwon HC, Iwaguro H, Yamaguchi JI, Uchida S, Masuda H, Silver M, Ma H, Kearney M, Isner JM, Asahara T. Therapeutic potential of ex vivo expanded endothelial progenitor cells for myocardial ischemia. Circulation. 2001; 103: 634637.
11. Kawamoto A, Tkebuchava T, Yamaguchi J, Nishimura H, Yoon YS, Milliken C, Uchida S, Masuo O, Iwaguro H, Ma H, Hanley A, Silver M, Kearney M, Losordo DW, Isner JM, Asahara T. Intramyocardial transplantation of autologous endothelial progenitor cells for therapeutic neovascularization of myocardial ischemia. Circulation. 2003; 107: 461468.
12. Werner N, Junk S, Laufs U, Link A, Walenta K, Bohm M, Nickenig G. Intravenous transfusion of endothelial progenitor cells reduces neointima formation after vascular injury. Circ Res. 2003; 93: e1724.
13. Hill JM, Zalos G, Halcox JP, Schenke WH, Waclawiw MA, Quyyumi AA, Finkel T. Circulating endothelial progenitor cells, vascular function, and cardiovascular risk. N Engl J Med. 2003; 348: 593600.
14. Vasa M, Fichtlscherer S, Aicher A, Adler K, Urbich C, Martin H, Zeiher AM, Dimmeler S. Number and migratory activity of circulating endothelial progenitor cells inversely correlate with risk factors for coronary artery disease. Circ Res. 2001; 89: E1E7.
15. George J, Herz I, Goldstein E, Abashidze S, Deutch V, Finkelstein A, Michowitz Y, Miller H, Keren G. Number and adhesive properties of circulating endothelial progenitor cells in patients with in-stent restenosis. Arterioscler Thromb Vasc Biol. 2003; 23: e57e60.
16. Shintani S, Murohara T, Ikeda H, Ueno T, Honma T, Katoh A, Sasaki K, Shimada T, Oike Y, Imaizumi T. Mobilization of endothelial progenitor cells in patients with acute myocardial infarction. Circulation. 2001; 103: 27762779.
17. George J, Goldstein E, Abashidze S, Deutsch V, Shmilovich H, Finkelstein A, Herz I, Miller H, Keren G. Circulating endothelial progenitor cells in patients with unstable angina: association with systemic inflammation. Eur Heart J. 2004; 25: 10031008.
18. Britten MB, Abolmaali ND, Assmus B, Lehmann R, Honold J, Schmitt J, Vogl TJ, Martin H, Schachinger V, Dimmeler S, Zeiher AM. Infarct remodeling after intracoronary progenitor cell treatment in patients with acute myocardial infarction (TOPCARE-AMI): mechanistic insights from serial contrast-enhanced magnetic resonance imaging. Circulation. 2003; 108: 22122218.
19. Kang HJ, Kim HS, Zhang SY, Zhang SY, Park KW, Cho HJ, Koo BK, Kim YJ, Soo Lee D, Sohn DW, Han KS, Oh BH, Lee MM, Park YB. Effects of intracoronary infusion of peripheral blood stem-cells mobilised with granulocyte-colony stimulating factor on left ventricular systolic function and restenosis after coronary stenting in myocardial infarction: the MAGIC cell randomised clinical trial. Lancet. 2004; 363: 751756.[CrossRef][Medline] [Order article via Infotrieve]
20. Wollert KC, Meyer GP, Lotz J, Ringes-Lichtenberg S, Lippolt P, Breidenbach C, Fichtner S, Korte T, Hornig B, Messinger D, Arseniev L, Hertenstein B, Ganser A, Drexler H. Intracoronary autologous bone-marrow cell transfer after myocardial infarction: the BOOST randomised controlled clinical trial. Lancet. 2004; 364: 141148.[CrossRef][Medline] [Order article via Infotrieve]
21. Wollert KC, Drexler H. Clinical applications of stem cells for the heart. Circ Res. 2005; 96: 151163.
22. George J, Afek A, Keren P, Herz I, Goldberg I, Haklai R, Kloog Y, Keren G. Functional inhibition of Ras by S-trans,trans-farnesyl thiosalicylic acid attenuates atherosclerosis in apolipoprotein E knockout mice. Circulation. 2002; 105: 24162422.
23. Silvestre JS, Gojova A, Brun V, Potteaux S, Esposito B, Duriez M, Clergue M, Le Ricousse-Roussanne S, Barateau V, Merval R, Groux H, Tobelem G, Levy B, Tedgui A, Mallat Z. Transplantation of bone marrow-derived mononuclear cells in ischemic apolipoprotein E-knockout mice accelerates atherosclerosis without altering plaque composition. Circulation. 2003; 108: 28392842.
