| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Biology |
in Immune Deficiency
From Atherosclerosis Research Center (P.C.D., H.L., K.-Y.C., P.K.S., B.C.), Division of Cardiology, Department of Medicine, Cedars-Sinai Medical Center and David Geffen School of Medicine at UCLA and the Department of Pathology (M.C.F.), David Geffen School of Medicine at UCLA, Los Angeles, Calif; and Experimental Cardiovascular Research (G.N.F., JN.), Department of Medicine, Lund University, University Hospital MAS, Malmö, Sweden.
Correspondence to Paul C. Dimayuga, PhD, Cedars-Sinai Medical Center, Davis 1064, 8700 Beverly Blvd, Los Angeles, CA 90048. E-mail DimayugaP{at}cshs.org
| Abstract |
|---|
|
|
|---|
in the response to injury in normal and immune-deficient Rag-1KO mice.
Methods and Results Carotid arterial injury was induced in wild-type (WT), Rag-1KO mice, and Rag-1KO mice reconstituted with T cell-enriched splenocytes. The exuberant intimal thickening in Rag-1KO mice compared with WT mice 21 days after injury was reduced by T cell transfer (P<0.01). Exogenous IFN-
starting on the day of injury inhibited intimal thickening in Rag-1KO mice. However, antibody neutralization of endogenous IFN-
in Rag-1KO mice starting 7 days after injury decreased intimal thickening, indicating that late presence of IFN-
promoted intimal thickening in Rag-1KO mice. Results further suggest that the effect of late IFN-
in Rag-1KO mice is mediated in part by increased IRF-1 and iNOS expression, coupled with low SOCS1 expression.
Conclusion T cells inhibit intimal thickening in the early stages of the response to injury through basal IFN-
secretion. In the Rag-1KO mice, late IFN-
expression promotes intimal thickening. These findings add novel insight to conditions of immune deficiency that affect intimal thickening.
Immune deficiency results in exuberant intimal thickening after arterial injury. We investigated the modulatory role of T cells and IFN-
in the response to injury in normal and immune-deficient Rag-1KO mice. The study adds novel insight in defining factors that contribute to vascular disease in conditions of immune deficiency.
Key Words: IFN-
immune deficiency intimal thickening lymphocytes Rag-1KO mice
| Introduction |
|---|
|
|
|---|
.4 However, CD4+ T cell transfer increased atherosclerosis in compound apolipoprotein E-deficient/immune-deficient SCID mice,5 and IFN-
augmented native atherosclerosis6 and graft arteriosclerosis.7
The effect of IFN-
on arterial response to injury in conditions of immune-deficiency is unknown. There has been speculation that increased serum IFN-
may contribute to accelerated coronary artery disease in HIV-positive patients.8,9 In vitro studies have shown that IFN-
can promote smooth muscle cell proliferation,10 likely through IFN regulatory factor-1 (IRF-1) regulation of inducible nitric oxide synthase (iNOS) expression.11 These findings suggest a complicated balance in the modulatory role of T cells in the vascular response to injury, and a dichotomy of the effects of IFN-
.
We have previously reported that B cells inhibit arterial injury-induced intimal thickening2 in immune-deficient Rag-1KO mice;12 yet, it is not known if T cell mediated inhibition of intimal thickening is independent of B cell interaction. In the current study, we continued the investigation by testing the role of T cell-secreted cytokine IFN-
in intimal thickening after arterial injury by transferring T cells into Rag-1KO mice. Administration of recombinant IFN-
to Rag-1KO mice was used to assess the direct effects of the cytokine on intimal thickening. We also investigated the mechanisms of IFN-
dysregulation in the exuberant intimal thickening in immune deficient mice after arterial injury.
| Methods |
|---|
|
|
|---|
T Cell Reconstitution
Splenocytes from age-matched wild-type (WT) mice were isolated as previously described.2 Aliquots of the cells were cultured in RPMI/10% FBS media for 18 hours to characterize basal IFN-
expression. T cell enrichment was performed by negatively selecting splenocytes using paramagnetic beads coated with anti-mouse B220 antibody and a magnetic particle concentrator (Dynal) to deplete B cells and then injected via the tail vein of Rag-1KO mice (2 to 4x107 cells per mouse) 48 hours before injury. Cells were characterized with anti-mouse CD4 and CD8 antibodies.
