Published online before print September 1, 2005, doi: 10.1161/01.ATV.0000184758.07257.88
© 2005 American Heart Association, Inc.
Atherosclerosis and Lipoproteins |
Trichostatin A Exacerbates Atherosclerosis in Low Density Lipoprotein Receptor–Deficient Mice
From the Departments of Veterinary Pathology (J-H.C., D.Y.K.) and Laboratory Animal Medicine (M.W.B.), College of Veterinary Medicine and School of Agricultural Biotechnology, Seoul National University, Seoul; the Laboratory of Cardiovascular Genomics (J-H.C., G.T.O.), Division of Molecular Life Science, Ewha Womans University, Seoul; the Laboratory of Animal Model Evaluation (K-H.N., J.K.), Korea Research Institute of Bioscience and Biotechnology, Dae-jeon; the Department of Internal Medicine (J.E.P.), College of Medicine, Sungkyunkwan University, Suwon; the Department of Biomedical Sciences (H.Y.P.), Division of Genetic Diseases, National Institute of Health, Seoul; the Department of Biotechnology (H.J.K.), Yonsei University, Seoul; and Bioanalysis and Biotransformation Research Center (O.-S.K), Korea Institute of Science and Technology, Seoul, Korea.
Correspondence to Dr Goo Taeg Oh, Laboratory of Cardiovascular Genomics, Division of Molecular Life Sciences, Ewha Womans University, Seoul, Republic of Korea, 120-750. E-mail gootaeg{at}ewha.ac.kr; or Dr Dae-Yong Kim, Department of Veterinary Pathology, College of Veterinary Medicine, Seoul National University, Seoul, Republic of Korea, 151-742. E-mail daeyong@snu.ac.kr
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Objective— Histone acetylation has been shown to be involved in expression of a restricted set of cellular genes including various proinflammatory molecules. We aimed to investigate the relationship between histone acetylation and atherosclerosis.
Methods and Results— In low-density lipoprotein (LDL) receptor-deficient (Ldlr–/–) mice fed an atherogenic diet for 4 or 8 weeks, trichostatin A (TSA), a specific histone deacetylase inhibitor, exacerbated atherosclerosis without alteration on plasma lipid profiles. When we assayed the effects of TSA on expressions of oxidized LDL (oxLDL) receptors on RAW264.7 macrophage, we found that TSA increased CD36 mRNA and protein, as well as cell surface expression of CD36. TSA also increased acetylation at the CD36 promoter region. The uptake of 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine percholate (Dil)-labeled oxLDL was enhanced in RAW264.7 macrophage by TSA. Furthermore, TSA treatment increased CD36 mRNA expression in aorta, and SRA, tumor necrosis factor (TNF)-
, and vascular cell adhesion molecule-1 (VCAM-1) were also elevated, whereas IL-6 and IL-1ß expressions were decreased.
Conclusions— Our findings suggest that histone acetylation could play some role in atherogenesis by modulating expressions of oxLDL receptor and some proatherogenic genes. Therefore, our results indicate that increased histone acetylation may affect the progress of atherosclerosis.
We investigated the effect of trichostatin A, a specific histone deacetylase inhibitor, on atherosclerosis of LDL receptor–deficient mice. TSA significantly increased the formation of fatty streak lesion and macrophage infiltration possibly by enhancing the expression of CD36 and other proatherogenic molecules, suggesting the role of histone acetylation in atherogenesis.
Key Words: atherosclerosis • histone acetylatione • scavenger receptors • trichostatin A
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Reversible acetylation of histones has been shown to be a crucial event in gene expression. Histone acetylation is controlled by the enzymes histone acetyltransferase and histone deacetylase (HDAC).1,2 Histone acetyltransferase AT-dependent acetylation of particular lysines is associated with an "open" chromatin conformation and increased accessibility of transcription factors to their binding sites, resulting in increased transcription of the target genes. In contrast, de-acetylation of these lysines by HDACs is associated with a more condensed chromatin structure and gene silencing.3 Specific inhibitors of HDAC, such as trichostatin A (TSA) and trapoxin A, have been used to study the function of histone acetylation. These inhibitors have been shown to alter the expression of &2% of cellular genes, including genes controlling the cell cycle and apoptosis, such as p21waf1, c-myc, plasminogen activator, and p53.4–7
Atherosclerosis is a complex chronic inflammatory disease involving elastic and muscular arteries.8 Chronic inflammation of the vascular wall includes the uncontrolled proliferation of vascular myointimal cells, the production of foam cells, and progressive vascular occlusion. These inflammatory responses are thought to be caused by endothelial dysfunction mediated by elevated or modified plasma low-density lipoprotein (LDL) cholesterol and elevated plasma homocysteine concentrations, as well as by infectious microorganisms.9 Recently, HDAC inhibitors have been shown to exhibit antiinflammatory properties. For example, several HDAC inhibitors were demonstrated to reduce the expression of inducible nitric oxide synthase, and IL-8.10,11 In addition, suberoylanilide hydroxamic acid, a specific HDAC inhibitor, was shown to reduce serum concentrations of TNF-, IL-1ß, IL-6, and interferon-
in lipopolysaccharide-treated mice, as well as to decrease production of these cytokines by lipopolysaccharide-stimulated human peripheral blood mononuclear cells.12
Macrophage scavenger receptors, including CD36 and scavenger receptor A (SRA), play an important role in atherogenesis by contributing to the formation of macrophage foam cells.13 These cell surface receptors recognize oxidized LDL (oxLDL) and mediate the accumulation of cholesterol.14,15 Genetic disruptions of these receptor genes were found to decrease fatty streak lesions in mouse models, indicating that these receptors contribute to lesion development.16,17 Moreover, the specific HDAC inhibitor TSA was observed to decrease the expression of SRA in P388D1 macrophage by reducing the expression of the Ets domain transcription factor PU.1, suggesting that HDAC inhibition may prevent the development of atherosclerosis.18
To determine the relationship between histone acetylation and atherosclerosis, we injected TSA into LDL receptor-deficient (Ldlr–/–) mice fed an atherogenic diet. We also tested the effect of TSA on the expression of scavenger receptors using the RAW264.7 mouse monocyte/macrophage cells.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Animal Protocol
Fifty-one male Ldlr–/– mice on a C57BL/6 background19 (Jackson Laboratory, Bar Harbor, Me) were fed an atherogenic diet containing 1.25% cholesterol (Oriental Yeast, Japan) and divided into 6 groups. Three groups of 8 mice each were treated for 4 weeks with 1 mg TSA/kg body weight (high dose), 0.5 mg TSA/kg body weight (low dose), or 2% dimethyl sulfoxide (DMSO) in saline (vehicle control), whereas 3 groups of 9 mice each were treated with the same TSA doses, but for 8 weeks. TSA was injected intraperitoneally every other day. The doses of TSA used in this study were based on the doses of TSA showing significant inhibition of tumor progression in mice.20,21 Plasma lipid levels, the extents of fatty streak lesions in the aortic sinus, were measured as described previously.22 Aortic HDAC activity of the total lysate of a pool of 3 aortas from each group was measured using an HDAC activity assay kit (BIOMOL Research Laboratory) according to the manufacturer’s protocol. All animal study protocols were approved by the animal care committee of Seoul National University.
Cell Culture and TSA Treatment
The RAW264.7 mouse monocyte/macrophage cell line was maintained in Dulbecco’s Modified Eagle Medium containing 10% fetal bovine serum. Cells were incubated with 0, 1, 5, and 10 ng/mL TSA for 8 or 12 hours; these TSA concentrations were determined by their effectiveness in inhibiting HDAC with no cytotoxicity. We could not determine whether these TSA concentrations could be correlated with plasma TSA levels, because there is no sensitive method for assaying TSA in biological matrices. However, using high-performance liquid chromatography, we found that after injection into mice, TSA is rapidly metabolized to two major metabolites (Figures I through III, available online at http://atvb.ahajournals.org), indicating that the effective TSA concentration that inhibits HDAC activity may be different in vivo and in vitro. Throughout the experimental period, we observed no clinical sign or notable lesion in TSA-treated mice, indicating that TSA had no obvious toxicity at the doses used.
Immunostaining
Avidin-Biotin Complex method was applied to detect HDAC 1, 4, 5, and macrophage marker (MOMA-2) using commercially available anti-mouse HDAC 1, 4, 5 (Upstate Biotechnology) and MOMA-2 (Serotec) antibodies at 1:200 dilutions as described previously.22 To stain the acetylated histone H4, the sections were incubated with rabbit polyclonal anti-mouse acetylated histone H4 antibody (Upstate Biotechnology) at 1:200 dilution. After incubation with biotinylated anti-rabbit IgG antibody as a secondary antibody, fluorescein isothiocyanate (FITC) or Texas Red conjugated Avidin D was incubated to visualize the antigen. Negative control tissues were prepared in the same manner described, except for the omission of primary antibodies and the substitution of control serum. The quantitative analysis of the average fluorescent intensity was determined with Zeiss LSM 510 software.
Flow Cytometry
After labeling with FITC-conjugated antibody directed against CD36 (Santa Cruz Biotechnology), or SRA (Serotec), the surface expressions of these molecules were analyzed by FACSCalibur flow cytometer (Becton-Dickinson).
Quantitative Real-Time Reverse-Transcriptase Polymerase Chain Reaction
After synthesizing cDNA from total RNA isolated by TRIZOL (GibcoBRL), quantitative real-time reverse-transcription polymerase chain reaction (RT-PCR) was performed with the 7700 sequence detector (Applied Biosystems). Mouse CD36, SRA, TNF-, VCAM-1, IL-1ß, IL-6, eNOS, intercellular adhesion molecule-1 (ICAM-1), E-selectin, granulocyte macrophage colony-stimulating factor, and MCP-1 primers and probes were obtained from Applied Biosystems (Assay-on-Demand). GAPDH primers and probe were developed with Primer Express software (Applied Biosystems). The oligonucleotide sequences for GAPDH is as follows: forward primer, 5'GGAGCCAAACGGGTCATCA3'; reverse primer, 5' GGTTCACACCCATCACAAACATG 3'; and probe, FAM-5' TCTCCGCCCCTTCTGC 3'. The resulting data were analyzed with SDS software (Applied Biosystems), with TAMRA as the reference dye.
Isolation of Histone
Histone fraction from 5x106 cells was collected according to Yoshida et al.23
Western Blot Analysis
Forty µg of cellular extract or 30 µg of isolated histone were electrophoresed and transferred to a nitrocellulose membrane (Schleicher & Schuell), which was incubated with antibody against CD36 (Cascade Bioscience), actin (Santa Cruz Biotechnology), histone H4, or acetylated histone H4 (Upstate Biotechnology). Primary antibody was detected with an ECL detection kit (Amersham).
Chromatin Immunoprecipitation
The chromatin immunoprecipitation assay was performed as described previously.24 Briefly, after extracting the total chromatin from 1.5x106 RAW264.7 cells fixed in 1% formaldehyde, the chromatin-DNA complexes immunoprecipitated by antibody against acetylated histone H4 (Upstate Biotechnology) were used as a template for PCR amplifications. The primer pairs are 5'-TGCTGTGAGGATGTTAGTG-3' and 5'-TAAAGGAACCATCAAAATGC-3'(primer 1); 5'-AAATTGCCTAGTCAGAGCAG -3' and 5'-AGCATCACCCTCAAATAAAA-3'(primer 2); and 5'-CCCTGTTG-ATTGACAAGAGT-3' and 5'-TGTGTGAGAGTTGAAACGAG-3'(primer 3).
Fluorescence Microscopy
After pretreatment for 8 hours with TSA, RAW264.7 cells were incubated with 5 mg/mL 1,1'-dioctadecyl-3,3,3',3'-tetramethylindo-carbocyanine percholate (Dil)-labeled oxLDL (Intracel) for 4 hours. After washing, the fluorescence intensity of the cells was analyzed by Image Pro Plus (Media Cybernetics) using a captured picture under a fluorescent microscope with a rhodamine filter set. Data are shown as mean fluorescence of 500 cells per treatment, with 3 fields analyzed per experiment. Three independent experiments were performed.
Statistical Analysis
The results were analyzed using 2-tailed Student t test if 2 groups were compared or ANOVA test followed by Fisher’s protected least significant difference method for multiple comparisons if more groups were compared with a control group. All data in this study are expressed as the mean±SEM. Values of P<0.05 were considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Effects of TSA on Atherogenesis in Ldlr–/– Mice
Throughout the experimental period, the plasma lipid profiles including total cholesterol, LDL, HDL, and triglyceride were not different among the groups (Table I, available online at http://atvb.ahajournals.org). All mice fed an atherogenic diet for 4 or 8 weeks showed fatty streak lesions in aortic sinuses (Figure 1). In mice not treated with TSA, the mean atherosclerotic lesion size in cross sections of the aortic sinuses was 26 020±4150 µm2 after 4 weeks and 97 950±11 880 µm2 after 8 weeks. Treatment with TSA for 4 weeks increased the mean lesion size, by 17.1% (P=0.52) in the low TSA group and 48.6% (P=0.08) in the high TSA group. After 8 weeks of TSA treatment, mean lesion size was further increased, by 35.5% (P=0.096) in the low TSA group and 60.5% (P<0.01) in the high TSA group. But statistical significance was observed only in the high TSA group received for 8 weeks.
|
Treatment with TSA also resulted in significant increases macrophage accumulation in aortic sinus (Figure 2; Figure IV, available online at http://atvb.ahajournals.org). After 4 weeks, the mean areas of macrophage infiltration were 90.7% higher (P<0.05) in the high TSA group than in the untreated group, and after 8 weeks, 73.4% higher (P<0.05) in the low TSA group and 74.7% (P<0.05) higher in the high TSA group.
|
The aortic HDAC activity was reduced 38.7% in the low TSA group and 50.7% in the high TSA group (P<0.05), leaving the expression patterns of HDAC1, HDAC4, and HDAC5 unchanged by TSA treatment (Figure V, available online at http://atvb.ahajournals.org).
Furthermore, we performed immunofluorescence staining for acetylated histone H4 in the lesions. Acetylated histone H4 was localized in most cells of the atherosclerotic vessels, including foam cells, endothelial cells, and smooth muscle cells (Figure VIa through VIf, available online at http://atvb.ahajournals.org). The intensity of staining was markedly higher by 41.8% in TSA-treated mice than in control mice, indicating that the TSA concentration used in this study effectively induced histone hyperacetylation (P<0.01) (Figure VIg and VIh).
Effect of TSA on Expression of OxLDL Receptors
In flow cytometric analysis, the surface expression of CD36 was increased by TSA in a dose-dependent manner (Figure 3A). In real-time RT-PCR analysis, the level of CD36 mRNA was markedly elevated by TSA treatment (Figure 3B). By Western blot, we also observed increased levels of CD36 protein in cells cultured with TSA (Figure 3C). However, there was no effect on SRA expression (Figure VII, available online at http://atvb.ahajournals.org).
|
Effect of TSA on Acetylation of Histone H4 at the CD36 Promoter
The acetylation of histone H4 was markedly increased after treatment with TSA (Figure 4A). To see the acetylation status of histones associated with CD36 genomic locus, chromatin immunoprecipitation analysis was performed. Using 3 different sets of primers (Figure 4B), which cover &600 bp of the upstream or downstream promoter regions of the CD36 gene, we found that TSA treatment induced increased histone H4 acetylation of CD36 promoter regions (Figure 4C).
|
Effect of TSA on Uptake of oxLDL
Because the expression of CD36 is upregulated by HDAC inhibition, we examined the effect of TSA on oxLDL uptake. Using fluorescence microscopy to visualize the amount of Dil-labeled oxLDL taken up by RAW264.7 cells in response to TSA treatment, we found that TSA induced a significant dose-dependent increase in cytoplasmic fluorescence (Figure VIII, available online at http://atvb.ahajournals.org).
Expression of Atherosclerosis-Related Genes in Aorta
In analysis of the expressions of atherosclerosis-related genes using real-time RT-PCR, we found that CD36 expression in aorta increased &2.7-fold in response to TSA treatment when compared with the control group. In addition, expression of mRNAs encoding SRA, TNF-, and VCAM-1 was significantly elevated, whereas expression of IL-6 and IL-1ß mRNA was decreased (Figure 5).
|
Among proatherogenic molecules, besides VCAM-1, having a role in monocyte adhesion and migration, TSA treatment reduced aortic MCP-1 and E-selectin mRNAs. The levels of expression of mRNAs encoding ICAM-1 and granulocyte macrophage colony-stimulating factor, however, were not altered. Thus, increased VCAM-1 expression may be involved in the increased macrophage recruitment into the lesions. We also found that aortic eNOS expression was not reduced by TSA treatment (Figure IX, available online at http://atvb.ahajournals.org).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
TSA is the most potent HDAC inhibitor known to date, and it is frequently used in studies on the role of histone acetylation in gene expression.25 In this study, we injected TSA into Ldlr–/– mice fed an atherogenic diet to determine the effect of HDAC inhibition on atherogenesis. Our results showed that TSA markedly exacerbated atherogenesis in these hyperlipidemic mice, but without changing plasma lipid profiles. These findings indicate that histone acetylation has a significant effect on atherogenesis.
During atherogenesis, the differentiation of monocytes into macrophages is a pivotal step. Macrophages express scavenger receptors, including CD36 and SRA. In a recent study on macrophage cell lines, inhibition of HDAC by TSA was reported to affect the expression of cell surface molecules by a mechanism involving the loss of the Ets domain transcription factor, PU.1.18 TSA inhibition of HDAC, however, has also been shown to increase the expression of CD14 and ICAM-1 in human and mouse monocytes.26 Taken together, these results suggested that histone acetylation may control macrophage function by altering the expression of macrophage surface molecules. We therefore investigated the effects of TSA on the expression of macrophage surface receptors involved in oxLDL uptake and found that TSA significantly increased the surface expression of CD36, but had no effect on expression of SRA. We also found that TSA increased the expression of both mRNA and protein of CD36, which appears to be responsible for the increased cell surface expression of this receptor. Furthermore, CD36 expression was markedly increased in TSA-treated mice. Because CD36 is known to function as a scavenger of oxLDL on macrophages,27 our findings suggest that the TSA-induced increase in oxLDL uptake is associated with the TSA-induced increase in CD36 expression. CD36 expression was recently shown to be increased by NF-
B activation,28 and HDAC inhibitors have been reported to enhance NF-B activity.29,30 We also observed TSA-induced enhancement of NF-B activity in RAW264.7 cells (data not shown). Thus, the mechanism by which TSA increases CD36 expression may involve the enhancement of NF-B activity. The increased NF-B activity by TSA may also contribute to increase of VCAM-1 mRNA expression in aorta of TSA treated mice, because VCAM-1 is one of representative NF-B dependent genes. Considering other NF-B–dependent genes including MCP-1 and E-selectin are reduced in TSA-treated mice, other unknown factors might be involved in regulation of these genes, but which mechanism remains to be elucidated.
In contrast to our cell experiments in which TSA did not elevate SRA expression in macrophages, the aortic expression of SRA was elevated in TSA-treated mice. This increase may be caused by the interaction with other cell types, such as smooth muscle cells (SMCs). Previously, coincubation of aortic SMC with macrophages or oxidized LDL from macrophage-conditioned medium was found to result in increased SRA expression,31 and nodular aortic SMCs show increased expression of SRA.32 Thus, increased SRA expression in aortic SMC caused by enhanced accumulation of macrophages after TSA treatment may be responsible for the upregulation of aortic SRA expression. Our observations therefore indicate that HDAC inhibition has a differential effect on oxLDL receptor expression, thus elucidating steps in the mechanism by which TSA accelerates atherosclerosis.
Recent observation suggested that eNOS expression is downregulated by HDAC inhibitors in endothelial cell.33 But we demonstrated that the eNOS expression was not reduced in TSA-treated mice. This result was unexpected, because eNOS expression has been reported to be restricted to endothelial cells. However, considering that eNOS expression was recently reported to be repressed by HDACs in nonendothelial cells, including artery SMCs, and this repression could be partially relieved by inhibiting HDACs in these cells,34 undiminished eNOS expression in the aortae of TSA-treated mice may be caused by the induction of eNOS expression in nonendothelial vascular cells, indicating that eNOS may not be highly involved in enhanced atherosclerosis by TSA. However, it seems that the understanding molecular mechanisms supporting the difference in eNOS regulation in endothelial cell and nonendothelial cells is quite important and requires further studies.
According to Leoni et al, the HDAC inhibitor suberoylanilide hydroxamic acid has antiinflammatory activity downregulating the expression of several cytokines involved in atherogenesis, including IL-1ß, IL-6, and TNF-.12 We have shown here that whereas the aortic levels of IL-1ß and IL-6 mRNA were reduced, aortic TNF- mRNA was elevated in TSA treated mice. Although the reason for this discrepancy remains to be determined, it may be because of the use of different animal models. TSA may be considered an antiinflammatory compound with respect to its antiatherogenic activity. Although we found that TSA reduced the expression of IL-1ß and IL-6 mRNA, it increased the expression of CD36, SRA, TNF-, and VCAM-1, all of which are involved in atherogenesis, thus suggesting a mechanism for the exacerbation of atherosclerosis by TSA.
Recently, HDAC inhibitors were reported to show anti-tumor activity through the upregulation of expression of silent tumor suppressor genes.20,21 Several HDAC inhibitors, including suberoylanilide hydroxamic acid, butyrate, depsipeptide, and valporic acid, are currently in human clinical trials as anti-cancer agents.25 Although no clinical trials of TSA are currently ongoing, our results, showing that TSA accelerates the development of atherosclerotic lesions, suggest that it is needed to determine the effect of other HDAC inhibitors on atherogenesis.
In conclusion, despite extensive research on the biological functions of histone acetylation, little is known of the role of histone acetylation in atherosclerosis. Several lines of evidence presented in our work clearly support the conclusion that histone acetylation plays some role in atherogenesis, and the control of histone acetylation may affect the process of atherosclerosis.
|
Acknowledgments |
|---|
This work was supported by grants from the 21st Century Frontier Program of Proteomics and Human Genome Research (FG05-22-03), and Molecular and Cellular BioDiscovery Research Program of MOST, from the Vascular System Research Center of the Korean Science & Engineering Foundation, and from the Brain Korea 21 Project. We thank Dr Kyu-Won Kim at Seoul National University for reviewing this manuscript and his helpful comments, and Dr Rho H. Seong at Seoul National University for his support during the chromatin immunoprecipitation assay.
Received November 11, 2004; accepted June 29, 2005.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Marks PA, Richon VM, Rifkind RA. Histone deacetylase inhibitors: inducers of differentiation or apoptosis of transformed cells. J Natl Cancer Inst. 2000; 92: 1210–1216.
2. Timmermann S, Lehrmann H, Polesskaya A, Harel-Bellan A. Histone acetylation and disease. Cell Mol Life Sci. 2001; 58: 728–736.[CrossRef][Medline] [Order article via Infotrieve]
3. Cairns BR. Emerging roles for chromatin remodeling in cancer biology. Trends Cell Biol. 2001; 11: S15–S21.[Medline] [Order article via Infotrieve]
4. Yoshida M, Horinouchi S, Beppu T. Trichostatin A and trapoxin: novel chemical probes for the role of histone acetylation in chromatin structure and function. Bioessays. 1995; 17: 423–430.[CrossRef][Medline] [Order article via Infotrieve]
5. Mitsiades N, Mitsiades CS, Richardson PG, McMullan C, Poulaki V, Fanourakis G, Schlossman R, Chauhan D, Munshi NC, Hideshima T, Richon VM, Marks PA, Anderson KC. Molecular sequelae of histone deacetylase inhibition in human malignant B cells. Blood. 2003; 101: 4055–4062.
6. Wang R, Brunner T, Zhang L, Shi Y. Fungal metabolite FR901228 inhibits c-Myc and Fas ligand expression. Oncogene. 1998; 17: 1503–1508.[CrossRef][Medline] [Order article via Infotrieve]
7. Arts J, Lansink M, Grimbergen J, Toet KH, Kooistra T. Stimulation of tissue-type plasminogen activator gene expression by sodium butyrate and trichostatin A in human endothelial cells involves histone acetylation. Biochem J. 1995; 310: 171–176.
8. Ross R. Atherosclerosis-an inflammatory disease. N Engl J Med. 1999; 340: 115–126.
9. Diaz MN, Frei B, Vita JA, Keaney JF Jr. Anti-oxidants and atherosclerotic heart disease. N Engl J Med. 1997; 337: 408–416.
10. Yu Z, Zhang W, Kone BC. Histone deacetylases augment cytokine induction of the iNOS gene. J Am Soc Nephrol. 2002; 13: 2009–2017.
11. Huang N, Katz JP, Martin DR, Wu GD. Inhibition of IL-8 gene expression in Caco-2 cells by compounds which induce histone hyperacetylation. Cytokine. 1997; 9: 27–36.[CrossRef][Medline] [Order article via Infotrieve]
12. Leoni F, Zaliani A, Bertolini. Porro G, Pagani P, Pozzi P, Dona G, Fossati G, Sozzani S, Azam T, Bufler P, Fantuzzi G, Goncharov I, Kim SH, Pomerantz BJ, Reznikov LL, Siegmund B, Dinarello CA, Mascagni P. The antitumor histone deacetylase inhibitor suberoylanilide hydroxamic acid exhibits antiinflammatory properties via suppression of cytokines. Proc Natl Acad Sci U S A. 2002; 99: 2995–3000.
13. Li AC, Glass CK. The macrophage foam cell as a target for therapeutic intervention. Nat Med. 2002; 8: 1235–1242.[CrossRef][Medline] [Order article via Infotrieve]
14. Linton MF, Fazio S. Class A scavenger receptors, macrophages, and atherosclerosis. Curr Opin Lipidol. 2001; 12: 489–495.[CrossRef][Medline] [Order article via Infotrieve]
15. Febbraio M, Hajjar DP, Silverstein RL. CD36: a class B scavenger receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid metabolism. J Clin Invest. 2001; 108: 785–791.[CrossRef][Medline] [Order article via Infotrieve]
16. Suzuki H, Kurihara Y, Takeya M, Kamada N, Kataoka M, Jishage K, Ueda O, Sakaguchi H, Higashi T, Suzuki T, Takashima Y, Kawabe Y, Cynshi O, Wada Y, Honda M, Kurihara H, Aburatani H, Doi T, Matsumoto A, Azuma S, Noda T, Toyoda Y, Itakura H, Yazaki Y, Horiuchi S, Takahashi K, Kruijt JK, van Berkel TJC, Steinbrecher UP, Ishibashi S, Maeda N, Gordon S, Kodama T. A role for macrophage scavenger receptors in atherosclerosis and susceptibility to infection. Nature. 1997; 386: 292–296.[CrossRef][Medline] [Order article via Infotrieve]
17. Febbraio M, Podrez EA, Smith JD, Hajjar DP, Hazen SL, Hoff HF, Sharma K, Silverstein RL. Targeted disruption of the class B scavenger receptor CD36 protects against atherosclerotic lesion development in mice. J Clin Invest. 2000; 105: 1049–1056.[Medline] [Order article via Infotrieve]
18. Laribee RN, Klemsz MJ. Loss of PU. 1 expression following inhibition of histone deacetylases. J Immunol. 2001; 167: 5160–5166.
19. Ishibashi S, Brown MS, Goldstein JL, Gerard RD, Hammer RE, Herz J. Hypercholesterolemia in low density lipoprotein receptor knockout mice and its reversal by adenovirus-mediated gene delivery. J Clin Invest. 1993; 92: 883–893.
20. Vigushin DM, Ali S, Pace PE, Mirsaidi N, Ito K, Adcock I, Coombes RC. Trichostatin A is a histone deacetylase inhibitor with potent antitumor activity against breast cancer in vivo. Clin Cancer Res. 2001; 7: 971–976.
21. Kim MS, Kwon HJ, Lee YM, Baek JH, Jang JE, Lee SW, Moon EJ, Kim HS, Lee SK, Chung HY, Kim CW, Kim KW. Histone deacetylases induce angiogenesis by negative regulation of tumor suppressor genes. Nat Med. 2001; 7: 437–443.[CrossRef][Medline] [Order article via Infotrieve]
22. Kim J, Nam KH, Kim SO, Choi JH, Kim HC, Yang SD, Kang JH, Ryu YH, Oh GT, Yoo SE. KR-31378 ameliorates atherosclerosis by blocking monocyte recruitment in hypercholestrolemic mice. FASEB J. 2004; 18: 714–716.
23. Yoshida M, Kijima M, Akita M, Beppu T. Potent and specific inhibition of mammalian histone deacetylase both in vivo and in vitro by trichostatin A. J Biol Chem. 1990; 265: 17174–17179.
24. Xu D, Popov N, Hou M, Wang Q, Bjorkholm M, Gruber A, Menkel AR, Henriksson M. Switch from Myc/Max to Mad1/Max binding and decrease in histone acetylation at the telomerase reverse transcriptase promoter during differentiation of HL60 cells. Proc Natl Acad Sci U S A. 2001; 98: 3826–3831.
25. de Ruijter AJ, van Gennip AH, Caron HN, Kemp S, van Kuilenburg AB. Histone deacetylases (HDACs): characterization of the classical HDAC family. Biochem J. 2003; 370: 737–749.[CrossRef][Medline] [Order article via Infotrieve]
26. Wang XQ, Alfaro ML, Evans GF, Zuckerman SH. Histone deacetylase inhibition results in decreased macrophage CD9 expression. Biochem Biophys Res Commun. 2002; 294: 660–666.[CrossRef][Medline] [Order article via Infotrieve]
27. Endemann G, Stanton LW, Madden KS, Bryant CM, White RT, Protter AA. CD36 is a receptor for oxidized low density lipoprotein. J Biol Chem. 1993; 268: 11811–11816.
28. Li J, Peet GW, Balzarano D, Li X, Massa P, Barton RW, Marcu KB. Novel NEMO/IkappaB kinase and NF-kappa B target genes at the pre-B to immature B cell transition. J Biol Chem. 2001; 276: 18579–18590.
29. Quivy V, Adam E, Collette Y, Demonte D, Chariot A, Vanhulle C, Berkhout B, Castellano R, de Launoit Y, Burny A, Piette J, Bours V, Van Lint C. Synergistic activation of human immunodeficiency virus type 1 promoter activity by NF-kappaB and inhibitors of deacetylases: potential perspectives for the development of therapeutic strategies. J Virol. 2002; 76: 11091–11103.
30. Ashburner BP, Westerheide SD, Baldwin AS Jr. The p65 (RelA) subunit of NF-kappaB interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression. Mol Cell Biol. 2001; 21: 7065–7077.
31. Mietus-Snyder M, Gowri MS, Pitas RE. Class A scavenger receptor up-regulation in smooth muscle cells by oxidized low density lipoprotein. Enhancement by calcium flux and concurrent cyclooxygenase-2 up-regulation. J Biol Chem. 2000; 275: 17661–17670.
32. Proudfoot D, Davies JD, Skepper JN, Weissberg PL, Shanahan CM. Acetylated low-density lipoprotein stimulates human vascular smooth muscle cell calcification by promoting osteoblastic differentiation and inhibiting phagocytosis. Circulation. 2002; 106: 3044–3050.
33. Rossig L, Li H, Fisslthaler B, Urbich C, Fleming I, Forstermann U, Zeiher AM, Dimmeler S. Inhibitors of histone deacetylation downregulate the expression of endothelial nitric oxide synthase and compromise endothelial cell function in vasorelaxation and angiogenesis. Circ Res. 2002; 91: 837–844.
34. Gan Y, Shen YH, Wang J, Wang X, Utama B, Wang J, Wang XL. Role of histone deacetylation in cell-specific expression of endothelial nitric oxide synthase. J Biol Chem. 2005; 280: 16467–16475.
This article has been cited by other articles:
 |
|
 |
|
  S. Song, S. W. Kang, and C. Choi Trichostatin A enhances proliferation and migration of vascular smooth muscle cells by downregulating thioredoxin 1 Cardiovasc Res, August 13, 2009; (2009) cvp263v2. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. D. N'Guessan, F. Riediger, K. Vardarova, S. Scharf, J. Eitel, B. Opitz, H. Slevogt, W. Weichert, A. C. Hocke, B. Schmeck, et al. Statins Control Oxidized LDL-Mediated Histone Modifications and Gene Expression in Cultured Human Endothelial Cells Arterioscler Thromb Vasc Biol, March 1, 2009; 29(3): 380 - 386. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Bowes, M. I. Khan, Y. Shi, L. Robertson, and G. H. Werstuck Valproate Attenuates Accelerated Atherosclerosis in Hyperglycemic ApoE-Deficient Mice: Evidence in Support of a Role for Endoplasmic Reticulum Stress and Glycogen Synthase Kinase-3 in Lesion Development and Hepatic Steatosis Am. J. Pathol., January 1, 2009; 174(1): 330 - 342. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. C. Matouk and P. A. Marsden Epigenetic Regulation of Vascular Endothelial Gene Expression Circ. Res., April 25, 2008; 102(8): 873 - 887. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, S. A. Mahmud, P. B. Bitterman, Y. Huo, and A. Slungaard Histone Deacetylase Inhibitors Suppress TF-{kappa}B-dependent Agonist-driven Tissue Factor Expression in Endothelial Cells and Monocytes J. Biol. Chem., September 28, 2007; 282(39): 28408 - 28418. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||