24. Huber SA, Sakkinen P, Conze D, Hardin N, Tracy R. Interleukin-6 exacerbates early atherosclerosis in mice. Arterioscler Thromb Vasc Biol. 1999; 19: 23642367.
25. Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion formation in CCR2/ mice reveals a role for chemokines in the initiation of atherosclerosis. Nature. 1998; 394: 894897.[CrossRef][Medline] [Order article via Infotrieve]
26. Mallat Z, Besnard S, Duriez M, Deleuze V, Emmanuel F, Bureau MF, Soubrier F, Esposito B, Duez H, Fievet C, Staels B, Duverger N, Scherman D, Tedgui A. Protective role of interleukin-10 in atherosclerosis. Circ Res. 1999; 85: e17e24.
27. Yoon YS, Park JS, Tkebuchava T, Luedeman C, Losordo DW. Unexpected severe calcification after transplantation of bone marrow cells in acute myocardial infarction. Circulation. 2004; 109: 31543157.
28. Sata M, Saiura A, Kunisato A, Tojo A, Okada S, Tokuhisa T, Hirai H, Makuuchi M, Hirata Y, Nagai R. Hematopoietic stem cells differentiate into vascular cells that participate in the pathogenesis of atherosclerosis. Nat Med. 2002; 8: 403409.[CrossRef][Medline] [Order article via Infotrieve]
29. Heeschen C, Dimmeler S, Hamm CW, Fichtlscherer S, Boersma E, Simoons ML, Zeiher AM; CAPTURE Study Investigators. Serum level of the antiinflammatory cytokine interleukin-10 is an important prognostic determinant in patients with acute coronary syndromes. Circulation. 2003; 107: 21092114.
This article has been cited by other articles:
![]() |
Y. Ramot, M. Meiron, A. Toren, M. Steiner, and A. Nyska Safety and Biodistribution Profile of Placental-derived Mesenchymal Stromal Cells (PLX-PAD) Following Intramuscular Delivery Toxicol Pathol, August 1, 2009; 37(5): 606 - 616. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, D. A. Ingram, M. P. Murphy, M. R. Saadatzadeh, L. E. Mead, D. N. Prater, and J. Rehman Release of proinflammatory mediators and expression of proinflammatory adhesion molecules by endothelial progenitor cells Am J Physiol Heart Circ Physiol, May 1, 2009; 296(5): H1675 - H1682. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, H. Li, F. Addabbo, F. Zhang, E. Pelger, D. Patschan, H.-C. Park, M.-C. Kuo, J. Ni, G. Gobe, et al. Adoptive Transfer of Syngeneic Bone Marrow-Derived Cells in Mice with Obesity-Induced Diabetes: Selenoorganic Antioxidant Ebselen Restores Stem Cell Competence Am. J. Pathol., February 1, 2009; 174(2): 701 - 711. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Al Mheid and A. A. Quyyumi Cell Therapy in Peripheral Arterial Disease Angiology, January 1, 2009; 59(6): 705 - 716. [Abstract] [PDF] |
||||
![]() |
A. Schober and C. Weber Leptin and EPCs in Arterial Injury: Yes, We Can! Circ. Res., August 29, 2008; 103(5): 447 - 449. [Full Text] [PDF] |
||||
![]() |
A. Zampetaki, J. P. Kirton, and Q. Xu Vascular repair by endothelial progenitor cells Cardiovasc Res, June 1, 2008; 78(3): 413 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Kalka and I. Baumgartner Gene and stem cell therapy in peripheral arterial occlusive disease Vascular Medicine, May 1, 2008; 13(2): 157 - 172. [Abstract] [PDF] |
||||
![]() |
E. Rigamonti, C. Fontaine, B. Lefebvre, C. Duhem, P. Lefebvre, N. Marx, B. Staels, and G. Chinetti-Gbaguidi Induction of CXCR2 Receptor by Peroxisome Proliferator-Activated Receptor {gamma} in Human Macrophages Arterioscler Thromb Vasc Biol, May 1, 2008; 28(5): 932 - 939. [Abstract] [Full Text] [PDF] |
||||
![]() |