Splenocyte Homing
Splenocyte homing in recipient mice was determined using the ß-gal transgenic ROSA26 mice (Jackson Laboratory) as donors. X-gal (Sigma) staining13 was performed on arteries and spleens of recipient mice 6 hours and 1, 3, and 7 days after injury. Polymerase chain reaction (PCR) was performed on splenic DNA 21 days after injury, with the following primers: AGCCGGAGATACCCAGTCCA mouse Rag-1 forward primer, position 461; CAAGACTCCTTTACCACCAC mouse Rag-1 reverse primer, position 1890;14 and AGGTGAGATGACAGGAGATC pgk-neo reverse primer, position 1185 (GenBank accession: AF335419). The WT Rag-1 gene yields a PCR product of 1429 bp long, whereas the Rag-1KO with the pgk-neo insert yields a PCR product of
963 bp.12 Presence of both bands would indicate a mixture of the 2 genotypes.
IFN-
Treatment and Neutralization
Recombinant mouse IFN-
(rIFN-
) (GIBCO/BRL) was administered to Rag-1KO mice at a dose of 100 µg/kg per day intravenous starting on the day of injury and every other day for the first week (short-term) or until euthanasia (long term). An additional group of WT mice was treated with the same dose of rIFN-
starting 7 days after injury. Monoclonal IFN-
neutralizing antibody (Calbiochem) was administered to injured Rag-1KO mice beginning at 7 days after injury (500 µg), and every 3 days (250 µg) for a total of 4 injections.15 A group of WT mice were treated with IFN-
mAb before injury (500 µg) and once more 4 days after injury (250 µg). Control mice received nonimmune IgG.
Morphometric Analysis and Immunostaining
Frozen sections 6- to 8-µm thick were collected from 21-day injured carotid arteries, as previously described.2 Immunostaining was performed using the following antibodies: SM
-actin (SIGMA), MOMA-2 (BMA Biomedicals, Switzerland), mouse CD4 (BD Pharmingen), PCNA, IRF-1, and iNOS (Santa Cruz).
Western Blot
Carotid arteries were harvested from Rag-1KO mice 3 days after injury and snap frozen. Nuclear proteins were extracted as previously described.16 Equal amounts of protein were subjected to Western blot analysis with PCNA antibody. Loading was assessed by Ponceau S stain.
Enzyme-Linked Immunosorbent Assay
Serum immunoglobulin levels were determined using an enzyme-linked immunosorbent assay kit (Southern Biotechnology Associates)2 with HRP-conjugated IgM and IgG (Pierce) antibodies, and ABTS as substrate. Serum IFN-
was measured using a kit (Biosource International, Camarillo, Calif), following manufacturers recommendations with modifications.
Reverse-Transcription PCR
Carotid artery and splenic RNA were extracted using TRIzol (Invitrogen). Arteries were dissected under microscopy to remove connective tissue, rinsed in saline, and snap-frozen. Four to 5 carotid arteries were pooled for each time point. Two µg total RNA was subjected to reverse-transcription using oligo-dT or random primers. Equal aliquots were then subjected to PCR using primer pairs for the following: ß-actin for 29 cycles; T cell cytokines IFN-
, interleukin (IL)-4,17 IL-10,18 IFN-
Rß,19 and suppressor of cytokine Signaling (SOCS1)20 for 35 cycles; the T cell marker CD3
,21 IRF-1,22 and iNOS (forward primer: ATGGCTTGCCCCTGGAAG; reverse primer: ATGCTCCATGGTCACCTCCA) for 36 cycles for arteries. Cyclings for the spleens were as follows: IFN-
and ß-actin for 28 cycles; IL-4 and IL-10 for 35 cycles, and CD3
for 36 cycles. PCR products were visualized on 1.5% agarose gels stained with ethidium bromide and captured digitally for densitometric analysis. Results were expressed as the ratio against ß-actin.
Statistics
Data are presented as mean±SD deviation. Group comparisons were performed with ANOVA followed by Neuman Keuls test, unless noted otherwise.
| Results |
|---|
|
|
|---|
mRNA expression in arteries was detected before and at early time points after injury, with a slight increase at day 21 (Figure 1, top panel). IL-10 and IL-4 were minimal at all time points (second and third panels). Presence of CD3
mRNA, a T cell marker, was minimal in all time points tested (fourth panel). ß-actin mRNA served as reference (bottom panel). Macrophage immunoreactivity was minimal 3 and 21 days after injury. CD4 staining was not detectable in all time points (not shown).
|
Temporal Profile of Serum IFN-
After Injury
Basal serum IFN-
was detected before injury in the WT mice, which was reduced 1 day after cuff placement (Table 1). Rag-1KO mice had very low levels of IFN-
before injury (P<0.05 versus WT mice) and remained low at the day 1 time point. Three days after injury, serum IFN-
started to increase in both the WT and Rag-1KO mice. Serum IFN-
levels in the Rag-1KO mice 21 days after injury was increased compared with pre-injury (P<0.05) and comparable with WT levels.
|
Cell Proliferation and Intimal Thickening
Proliferating cell nuclear antigenpositive medial cells in the Rag-1KO mice were significantly increased compared with WT mice 3 days after injury (25.3±3.9, n=4 versus 10.3±3.3 cells/section, n=5; P<0.01). Twenty-one days after injury, intimal thickening was markedly increased in the Rag-1KO compared with WT mice (P<0.001; Figure 1C and 1B; Table 2). Intima-to-media ratio (I/M) was significantly increased in the Rag-1KO compared with WT mice (P<0.05). External elastic lamina area (EEL) was similar in both groups (not shown).
|
T Cell Transfer in Rag-1KO Mice
Splenocytes isolated from WT donor mice showed basal IFN-
mRNA expression (Figure 1E) and IFN-
in the condition media (n=3). The cell enrichment procedure yielded >90% T cell purity, 73.6±2.4% were CD4+ and 15.9±1.3% were CD8+ (n=4). Transfer of T cell-enriched splenocytes from WT mice to Rag-1KO mice (Rag-1KO+T) variably increased basal serum IFN-
before injury compared with Rag-1KO mice (259±317 pg/mL, n=9 versus 54±45 pg/mL, respectively; P=0.1, t test). Proliferating medial cells were reduced significantly in the Rag-1KO+T group compared with Rag-1KO mice 3 days after injury (16.0±3.0, n=3 versus 25.3±3.9 cells/section, n=5; P<0.05). The transfer resulted in significantly reduced intimal thickening (P<0.01; Figure 1C and 1D; Table 2), and reduced I/M ratio (P<0.01; Table 2) compared with Rag-1KO mice. EEL was similar to WT and Rag-1KO. The intima consisted of predominantly smooth muscle
-actin positive cells in all groups. Macrophage immunoreactivity was minimal in both Rag-1KO and Rag-1KO+T groups 3 days and 21 days after injury (not shown), similar to a previous report.2 Minimal IgM and IgG were observed in the Rag-1KO+T group at euthanasia (not shown), indicating minimal presence of contaminating B cells.
Splenocyte homing was assessed by ß-gal activity from ROSA26 donor cells, which was not detected in the injured arterial wall of recipient Rag-1KO mice at any time point, but was detected in the spleen (not shown). PCR analysis of splenic DNA (please see http://atvb.ahajournals.org) detected the presence of the intact Rag-1 gene in WT mice and the pgk-neo insertion in Rag-1KO mice. Both bands were detected in the Rag-1KO+T, indicating the presence of both WT and Rag-1KO DNA.
Splenic Cytokine mRNA
Splenic IFN-
expression was similar between WT, Rag-1KO, and Rag-1KO+T mice as verified by reverse-transcription PCR (Figure 2A, top panel). IL-4 expression (second panel) was variable in all groups. IL-10 expression (third panel) was significantly higher in the WT compared with Rag-1KO+T and Rag-1KO mice (Figure 2B). Densitometric measurements were standardized against ß-actin (Figure 2A, bottom panel and Figure 2B; please also see http://atvb.ahajournals.org).
|
IFN-
Treatment and Neutralization
Administration of rIFN-
to Rag-1KO mice for the 21-day injury period (rIFN-
lt; n=6) significantly reduced intimal thickening compared with untreated Rag-1KO mice (P<0.001; Figure 2C). Medial area and EEL were similar to Rag-1KO mice. I/M ratio was significantly reduced by rIFN-
treatment (0.13±0.04 versus 0.53±0.21; P<0.001). Serum IFN-
level at day 3 was 217±9 pg/mL (n=2) and at day 21 was 189±24 pg/mL (n=4). Macrophage immunoreactivity was minimal 3 days and 21 days after injury. Splenic mRNA expression by rIFN-
treated Rag-1KO mice was similar to untreated Rag-1KO mice (not shown). Treatment with rIFN-
only for the first week (rIFN-
st; n=7) also resulted in reduced intimal thickening (P<0.05, Figure 2C) and I/M ratio (0.37±0.09; P<0.05) compared with untreated Rag-1KO mice. rIFN-
treatment reduced medial cell proliferation (11.9±7.5 cells/section, n=3; P<0.01) and nuclear PCNA expression (please see http://atvb.ahajournals.org) compared with untreated Rag-1KO mice 3 days after injury. Administration of rIFN-
in WT mice starting 7 days after injury did not increase intimal thickening (not shown).
IFN-
neutralizing antibody was administered to Rag-1KO mice starting 7 days after injury, based on the late increase in serum IFN-
levels. Intimal area in Rag-1KO mice treated IFN-
antibody was significantly decreased compared with mice that received nonimmune IgG (P<0.05, Figure 2D). Medial area and EEL were similar between the 2 groups. Neutralization of IFN-
in WT mice during the first week of injury did not affect intimal thickening (not shown).
Arterial IRF-1 and iNOS Expression
To determine the pathway of IFN-
mediated augmentation of intimal thickening in Rag-1KO mice, mRNA expression of IRF-1 and iNOS in the injured arteries were assessed. Seven days after injury, IRF-1 and iNOS expression were higher in Rag-1KO mice compared with WT mice, which persisted until 21 days (Figure 3A). WT mice also had less iNOS immunostaining compared with Rag-1KO mice (not shown). Because IFN-
receptor ß mediates IFN-
signaling,23 its expression was assessed. IFN
Rß mRNA expression was higher in the Rag-1KO compared with WT mice (Figure 3A). To further investigate the effect of IFN-
neutralization in Rag-1KO mice, immunostaining for IRF-1 was performed. Rag-1KO mice treated with IFN-
neutralizing antibody (Figure 3C) had reduced IRF-1 stain compared with Rag-1KO mice treated with control IgG 21 days after injury (Figure 3B). Reduced IRF-1 staining was associated with significantly reduced iNOS stain area (P<0.05) in the Rag-1KO mice treated with IFN-
neutralizing antibody compared with Rag-1KO mice treated with control IgG (2.6±1.3% versus 10.5±2.7%; n
3; Figure 3E and 3D, respectively).
|
Arterial SOCS1 Expression
SOCS1 modulates IFN-
signaling.24 We therefore determined SOCS1 expression in WT and Rag-1KO mice. One day after arterial cuffing, SOCS1 expression was less in Rag-1KO mice compared with WT mice (Figure 4A). The difference in expression levels persisted through 7 and 21 days after injury (Figure 4B). To determine whether the effect of rIFN-
in Rag-1KO mice was mediated through a similar pathway, IRF-1, iNOS, and SOCS1 expression were assessed at day 3. Rag-1KO mice treated with rIFN-
had reduced iNOS expression and increased SOCS1 expression compared with Rag-1KO mice treated with saline. IRF-1 expression was similar between the 2 groups (Figure 4C).
|
| Discussion |
|---|
|
|
|---|
augmented graft arteriosclerosis.7 Serum IFN-
levels are elevated in HIV-infected patients and are postulated to contribute to accelerated coronary artery disease.8,9 To define the mechanism(s) involved in the exuberant intimal thickening associated with immune deficiency, we investigated the role of T cells and IFN-
in the response to arterial injury.
We provide evidence that during early stages of arterial repair, T cell secreted IFN-
inhibits intimal thickening. In contrast, delayed IFN-
expression after injury in Rag-1KO mice contributes to the exuberant intimal thickening. The effects of T cells do not appear to be caused by a predominantly localized immune response. CD4+ T cells were not detected in the arteries of WT mice at any time point checked. The minimal presence of T cell marker CD3
mRNA, observed in the uninjured arteries, did not increase after injury. Low IFN-
expression detected in the uninjured arteries did not increase until the 21-day time point, and IL-4 and IL-10 were minimally detectable. Transferred T cells from the ROSA26 mice could not be detected in the arteries of the injured Rag-1KO recipients. However, low CD3
and IFN-
mRNA detected in the arterial wall before injury suggest the combination of local and systemic regulation of the early response to injury. A recent study using arterial injury in rats supports the notion of some degree of localized T cell immune response.25 Although minimally present before injury, the lack of clear evidence of increased T cell localization to the site after injury in the mouse has been observed by others as well.3 This lack of medial infiltration is attributed to the immunoprivileged state of the media of elastic arteries, likely caused by the lack of vasa vasorum in mice.26
Basal serum IFN-
in WT mice was shown to regulate endothelial MHC class I expression.27 Rag-1KO mice, lacking functional T and B cells, have only minimal levels of basal IFN-
. Reconstitution of Rag-1KO mice with T cells alone resulted in increased basal IFN-
levels and reduction of intimal thickening. It has been reported that lack of T cells was associated with increased intimal thickening,1 but it was unclear whether T cells function independently of B cells. Our results suggest that T cell secreted IFN-
played a significant role in inhibiting intimal thickening, independent of B cells. Because Rag-1KO mice had significantly increased intimal thickening compared with WT and Rag-1KO+T, these data suggest that IFN-
presence during early stages of repair after injury inhibits intimal thickening.
ß-gal activity and genotyping provided evidence that the transferred cells homed-in to the recipients spleens. IFN-
mRNA was detected in the WT, Rag-1KO and Rag-1KO+T mice 21 days after injury. The increased splenic IFN-
mRNA in the Rag-1KO mice paralleled the IFN-
in the serum. IL-4 mRNA expression was low in spleens of all 3 groups of mice and IL-10 was significantly increased in WT mice.
Treatment of Rag-1KO mice with IFN-
starting on the day of injury significantly inhibited intimal thickening. Reduced nuclear PCNA expression 3 days after injury in the arteries of treated mice suggests that control of proliferation is one of the mechanisms for the early effects of IFN-
. In a previous study, a treatment duration of as short as 4 days was also effective in rats,4 suggesting that early administration of IFN-
is crucial in controlling intimal thickening. Our results with the short term IFN-
treatment concur with that study. One pathway involved at the early stage of injury is likely mediated by a known regulator of cytokine expression, SOCS1. SOCS1 is tightly regulated by the STAT family of transcription factors28 and is intricately involved in modulating IFN-
response, as evidenced by the exaggerated IFN-
signaling in socs1/ mice.24 In our study, arterial SOCS1 expression was less in Rag-1KO mice compared with WT. The difference in expression was apparent as early as 1 day after injury, suggesting that the presence of IFN-
early in the injury response is key to SOCS1 expression to regulate IFN-
signaling. Treatment of Rag-1KO mice with rIFN-
increased SOCS1 expression 3 days after injury, further supporting a regulatory role for early presence of IFN-
in the response to injury.
Treatment of WT mice with rIFN-
starting at 7 days after injury did not augment intimal thickening, further supporting the notion that presence of endogenous IFN-
at the start of injury in WT mice was sufficient to limit intimal thickening. Transplant arteriosclerosis in immune deficient mice was increased by IFN-
treatment initiated 7 days after surgery.7 Variable effects of IFN-
on cultured smooth muscle cell in vitro have also been reported,10,29 suggesting that IFN-
has phenotype-dependent effects on smooth muscle cells. Neutralization of IFN-
in WT mice in our study did not affect intimal thickening. We have previously shown that B cells alone inhibit intimal thickening. Although IFN-
may be blocked by antibody treatment, as was shown in Rag-1KO mice, B cells in WT mice likely were sufficient to control exuberant intimal thickening.
In the late stage after injury, at 21 days, the IFN-
levels were comparable in WT and Rag-1KO mice. The cells that secrete IFN-
in Rag-1KO mice in the absence of functional T cells are likely NK cells and macrophages.30 As the Rag-1KO mice have exuberant intimal thickening after injury, these data suggest that IFN-
, when present predominantly in the late stages, promotes intimal thickening. Cell responsiveness to IFN-
is dependent on the presence of both subunits of the IFN-
receptor. IFN
R
, the ligand binding unit, is ubiquitously expressed whereas IFN
Rß is tightly regulated and mediates signaling.23 We show that IFN
Rß mRNA expression in injured arteries of Rag-1KO mice remained elevated compared with WT mice, suggesting increased propensity for IFN-
signaling. Ligand-induced downregulation of IFN
Rß expression has been previously reported.23 The role of IFN-
in the exuberant intimal thickening after arterial injury in Rag-1KO mice was further defined by the neutralizing IFN-
antibody treatment of Rag-1KO mice, beginning 7 days after injury. The treatment significantly decreased intimal thickening compared with control Rag-1KO mice. Neutralization of IFN-
in an allogeneic graft model reported recently also resulted in reduced intimal thickening.31 These data support the notion that IFN-
present only during the later stage of arterial repair promotes intimal thickening in a condition of combined immune deficiency.
The effect of the late increase of IFN-
on intimal thickening appears to be linked to increased iNOS expression, consistent with a report showing significant increase in iNOS expression in Rag-1KO mice.30 IRF-1 is a known transcriptional activator of iNOS.11 We have reported a pro-proliferative role for iNOS in cuff-injury induced intimal formation using iNOS KO mice.16,32,33 The signaling pathway for iNOS mediated cell proliferation involves redox-responsive gene reducing factor-1 (Ref-1) and thioredoxin control of AP-1 activation.32 Our study shows that late increase in IFN-
in Rag-1KO mice results in increased IRF-1 and iNOS expression. This pathway was partially interrupted by the neutralizing antibody to IFN-
. A recent report similarly showed NOS dysfunction induced by IFN-
resulted in increased intimal thickening.34 Interestingly, IRF-1 and iNOS expression are upregulated in socs1/ mice caused by exaggerated IFN-
signaling.28
The inhibitory effect of B cells on intimal thickening that we previously reported2 likely works through a different mechanism. IFN-
is predominantly produced by T cells and NK cells and not B cells. Experiments are underway to test the role of B cells and immunoglobulins. The current study did not identify the type of T cells responsible for limiting intimal thickening. A previous report suggests that CD4+ T cells are pro-inflammatory5 and may therefore contribute to tissue damage. In addition, other T cell subsets, such as NKT and T regs may play a role in the response to injury. We are currently investigating the role of specific T cell subsets in arterial injury.
In summary, the present report suggests that T cell-mediated inhibition of intimal thickening is independent of B cells. Thus, the studies suggest that host response to vascular injury occur at various levels with redundancy of roles; in this case limiting intimal thickening. It is also possible that various immune mechanisms cooperate to control the process. The effect of T cells appears to be mediated by basal IFN-
secretion and SOCS1. The late increase in IFN-
in Rag-1KO mice significantly contributes to intimal thickening, mediated in part by increased iNOS expression through IRF-1. The exaggerated IFN-
response is caused in part by increased IFN-
Rß and reduced SOCS1 expression in injured arteries of Rag-1KO mice. These findings add novel insight in understanding the role of IFN-
in vascular disease.35
| Acknowledgments |
|---|
Received February 3, 2005; accepted September 28, 2005.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Strom, M. Wigren, A. Hultgardh-Nilsson, A. Saxena, M. F. Gomez, S. Cardell, G. N. Fredrikson, and J. Nilsson Involvement of the CD1d Natural Killer T Cell Pathway in Neointima Formation After Vascular Injury Circ. Res., October 12, 2007; 101(8): e83 - e89. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tellides and J. S. Pober Interferon-{gamma} Axis in Graft Arteriosclerosis Circ. Res., March 16, 2007; 100(5): 622 - 632. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2005 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |