Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2004;24:1628-1633
Published online before print July 1, 2004, doi: 10.1161/01.ATV.0000137188.76195.fb
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
24/9/1628    most recent
01.ATV.0000137188.76195.fbv1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hamilton, K. L.
Right arrow Articles by Knowlton, A.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hamilton, K. L.
Right arrow Articles by Knowlton, A.A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*TAMOXIFEN
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2004;24:1628.)
© 2004 American Heart Association, Inc.


Vascular Biology

Estrogen, Heat Shock Proteins, and NF{kappa}B in Human Vascular Endothelium

Karyn L. Hamilton; F.N. Mbai; S. Gupta; A.A. Knowlton

From the University of California (F.N.M., S.G., A.A.K.), Davis, Calif; Sacramento VA Medical Center (A.A.K.), Sacramento, Calif; and Baylor College of Medicine (K.L.H.), Houston, Tex.

Correspondence to Dr A.A. Knowlton, Cardiovascular Division, TB 172, University of California, Davis, One Shields Avenue, Davis, CA 95616. E-mail aaknowlton{at}ucdavis.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Background— We hypothesized that estrogen would increase HSP72 in human coronary artery endothelial cells (HCAEC), and that these would be more sensitive to estrogen than our previous observations in myocytes.

Methods and Results— HCAEC were treated with 17ß-estradiol or tamoxifen, ranging from physiological to pharmacological(1 nM to 10 µmol/L) for either 24 hours (early) or 7 days (chronic). HSP expression was assessed by Western blots. Both early and chronic 17ß-estradiol and tamoxifen increased HSP72. Electromobility shift assays (EMSA) showed activation of HSF-1 with early, but not chronic, 17ß-estradiol. 17ß-Estradiol activated NF{kappa}B within 10 minutes, and the ER-{alpha} selective inhibitor, ICI 182 780, abolished this effect. Transcription factor decoys containing the heat shock element blocked HSP72 induction. Estrogen pretreatment decreased lactate dehydrogenase release with hypoxia. This protective effect persisted despite blockade of HSF-1 by decoys. However, an NF-{kappa}B decoy prevented the increase in HSP72 and abolished the estrogen-associated protection during hypoxia.

Conclusions— 17ß-Estradiol upregulates HSP72 early and chronically via different mechanisms in HCAEC, and provides cytoprotection during hypoxia, independent of HSP72 induction. NF-{kappa}B mediates the early increase in HSP72, suggesting that estrogen activates NF-{kappa}B via a nongenomic, receptor-dependent mechanism, and this leads to activation of HSF-1. Activation of NF-{kappa}B was critical for estrogen-associated protection. Further studies are needed to elucidate the involved signaling pathways.

We hypothesized that estrogen would increase HSP72 in human coronary artery endothelial cells (HCAEC). Both early and chronic treatment increased HSP72. EMSA showed activation of HSF-1 with early, but not chronic, 17ß-estradiol. Transcription factor decoys blocked estrogen-related HSP72 induction. Estrogen decreased LDH release with hypoxia. An NF-{kappa}B decoy blocked the HSP72 increase and estrogen-associated protection.


Key Words: estrogen • endothelium • signal transduction • hypoxia • HSP72


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Gender-specific differences in the incidence of cardiovascular disease have long-been recognized.1 Although the risk of cardiovascular disease (CVD) increases with age, premenopausal women have markedly lower risk than age-matched men. Although women’s risk for cardiac disease increases significantly after menopause, some of this risk may be attenuated by estrogen therapy, leading to a 40% to 50% decrease in CVD;2,3 however, clinical trials of estrogen therapy in postmenopausal women have not shown the expected benefit.4,5 Clearly, much more needs to be understood about the effects of estrogen at a more basic level than can be addressed in a clinical trial.

The mechanisms to explain the cardioprotective effects of estrogen remain complex and elusive. Estrogen-induced changes in blood lipid profiles can only account for {approx}30% of the decreased risk in premenopausal women. We postulated that another means by which estrogen provides cardioprotection is via upregulation of heat shock proteins (HSPs). HSPs are endogenous protective proteins that guard cells from injury and aid in recovery after injury. We have shown that estrogen increases HSP72 in male rat cardiac myocytes.6 Further, we have observed that female rats have more HSP72 in their hearts than males do.7 Importantly, this difference is lost with surgically induced menopause. Despite the higher endogenous levels of estrogen in females and the higher baseline amounts of HSP72, supplemental estrogen still leads to a further increase in HSP72 and HSP90 in cardiomyocytes from female rats.8 HSP90 binds intracellular hormone receptors. It has been postulated, therefore, that the interaction between HSP90, hormone receptors, and HSF is an important element in activation of HSF-1 by hormones.6 Estrogen, as well as hypoxia, stimulates HSP90 binding to eNOS in cardiac myocytes and vascular endothelial cells,9 with subsequent regulation of NO release, PI3-Akt activation, and calcium sensitivity.10,11

Thus, our findings in cardiomyocytes prompted us to investigate whether 17ß-estradiol has a similar effect on human coronary artery endothelial cells (HCAEC). We examined the effects of both early and chronic administration of 17ß-estradiol and a selective estrogen receptor modulator with mixed agonist/antagonist effects, tamoxifen, on HSP expression, and whether estrogen protected HCAEC from hypoxia. Finally, using transcription factor decoys, we examined the mechanism by which 17ß-estradiol regulates HSP synthesis. Through this work, we identified a novel link between estrogen treatment, NF{kappa}B activation, and HSF-1 activation. To our knowledge, this is the first report of the differential role of HSF-1 activation during early versus chronic estrogen and HSP induction, and the first use of transcription factor decoys to evaluate heat shock factor activation as a mechanism of action.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Endothelial Cell Culture
HCAEC were purchased from Clonetics (La Jolla, Calif). Because of availability, all experiments used male HCAEC. Cells were cultured at 37°C in a humidified incubator with 5% CO2 and 95% room air in phenol red free endothelial basal medium (Clonetics) supplemented with the following (per 500 mL): 10 mL fetal bovine serum, 0.5 mL human endothelial growth factor, 2 mL human fibroblast growth factor-B, 0.5 mL vascular endothelial growth factor, 0.5 mL ascorbic acid, 0.5 mL long R3-IGF-1, and 0.5 mL gentamycin/amphotericin-B. All experiments were performed at an early passage number.4–6

Treatment Protocols
Seventy percent to 90% confluent HCAEC were used for all studies. Cells were treated with 17ß-estradiol, tamoxifen (an estrogen receptor agonist/antagonist), or vehicle (an equal volume of diluent ethanol). 17ß-Estradiol and tamoxifen were applied in a range of concentrations from physiological to pharmacological: 1 nM, 10 nM, 100 nM, or 10 µmol/L. We investigated the effects of both early (24 hours) and chronic (7 days) exposure to these compounds.

Hypoxia and Cellular Injury
After treatment with 17ß-estradiol, HCAEC were changed to a glucose-free medium to prevent anaerobic glycolysis. Cells were subjected to 24-hour hypoxia in an anaerobic workstation as described.12 Cellular injury was estimated by measuring lactate dehydrogenase (LDH) release as described.13

Western Blotting
Western blotting was performed as described.14 Blots were developed with a chemiluminescent system. Bands were quantified by densitometry and expressed relative to control (vehicle-treated) values.

Electromobility Shift Assays
Activation of HSF-1 was detected by electromobility shift assays (EMSA) as described.15 5'GCCTCGAATGTTCGCGAACTTT3' and its complementary strand were used as a probe. Biotin-labeled 5'AGTTGAGGGGACTTTCCCAGGC3' and its complementary strand were used to assess activation of the transcription factor NF{kappa}B.

Nuclear protein extracts were used for all EMSA. Nuclei were isolated by the method of deMoissac et al16 Incubation with a 50-fold excess of unlabeled probe, "cold compete," was performed to control for nonspecific binding. Supershift studies were performed with anti-HSF-1 antibody (Affinity Bioreagents) and anti-HSF-2 antibody (LabVision, Fremont, Calif) as previously described.

In later experiments, to compare NF-{kappa}B activation in multiple samples, a kit detecting activation of NF-{kappa}B and binding of p50 was used (Pierce). HCAEC were treated with 17ß-estradiol, 17ß-estradiol in the presence of the estrogen receptor antagonist ICI 182 780 (10 nM), tamoxifen (10 nM), or raloxifene (10 nM) for 15 minutes. Nuclear extracts were prepared following the directions of the manufacturer. Samples were assayed in duplicate in a 96-well plate coated with the consensus NF-{kappa}B binding element. After incubation with anti-p50 followed by a secondary antibody linked to HRP, plates were developed with a chemiluminescent substrate and read in a luminometer. An internal positive control was used as a reference point for maximal signal. "Cold competition" for this assay was performed by adding excess consensus binding element to wells. This reduced the signal level to near zero. A mutated binding sequence had no effect on signal.

Transcription Factor Decoy Experiments
To further investigate the role of HSF-1 activation in the 17ß-estradiol–mediated increases in HSPs, transcription factor decoys were used with the consensus sequence for the heat shock element (HSE), the nuclear sequence bound by HSF on activation, and translocation into the nucleus. HCAEC were transfected with double-stranded phosphorothioate oligonucleotides (2 µmol/L) containing either the HSE consensus sequence 5'GCCTCGAATG-TTCGCGAACTTT3' or NF-{kappa}B 5'CCTTGAAGGGATTTCCCTCC3' (Trilink, San Diego, Calif) using 5 µg/µL Lipofectin (Gibco BRL, Carlsbad, Calif), which is routinely used to facilitate efficient uptake of the oligonucleotide decoys by vascular cells.17 Twelve hours later, 17ß-estradiol was added to the media to a final concentration of 100 nM. A scrambled double-stranded phosphorothioate oligonucleotide with the sequence 5'ATGGCCTCGTTTATTCACGCG3' was used as a control. Cells were either prepared for Western blotting or subjected to the hypoxia protocol as described previously.

Statistics and Data Analysis
Values reported are means±SEM of 3 or more separate experiments with multiple data determinations in each experiment. Data were compared by 1-way ANOVA followed by a student Newman–Keuls post hoc test. When normalized values were compared with control values, data were analyzed using an ANOVA on Ranks followed by a Dunn test; if data passed tests of normality and equal variance, 1-way ANOVA was performed. A P<0.05 was considered significant.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Changes in HSP Levels With Estrogen and Tamoxifen
After confirming the presence of estrogen receptors in male HCAEC (not shown), we examined the effect of early and chronic treatment with 17ß-estradiol or tamoxifen on 3 HSPs. As shown in Figure 1A, early (24-hour) 17ß-estradiol resulted in a significant increase in both HSP72 and HSP90. Chronic (1-week) 17ß-estradiol resulted in HSP72, but not HSP90, accumulation (Figure 1B). Representative Western blots are shown in Figure I (available online at http://atvb.ahajournals.org).



View larger version (28K):
[in this window]
[in a new window]
 
Figure 1. Western blots of HCAEC exposed to 1 nM, 100 nM, or 100 µM 17ß-estradiol. A, HSP72 with 24-hour estrogen. B, HSP90 with 24-hour estrogen. C, HSP72, 7-day estrogen treatment. D, HSP90, 7 days of estrogen. ß-actin is shown as loading control. *P<0.05 versus control.

The estrogen receptor antagonist/agonist, tamoxifen, had a similar effect on HSP levels. Both early and chronic (Figure IIA and IIB, available online at http://atvb.ahajournals.org) tamoxifen exposure resulted in significant increases in HSP72 and HSP90 at the higher doses; however, the highest dose given chronically was lethal to cells. Neither 17ß-estradiol nor tamoxifen treatment altered HSP27 (not shown).

Transcription Factor Activation
EMSAs were used to evaluate activation of the transcription factor for the heat shock response, HSF-1, after treatment with 17ß-estradiol. Early estrogen resulted in HSF activation by 3 hours of treatment, but chronic estrogen did not activate HSF (Figure 2A). Supershift experiments confirmed that HSF-1 rather than HSF-2 was activated by early estrogen treatment (Figure 2A).



View larger version (27K):
[in this window]
[in a new window]
 
Figure 2. A, HSF activation in HCAEC treated as follows: lane 1, control, vehicle only; lane 2, 100 nM 17ß-estradiol for 7 days; lane 3, 10 µmol/L 17ß-estradiol for 7 days; lane 4, 1 nM 17ß-estradiol for 3 hours; lane 5, 100 nM 17ß-estradiol for 3 hours; lane 6, 10 µmol/L 17ß-estradiol for 3 hours; lane 7, 100 nM 17ß-estradiol for 3 hours plus 50-fold excess of unlabeled oligonucleotide (cold compete); lane 8, 100 nM 17ß-estradiol for 3 hours plus HSF-1 antibody (supershift); lane 9, 100 nM 17ß-estradiol for 3 hours plus HSF-2 antibody (no supershift). B, EMSA demonstrating activation of NF-kB after 15 minutes. of treatment with 100 nM 17ß-estradiol compared with ethanol only (E, lane 1). Lane 3 shows loss of signal with cold competition (CC) with excess unlabeled oligonucleotide. C, NF{kappa}B activation at 1 and 100 nM with 15 minutes of treatment using NF-kB p50 activation assay. Control is treated with ethanol only. D, Effects of antagonists (ICI 182 780) and mixed antagonists/agonists (tamoxifen [T] and raloxifene) versus 17ß-estradiol (E2). *P<0.05 versus control.

Previously, we hypothesized that the delayed activation of HSF-1 might occur because of the interaction of the estrogen receptor with HSP90, which also binds HSF-1.6 Alternatively, HSF-1 activation may take several hours because another pathway is activated first. To test this, NF-kB activation was assessed at 5, 10, 15, 30, and 60 minutes after treatment with 17ß-estradiol as well as after several hours. As shown in Figure 2B and 2C, activation of NF-{kappa}B occurred within 10 minutes. of treatment with 17ß-estradiol, peaking at 15 minutes, and still showing activation at 60 minutes. Later time points of several hours showed little or no activation of NF-{kappa}B. Activation of NF-{kappa}B was seen with both 1 nM and 100 nM 17ß-estradiol. To further assess whether 17ß-estradiol activates NF-{kappa}B via a receptor-dependent mechanism, NF-{kappa}B activation was measured after treatment with tamoxifen (10 nM), raloxifene (10 nM), or 17ß-estradiol(10 nM) in the presence of ICI 182 780 (10 nM), an inhibitor of ER{alpha}. ICI 182 780 abolished the NF-{kappa}B activation observed with 17ß-estradiol, whereas tamoxifen and raloxifene had no significant effect (Figure 2D).

Transcription Factor Decoy Experiments
To confirm that HSF-1 activation is an essential part of the signaling pathway by which early 17ß-estradiol induces HSP72, we used a double-stranded phosphorothioate oligonucleotide with an HSE consensus sequence as a transcription factor decoy.18,19 This HSF decoy acts as a cytosolic "sponge," binding the activated HSF-1 before it has a chance to translocate to the nucleus. The HSF decoy prevented estrogen-related HSP72 accumulation during early treatment; however, HSP72 levels remained elevated after chronic 17ß-estradiol despite transfection with the HSF decoy (Figure 3A and 3D). This confirms the results of the EMSA experiments and shows that early estrogen upregulates HSP72 via activation of HSF-1; however, increased HSP72 with chronic estrogen treatment is via a mechanism other than HSF-1 activation. Transfection with the NF-{kappa}B decoy also prevented the estrogen-associated increase in HSP72 after 24 hours (Figure 3B and 3D). Transfection with the scrambled decoy had no effect on HSP72 levels (Figure 3C and 3D).



View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. A, HSP72 levels after transfection with HSF decoys and 100 nM 17ß-estradiol for 24 hours or 7 days. B, HSP72 levels with one of the following: NF{kappa}B decoys before 24 hours with 100 nM 17ß-estradiol; 24 hours with 100 nM 17ß-estradiol; or vehicle. C, HSP72 with HSF decoys or scrambled (SCR) decoys before 24 hours 100 nM 17ß-estradiol. D, Graph summarizes changes. *P<0.05 versus C and E + either HSF or NF{kappa}B decoy. C, indicates control, ethanol only; E, 17ß-estradiol; HSF, NF{kappa}B; SCR (scramble), respective decoy applied before 17ß-estradiol.

Hypoxia/Cellular Injury
Hypoxia was used to evaluate whether 17ß-estradiol can prevent cell injury. Both early and chronic estrogen resulted in significant decreases in LDH release, a marker of cell injury, during hypoxia compared with controls (Figure III, available online at http://atvb.ahajournals.org). The HSF decoy did not block the protective effects of estrogen on LDH release (Figure 4A), but the NF-{kappa}B decoy abolished the protective effects of estrogen (Figure 4B).



View larger version (29K):
[in this window]
[in a new window]
 
Figure 4. A, LDH release after transfection with HSE decoy before treatment with 100 nM estradiol. B, LDH release after transfection with NF{kappa}B decoys before treatment with 100 nM 17ß-estradiol. *P<0.05 versus no hypoxia controls.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Investigation of the effects of estrogen on HCAEC demonstrates that: (1) 17ß-estradiol increases HSP72 and HSP90 early and chronically; (2) 17ß-estradiol treatment results in sequential activation of NF{kappa}B and HSF-1; (3) the mechanism underlying the early and chronic increases differ; (4) transcription factor decoys to HSF-1 and NF-{kappa}B both can block the increase in HSP72; and (5) only NF-{kappa}B inhibition blocks the protective effects of 17ß-estradiol against hypoxic injury. Previously, we have observed that 17ß-estradiol increases HSP72 in cardiomyocytes, but there was no change in HSP90 or HSP27. We were interested in whether estrogen would have a similar effect on the endothelial cell.20 In contrast to the myocyte, both HSP90 and HSP72 increased significantly in response to 17ß-estradiol but showed a similar response time; however, the endothelial cells were much more sensitive to the effects of 17ß-estradiol, and changes in HSPs were seen at much lower concentrations than in myocytes (1 nM to 10 µmol/L versus 100 nM to 10 µmol/L). HSP27, again, was unchanged despite the presence of an estrogen response element in the promoter of this gene.

Chronic treatment with 17ß-estradiol had a greater effect on HSP72 protein levels, with the lowest dose (10 nM) resulting in the maximal increase. The chronic treatment with estrogen more closely reproduces the in vivo setting where endothelial cells would be continuously exposed to estrogen.

The mixed antagonist/agonist, tamoxifen, was studied for comparison. Interestingly, similar effects were observed with early treatment. With chronic treatment, much less of a response was observed in HSP levels, and the highest dose was lethal to the cells. Thus, tamoxifen-like estrogen could increase expression of HSP72 and HSP90, but the effect was less with chronic treatment, in contrast to estrogen, in which the effect was greater with chronic treatment.

To further elucidate the mechanism involved in the estrogen-associated increase in HSPs, transcription factor decoy experiments were performed. In the early setting, the activation of NF-{kappa}B and HSF-1 were necessary to increase HSP72. The decoy for HSF abolished the increase in HSP72 but did not abolish the protective effect of treatment with17ß-estradiol; however, the decoy for the NF-{kappa}B transcription factor abolished the increase in HSPs and the protective effect of treatment with 17ß-estradiol. These results suggest that NF-{kappa}B is activated first, and then HSF-1 is activated. This is further bolstered by the observation that NF{kappa}B is activated within minutes of treatment with 17ß-estradiol, and HSF-1 activation takes several hours. Previously, we interpreted the lag between hormone treatment and activation of HSF-1 in cardiomyocytes to result from change in the homeostasis between HSP90–HSF-1 and the estrogen receptor, with HSF-1 being released as a result, and subsequent activation occurring spontaneously. However, the current results suggest that the signaling pathway between the addition of estrogen and the increase in HSP72 is much more complex. Our data indicate that activation of NF-{kappa}B is necessary for the increase in HSP72. Estrogen-related NF-{kappa}B activation is ER{alpha}-mediated as demonstrated by its complete inhibition by the antagonist ICI 182 780. Tamoxifen and raloxifene had less effect on NF-{kappa}B activation than estradiol. Both tamoxifen and raloxifene have been described to have agonistic properties and to have nongenomic effects via ER{alpha}, which are less than the effects of estrogen.21–23 Thus, our data suggest that tamoxifen and raloxifene have an intermediate effect compared with estradiol. NF-{kappa}B activation was increased, but not significantly, for these 2 treatments. The observation that NF-{kappa}B is an intermediary between estrogen and the heat shock proteins presents a new signaling pathway. Further work will be needed to identify the mechanism of NF-{kappa}B activation by estrogen and the additional intermediate steps. It should be emphasized that the activation of NF-{kappa}B was seen with physiological concentrations of estrogen.

With chronic 17ß-estradiol, to model in vivo when estrogen is continuously present, only HSP72 increased. This increase in HSP72 was not abolished by treatment with a decoy for HSF-1; however, cells were treated with decoy for only the last 24 hours of estrogen. These results suggest that another mechanism, other than activation of HSF-1, was responsible for the increased HSP72. This result is consistent with our observation that after ovariectomy, it took 9 weeks for HSP72 levels in female rat hearts to decrease to the level of male rat hearts.7

Estrogen pretreatment protected HCAEC from hypoxia/reoxygenation. Blocking the increase in HSP72 through the use of transcription factor decoys for HSF did not abolish the protective effects of estrogen. This is in contrast to isolated rat cardiomyocytes in which blocking the endogenous increase in HSP72 in response to simulated ischemia increases cellular injury.13 The maintenance of a protective effect from estrogen treatment, despite blocking the increase in HSP72, is consistent with the cytoprotective effects of estrogen being plethoric, rather than dependent on a single mechanism. The 2 cells types, endothelial cells and myocytes, are vastly different, with different susceptibilities to injury. Thus, the greater importance of HSP72 to protection in myocytes versus endothelial cells is not surprising, although HSP72 is known to be protective in the endothelial cell.24

Estrogen is known to have a wide variety of biological effects. These effects are mediated by at least 2 different receptors (ER{alpha} and ERß) and occur via genomic and nongenomic mechanisms, resulting either in direct local effects (eg, changes in ion channel activity) or in activation of cell signaling cascades.25–29 An example of this is the activation of endothelial nitric oxide synthase (eNOS), which occurs through an IP3-kinase–dependent pathway and is independent of transcription.9,30 HSP90 is involved in this, because it complexes with eNOS in the cell, and estrogen increases the binding eNOS by HSP90. The exact mechanisms through which this occurs are still being elucidated. The rapidity of activation of NF-{kappa}B in the current work supports a nongenomic mechanism.

In contrast to HSF decoys, the NF-{kappa}B decoys abolished the estrogen-induced protection against hypoxia. This finding, in addition to our observation that the NF-{kappa}B decoy prevented the estrogen-associated increase in HSP72, suggests that this redox-sensitive transcription factor plays a key role in the estrogen-associated cellular protection against hypoxic injury.

NF-{kappa}B is implicated in the regulation of diverse cellular processes, including apoptosis, cell division, differentiation, growth, immunity, and cellular responses to stress, including hypoxia.31 NF-{kappa}B has been shown to be activated in atherosclerosis, with angina, during transplant rejection, after ischemia/reperfusion, in congestive heart failure, dilated cardiomyopathy, after preconditioning, and with heat shock. Regulation of NF-{kappa}B is complex and involves cross-talk with other pathways, the best-described of which are cytokine-mediated pathways. The effect of estrogen and selective estrogen receptor modulators on NF-{kappa}B regulation has been primarily studied with respect to modulation of cytokine-induced NF-{kappa}B activation. In general, estrogen attenuates cytokine-induced NF-{kappa}B activation, whereas selective estrogen receptor modifiers (SERM), including raloxifene and tamoxifen, have varied effects on NF-{kappa}B activation.32–34 However, NF-{kappa}B activation was assessed several hours after estrogen exposure. We have described the effect of estrogen and 2 SERMs on rapid changes in NF-{kappa}B activation status. To our knowledge, this is the first report of rapid activation of NF-{kappa}B by estrogen via an ER{alpha}-dependent mechanism.

The mechanisms by which estrogen activates NF-{kappa}B remain speculative, with few observations published to date. Speir et al reported that the estrogen receptor and an NF-{kappa}B component (p65) compete for limited amounts of p300, a relative of the cyclic AMP response element–binding protein.35 In T cells, 17ß-estradiol suppresses the IL-2 and IL-1 receptors, decreasing activation of NF-{kappa}B.36 Hence, the estrogen receptors have an indirect effect on transcriptional activation of inflammatory genes by NF-{kappa}B. However, estrogen’s effects are a mixture of protective and inflammatory responses, which reflects the complexity of the response to estrogen.37 Likewise, NF-{kappa}B is both protective and injurious, depending on the cell type and setting. Further work is needed to determine the role of NF-{kappa}B in estrogen-associated protection in endothelial cells as well as in the increase in HSP72.

In summary, estrogen treatment of human coronary artery endothelial cells induced HSP synthesis and attenuated cell injury during 24 hours of hypoxia. This protective effect persisted despite blockade of HSF-1 binding. Chronic estrogen exposure had similar effects—HSP induction and protection against hypoxia-induced damage—but without HSF-1 activation. Early estrogen treatment activated NF-{kappa}B via an ER{alpha}-mediated pathway. Transfection with an NF-{kappa}B decoy before treatment with estrogen prevented the increase in HSP72 and abolished estrogen-associated protection during hypoxia. Collectively, these results suggest multiple mechanisms of estrogen-related protection, with probable cross-talk between signaling pathways. The mechanisms of HSP induction during chronic estrogen exposure and the involvement of NF-kB in estrogen-associated HSP induction and protection during hypoxia remain to be elucidated. Treatment with 17ß-estradiol and tamoxifen may provide a novel means of protecting not only cardiac myocytes but also the vascular endothelium.


*    Acknowledgments
 
The authors thank Phyllis Wise, PhD and Judy Turgeon, PhD for their insightful comments on this work, and Jessica Tristan for her assistance. The authors thank Kathy Lamping, PhD for timely reagent provision.

Supported by grants from The Women’s Fund, Houston, Tex (A.A.K.) and from the National Institute of Health (AG19327, HL58515), and by a VA Merit Award (A.A.K.).

Received April 9, 2004; accepted June 18, 2004.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Mosca L, Manson JE, Sutherland SE, Langer RD, Manolio T, Barrett-Connor E. Cardiovascular Disease in Women: A Statement for Healthcare Professionals From the Am Heart Association. Circulation. 1997; 96: 2468–2482.[Free Full Text]

2. Mendelsohn ME, Karas RH. The protective effects of estrogen on the cardiovascular system. N Engl J Med. 1999; 340: 1801–1811.[Free Full Text]

3. Stevenson JC. Cardiovascular effects of oestrogens. J Steroid Biochem Mol Biol. 2000; 74: 387–393.[CrossRef][Medline] [Order article via Infotrieve]

4. Grady D, Herrington D, Bittner V, Blumenthal R, Davidson M, Hlatky M, Hsia J, Hulley S, Herd A, Khan S, Newby KL, Waters D, Vittinghoff E, Wenger N. Cardiovascular disease outcomes during 6.8 years of hormone therapy: Heart and Estrogen/Progestin Replacement study follow-up (HERS II). JAMA. 2002; 288: 49–57.[Abstract/Free Full Text]

5. Nelson HD, Humphrey LL, Nygren P, Teutsch SM, Allan JD. Postmenopausal Hormone Replacement Therapy: Scientific Review. JAMA. 2002; 288: 872–881.[Abstract/Free Full Text]

6. Knowlton AA, Sun L. Heat shock factor-1, steroid hormones, and regulation of heat shock protein expression in the heart. Am J Physiol. 2001; 280: H455–H464.

7. Voss MR, Stallone JN, Li M, Cornelussen RNM, Knuefermann P, Knowlton AA. Gender Differences in the Expression of Heat Shock Proteins: The Effect of Estrogen. Am J Physiol Heart Circ Physiol. 2003; 285: H687–H692.[Abstract/Free Full Text]

8. Hamilton KS, Gupta S, Knowlton AA. Estrogen and Regulation of Heat Shock Protein Expression in Female Cardiomyocytes: Cross-talk with NF{kappa}B Signaling. J Mol Cell Cardiol. 2004; 36: 579–586.[CrossRef]

9. Russell KS, Haynes MP, Caulin-Glaser T, Rosneck J, Sessa WC, Bender J. Estrogen stimulates heast shock protein 90 binding to endothelial nitric oxide synthase in human vascular endothelial cells. Effects on calcium sensitivity and NO release. J Biol Chem. 2000; 275: 5026–5030.[Abstract/Free Full Text]

10. Takahashi S, Mendelsohn ME. Synergistic Activation of Endothelial Nitric-oxide Synthase (eNOS) by HSP90 and Akt: calcium-independent eNOS activation involves formation of AN HSP90-Akt-CaM-bound eNOS complex. J Biol Chem. 2003; 278: 30821–30827.[Abstract/Free Full Text]

11. Chen JX, Meyrick B. Hypoxia increases HSP90 binding to eNOS via PI3K-Akt in porcine coronary artery endothelium. Lab Invest. 2004; 84: 182–190.[CrossRef][Medline] [Order article via Infotrieve]

12. Gupta S, Knowlton AA. Cytosolic HSP60, Hypoxia and Apoptosis. Circulation. 2002; 106: 2727–2733.[Abstract/Free Full Text]

13. Nakano M, Mann DL, Knowlton AA. Blocking the endogenous increase in HSP72 increases susceptibility to hypoxia and reoxygenation in isolated adult feline cardiocytes. Circulation. 1997; 95: 1523–1531.[Abstract/Free Full Text]

14. Sun L, Chang J, Kirchhoff SR, Knowlton AA. Activation of HSF and selective increase in heat shock proteins by acute dxamethasone treatment. Am J Physiol. 2000; 278: H1091–H1096.

15. Cornelussen RNM, Gupta S, Knowlton AA. Regulation of prostaglandin A1-induced heat shock protein expression in isolated cardiomyocytes. J Mol Cell Cardiol. 2001; 33: 1447–1454.[CrossRef][Medline] [Order article via Infotrieve]

16. Moissac M, Mustapha S, Greenberg AH, Kirshenbaum L. Bcl-2 activates the transcription factor NFkB through the degradation of the cytoplasmic inhibitor IkB. J Biol Chem. 1998; 273: 23946–23951.[Abstract/Free Full Text]

17. Tomita N, Morishita R, Tomita S, Yamamoto K, Aoki M, Matsushita H, Hayashi S, Higaki J, Ogihara T. Transcription factor decoy for nuclear factor-kappaB inhibits tumor necrosis factor-{alpha}-induced expression of interleukin-6 and intracellular adhesion molecule-1 in endothelial cells. J Hypertens. 1998; 16: 993–1000.[CrossRef][Medline] [Order article via Infotrieve]

18. Bielinska A, Shivdasani RA, Zhang L, Nabel GJ. Regulation of gene expression with double-stranded phosphorothioate oligonucleotides. Science. 1990; 250: 997–1000.[Abstract/Free Full Text]

19. Morishita R, Gibbons GH, Horiuchi M, Ellison KE, Nakajima M, Zhang L, Kaneda Y, Ogihara T, Dzau VJ. A gene therapy strategy using a transcription factor decoy of the E2F binding site inhibits smooth muscle proliferation in vivo. Proc Natl Acad Sci USA. 1995; 92: 5855–5859.[Abstract/Free Full Text]

20. Mendelsohn ME. Mechanisms of estrogen action in the cardiovascular system. J Steroid Biochem Mol Biol. 2000; 74: 337–343.[CrossRef][Medline] [Order article via Infotrieve]

21. Simoncini T, Genazzani AR, Liao JK. Nongenomic Mechanisms of Endothelial Nitric Oxide Synthase Activation by the Selective Estrogen Receptor Modulator Raloxifene. Circulation. 2002; 105: 1368–1373.[Abstract/Free Full Text]

22. Singleton DW, Feng Y, Burd CJ, Khan SA. Nongenomic activity and subsequent c-fos induction by estrogen receptor ligands are not sufficient to promote deoxyribonucleic acid synthesis in human endometrial adenocarcinoma cells. Endocrinology. 2003; 144: 121–128.[Abstract/Free Full Text]

23. Webb P, Nguyen P, Kushner PJ. Differential SERM Yeffects on corepressor binding dictate ER{alpha} activity in vivo. J Biol Chem. 2003; 278: 6912–6920.[Abstract/Free Full Text]

24. Suzuki K, Sawa Y, Kaneda Y, Ichikawa H, Shirakura R, Matsuda H. Overexpressed heat shock protein 70 attenuates hypoxic injury in coronary endothelial cells. J Mol Cell Cardiol. 1998; 30: 1129–1136.[CrossRef][Medline] [Order article via Infotrieve]

25. Mendelsohn ME. Nongenomic, estrogen receptor-mediated activation of endothelial nitric oxide synthase. Circ Res. 2000; 87: 677–682.[Abstract/Free Full Text]

26. Nadal A, Ropero AB, Laribi O, Maillet M, Fuentes E, Soria B. Nongenomic actions of estrogens and xenoestrogens by binding at a plasma membrane receptor unrelated to estrogen receptor {alpha} and estrogen receptor ß. Proc Natl Acad Sci USA. 2000; 97: 11603–11608.[Abstract/Free Full Text]

27. Ho KJ, Liao JK. Nonnuclear Actions of Estrogen. Arterioscler Thromb Vasc Biol. 2002; 22: 1952–1961.[Abstract/Free Full Text]

28. Geraldes P, Sirois MG, Tanguay JF. Specific Contribution of Estrogen Receptors on Mitogen-Activated Protein Kinase Pathways and Vascular Cell Activation. Circ Res. 2003; 93: 399–405.[Abstract/Free Full Text]

29. Chambliss KL, Yuhanna IS, Anderson RGW, Mendelsohn ME, Shaul PW. ERß has nongenomic action in caveolae. Mol Endocrinol. 2002; 16: 938–946.[Abstract/Free Full Text]

30. Haynes MP, Li L, Sinha D, Russell KS, Hisamoto K, Baron R, Collinge M, Sessa WC, Bender JR. Src Kinase mediates phosphatidylinositol 3-kinase/Akt-dependent rapid endothelial ntric-oxide synthase activation by estrogen. J Biol Chem. 2003; 278: 2118–2123.[Abstract/Free Full Text]

31. Jones WK, Brown M, Ren X, He S, McGuinness M. NF-kappaB as an integrator of diverse signaling pathways: the heart of myocardial signaling? Cardiovasc Toxicol. 2003; 3: 229–254.[CrossRef][Medline] [Order article via Infotrieve]

32. Omoya T, Shimizu I, Zhou Y, Okamura Y, Inoue H, Lu G, Itonaga M, Honda H, Nomura M, Ito S. Effects of idoxifene and estradiol on NF-{kappa}B activation in cultured rat hepatocytes undergoing oxidative stress. Liver Int. 2001; 21: 183–191.

33. Daosukho C, Kiningham K, Kasarskis E, Ittarat W, St. Clair DK. Tamoxifen enhancement of TNF-{alpha} induced MnSOD expression: modulation of NF-{kappa}B dimerization. Oncogene. 2002; 21: 3603–3610.[CrossRef][Medline] [Order article via Infotrieve]

34. Hsu SM, Chen YC, Jiang MC. 17[ß]-Estradiol inhibits tumor necrosis factor-[{alpha}]-induced nuclear factor-[kappa]B activation by increasing nuclear factor-[kappa]B p105 level in MCF-7 breast cancer cells. Biochem Biophys Res Commun. 2000; 279: 47–52.[CrossRef][Medline] [Order article via Infotrieve]

35. Speir E, Yu ZX, Takeda K, Ferrans VJ, Cannon III. Competition for p300 regulates transcription by estrogen receptors and nuclear factor-kB in human coronary smooth muscle cells. Circ Res. 2000; 87: 1006–1011.[Abstract/Free Full Text]

36. McMurray RW, Ndebele K, Hardy KJ, Jenkins JK. 17-[ß]-Estradiol suppresses IL-2 and IL-2 receptor. Cytokine. 2001; 14: 324–333.[CrossRef][Medline] [Order article via Infotrieve]

37. Koh KK. Effects of estrogen on the vascular wall: vasomotor function and inflammation. Cardiovasc Res. 2002; 55: 714–726.[Free Full Text]




This article has been cited by other articles:


Home page
J CARDIOVASC PHARMACOL THERHome page
C. L. Stebbins, J. P. Stice, C. M. Hart, F. N. Mbai, and A. A. Knowlton
Effects of Dietary Decosahexaenoic Acid (DHA) on eNOS in Human Coronary Artery Endothelial Cells
Journal of Cardiovascular Pharmacology and Therapeutics, December 1, 2008; 13(4): 261 - 268.
[Abstract] [PDF]


Home page
Physiol. GenomicsHome page
K. L. Hamilton, L. Lin, Y. Wang, and A. A. Knowlton
Effect of ovariectomy on cardiac gene expression: inflammation and changes in SOCS gene expression
Physiol Genomics, January 17, 2008; 32(2): 254 - 263.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
M. Nickerson, S. L. Kennedy, J. D. Johnson, and M. Fleshner
Sexual dimorphism of the intracellular heat shock protein 72 response
J Appl Physiol, August 1, 2006; 101(2): 566 - 575.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A.A. Knowlton
NF{kappa}B, heat shock proteins, HSF-1, and inflammation
Cardiovasc Res, January 1, 2006; 69(1): 7 - 8.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow All Versions of this Article:
24/9/1628    most recent
01.ATV.0000137188.76195.fbv1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hamilton, K. L.
Right arrow Articles by Knowlton, A.A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hamilton, K. L.
Right arrow Articles by Knowlton, A.A.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*ESTRADIOL
*TAMOXIFEN