H-J Kang, Y-S Kim, B-K Koo, K W Park, H-Y Lee, D-W Sohn, B-H Oh, Y-B Park, and H-S Kim Effects of stem cell therapy with G-CSF on coronary artery after drug-eluting stent implantation in patients with acute myocardial infarction Heart, May 1, 2008; 94(5): 604 - 609. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zernecke, I. Bot, Y. Djalali-Talab, E. Shagdarsuren, K. Bidzhekov, S. Meiler, R. Krohn, A. Schober, M. Sperandio, O. Soehnlein, et al. Protective Role of CXC Receptor 4/CXC Ligand 12 Unveils the Importance of Neutrophils in Atherosclerosis Circ. Res., February 1, 2008; 102(2): 209 - 217. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zoll, V. Fontaine, P. Gourdy, V. Barateau, J. Vilar, A. Leroyer, I. Lopes-Kam, Z. Mallat, J.-F. Arnal, P. Henry, et al. Role of human smooth muscle cell progenitors in atherosclerotic plaque development and composition Cardiovasc Res, February 1, 2008; 77(3): 471 - 480. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kanayasu-Toyoda, A. Ishii-Watabe, T. Suzuki, T. Oshizawa, and T. Yamaguchi A New Role of Thrombopoietin Enhancing ex Vivo Expansion of Endothelial Precursor Cells Derived from AC133-positive Cells J. Biol. Chem., November 16, 2007; 282(46): 33507 - 33514. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gossl, L. O. Lerman, and A. Lerman Frontiers in Nephrology: Early Atherosclerosis A View Beyond the Lumen J. Am. Soc. Nephrol., November 1, 2007; 18(11): 2836 - 2842. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Hauer, G. H.M. van Puijvelde, N. Peterse, P. de Vos, V. van Weel, E. J.A. van Wanrooij, E. A.L. Biessen, P. H.A. Quax, A. G. Niethammer, R. A. Reisfeld, et al. Vaccination Against VEGFR2 Attenuates Initiation and Progression of Atherosclerosis Arterioscler Thromb Vasc Biol, September 1, 2007; 27(9): 2050 - 2057. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L.T. Ballard and J. M. Edelberg Stem Cells and the Regeneration of the Aging Cardiovascular System Circ. Res., April 27, 2007; 100(8): 1116 - 1127. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. P. Fadini, C. Agostini, and A. Avogaro Endothelial Progenitor Cells in Coronary Artery Disease J. Am. Coll. Cardiol., April 10, 2007; 49(14): 1585 - 1585. [Full Text] [PDF] |
||||
![]() |
M. Hristov, A. Zernecke, K. Bidzhekov, E. A. Liehn, E. Shagdarsuren, A. Ludwig, and C. Weber Importance of CXC Chemokine Receptor 2 in the Homing of Human Peripheral Blood Endothelial Progenitor Cells to Sites of Arterial Injury Circ. Res., March 2, 2007; 100(4): 590 - 597. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Avogaro and G. P. Fadini The Janus Face of Nicotinic Angiogenesis J. Am. Coll. Cardiol., December 19, 2006; 48(12): 2561 - 2563. [Full Text] [PDF] |
||||
![]() |
K. Miyamoto, K. Nishigami, N. Nagaya, K. Akutsu, M. Chiku, M. Kamei, T. Soma, S. Miyata, M. Higashi, R. Tanaka, et al. Unblinded Pilot Study of Autologous Transplantation of Bone Marrow Mononuclear Cells in Patients With Thromboangiitis Obliterans Circulation, December 12, 2006; 114(24): 2679 - 2684. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Widimsky, M. Penicka, O. Lang, T. Kozak, Z. Motovska, R. Jirmar, and M. Aschermann Intracoronary transplantation of bone marrow stem cells: background, techniques, and limitations Eur. Heart J. Suppl., December 1, 2006; 8(suppl_H): H16 - H22. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Leor and M. Marber Endothelial Progenitors: A New Tower of Babel? J. Am. Coll. Cardiol., October 17, 2006; 48(8): 1588 - 1590. [Full Text] [PDF] |
||||
![]() |
S. Wassmann, N. Werner, T. Czech, and G. Nickenig Improvement of Endothelial Function by Systemic Transfusion of Vascular Progenitor Cells Circ. Res., October 13, 2006; 99(8): E74 - E83. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sata Role of Circulating Vascular Progenitors in Angiogenesis, Vascular Healing, and Pulmonary Hypertension: Lessons From Animal Models Arterioscler Thromb Vasc Biol, May 1, 2006; 26(5): 1008 - 1014. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Werner and G. Nickenig Influence of Cardiovascular Risk Factors on Endothelial Progenitor Cells: Limitations for Therapy? Arterioscler Thromb Vasc Biol, February 1, 2006; 26(2): 257 - 266. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |