This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: 24/12/2333    most recent 01.ATV.0000148007.06370.68v1 Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Febbraio, M. Articles by Silverstein, R. L. Search for Related Content PubMed PubMed Citation Articles by Febbraio, M. Articles by Silverstein, R. L. Related Collections Animal models of human disease Pathophysiology Cell biology/structural biology Gene expression Genetically altered mice Lipid and lipoprotein metabolism Mechanism of atherosclerosis/growth factors

(Arteriosclerosis, Thrombosis, and Vascular Biology. 2004;24:2333.)
© 2004 American Heart Association, Inc.

Atherosclerosis and Lipoproteins

Stem Cell Transplantation Reveals That Absence of Macrophage CD36 Is Protective Against Atherosclerosis

Maria Febbraio; Ella Guy; Roy L. Silverstein

From the Department of Cell Biology (M.F., R.L.S.), Lerner Research Institute, The Cleveland Clinic Foundation, Cleveland, Ohio; and the Department of Medicine (E.G.), Division of Hematology/Medical Oncology, Weill Medical College of Cornell University, New York, NY.

Correspondence to Maria Febbraio, PhD, Cell Biology, Lerner Research Institute, The Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, Ohio. E-mail febbram{at}ccf.org

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Objective— CD36 is expressed on multiple cell types and has numerous functions, a subset of which can impact on atherogenesis. In previous work, we demonstrated that CD36 absence was protective against lesion formation. The current objective was to determine whether absence of macrophage CD36 alone was protective.

Methods and Results— Lethal irradiation and stem cell transfer were used to create chimeric mice that did or did not express macrophage CD36 in the context of the Apo E-null model of atherosclerosis. After engraftment, mice were fed a Western diet for 12 weeks. White cell counts, plasma levels of lipoproteins, triacylglycerol, and nonesterified fatty acids were determined, and glucose tolerance tests were preformed. Lesion area was assessed quantitatively after oil red O staining. Mice lacking CD36 in macrophages alone were profoundly protected against atherosclerosis (88.1% reduction of lesion area throughout the aortic tree). Re-introduction of macrophage CD36 resulted in a 2.11-fold increase in lesion area. There were no differences in engraftment, macrophage recruitment, glucose tolerance, weight, and total, low-density lipoprotein, and high-density lipoprotein cholesterol among the groups. Lesions contained similar percent macrophage antigen-positive area.

Conclusion— Protection in this model is primarily caused by loss of CD36 macrophage function.

To determine whether absence of macrophage CD36 alone was protective against atherosclerosis, mice were lethally irradiated and reconstituted with CD36 wild-type or null stem cells in the context of Apo E-null mice lacking CD36 in macrophages alone were profoundly protected against atherosclerosis (88.1% reduction of lesion area).

Key Words: CD36 • atherosclerosis • Apo E-null mice • scavenger receptor • macrophages

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Cellular cholesterol homeostasis is tightly regulated such that cells have an adequate supply under varying dietary conditions.¹ For most cell types, excessive accumulation of cholesterol does not occur and would have toxic implications.² Macrophages, by virtue of their scavenger function, internalize cholesterol-laden modified lipoproteins. Uncontrolled cholesterol accumulation in macrophages may result as an adaptive mechanism in response to excessive lipid load and lead to foam cell formation. These appear grossly as the initial lesion in atherosclerosis, the fatty streak.³ Oxidative modification of low-density lipoprotein (LDL) has been hypothesized to be a key event in the conversion of LDL to a pro-atherogenic form recognized by macrophage scavenger receptors.^4,5 Thus, internalization of oxidized LDL (OxLDL) by macrophages is an early and potentially pivotal event which, if inhibited through intervention at the level of the scavenger receptor, may delay the atherosclerotic process.

Previous in vitro work has supported a significant role for the class B scavenger receptor, CD36, in atherogenesis.^6,7 We and others demonstrated that CD36 bound OxLDL in a saturable manner; binding, internalization, and degradation of OxLDL were increased substantially in CD36 transfected cells.^6–8 Regulation of CD36 expression was also highly suggestive of an important role in atherosclerosis.^9–15 Unlike the LDL receptor, which is downregulated by cellular cholesterol/cholesterol ester, expression of CD36 was enhanced by cellular cholesterol/cholesterol ester content and downregulated by its depletion.¹⁰ We also showed that IL-4 and macrophage-colony stimulating factor cytokines present in atherosclerotic lesions, induced human monocyte expression of CD36 mRNA and protein, and that greater than half of the binding of OxLDL by human monocyte-derived macrophages was inhibited by specific anti-CD36 antibodies.^7,11,12 Other studies have demonstrated that lipid-laden macrophages in human atherosclerotic lesions exhibited strong immunoreactivity to CD36, whereas in these same lesions there were low or moderate levels of immunoreactivity to the class A scavenger receptors.¹⁶ Genetic polymorphisms have been identified in Asian and African populations, which can lead to deficient or absent expression of CD36.^17,18 Monocyte-derived macrophages isolated from homozygous mutant patients bound 40% less OxLDL and accumulated 40% less cholesterol ester than cells derived from normal controls.¹⁹ More recently, using macrophages derived from mice lacking both CD36 and the class A scavenger receptors, we demonstrated that the predominant receptor involved in recognition of pro-atherogenic LDL (either mildly oxidized by copper sulfate or oxidized by the myeloperoxide/hydrogen peroxide/nitrite system) was CD36; the combined effect of absence of both scavenger receptors was not significantly greater than absence of CD36 alone.⁵

CD36 is expressed on multiple cell types in addition to monocytes/macrophages: adipocytes, skeletal muscle, platelets, megakaryocytes, microvascular endothelium, retinal pigment epithelium, and microglia.^20–22 CD36 recognizes a broad array of ligands including OxLDL, anionic phospholipids, apoptotic cells, thrombospondin, collagen, effete photoreceptors, fatty acids, fibril ß-amyloid deposits, and Plasmodium falciparum-infected erythrocytes.^20–22 Unlike the class A receptors, which recognize the oxidized apoprotein portion of the lipoprotein particle, CD36 binds to the lipid moiety of OxLDL, and is competed by anionic phospholipids.^7,23 Recently, the specific ligands for CD36 on OxLDL have been defined as a family of structurally related oxidized choline glycerophospholipids.^24,25 It is important to note that scavenger receptors are expressed on tissues other than macrophages that may effect disease outcome. This is especially true of CD36: fat and muscle are considered to be key tissues affecting insulin resistance, and both express CD36. CD36 is involved in fatty acid transport, and this has implications for fatty acid, glucose, and lipoprotein metabolism, which in turn has the potential to impact on atherosclerosis. CD36 is also expressed on microvascular endothelium, where it mediates a pro-apoptotic, anti-angiogenic response to thrombospondin-1, and this may also impact lesion development.²⁶

In a previous study, we observed that CD36-null mice crossed to the apo E-null (Apo E⁰) strain had a dramatic decrease in aortic lesion area.²⁷ Interestingly, these results were confirmed indirectly by a study of the mechanism by which drugs used to treat HIV accelerated atherosclerosis.²⁸ One such drug, ritonavir, upregulates CD36 and promotes lesion progression in the Apo E⁰ mouse. This effect was abrogated in Apo E⁰/CD36⁰ mice, and the authors noted a 75% to 80% difference in lesion size in the 2 strains when treated with ritonavir. Their results indicate that upregulation of CD36 by a drug mimics upregulation of CD36 in the subendothelial space by pro-inflammatory factors, which also convert LDL into a ligand for CD36 and initiate a feed-forward loop in macrophages.^14,15 The degree of protection afforded by absence of CD36 was nearly identical to our results.²⁷

The current study was designed to differentiate the role of CD36 as a macrophage scavenger receptor from other functions it has in endothelium, muscle, adipocytes, and in regulating fatty acid transport and angiogenesis. Using stem cell transfer, the genotype of hematopoietic cells, including monocytes/macrophages, was exchanged in the background of presence or absence of CD36 in the Apo E⁰ model. Our results suggest rather conclusively that in the Apo E⁰ model, absence of macrophage CD36 is overwhelmingly protective, regardless of CD36 expression elsewhere, and indicates that specifically targeting macrophage CD36 can have important therapeutic implications.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Animals
CD36/Apo E double-null (CD36⁰/Apo E⁰) and Apo E⁰ mice were derived from a cross between CD36⁰ (created in our laboratory) and Apo E⁰ mice (Taconic, Germantown, NY). The strains are background-matched. The lines were established from littermates after the cross of heterozygotes. The genetic background is 96.9% C57Bl/6 and 3.1% 129Sv. Procedures were Institutional Animal Case and Use Committee–approved and performed in an Association for Assessment and Accreditation of Laboratory Animal Care International–accredited facility.

Stem Cell Transfer
One week before transplantation until 2 weeks after transplantation, recipient mice received 100 mg/L neomycin and 10 mg/L polymyxin B sulfate in acidified water. At 6 weeks of age, Apo E⁰ and CD36⁰/Apo E⁰ mice were lethally irradiated (9 gray from a cesium gamma source; Gamma Cell 40). Four hours later, 1x10⁷ bone marrow cells (from background- and gender-matched mice 6 to 12 weeks of age) were injected into the tail vein. Recipient mice received normal chow for 4 weeks. For the next 12 weeks, mice were fed a high-fat diet: 21% (wt/wt) adjusted calories from fat and 1.5% (wt/wt) cholesterol (no cholate; Harlan Teklad, TD 88137).

Assessment of Chimerism
Resident macrophages were collected by phosphate-buffered saline lavage. DNA was purified after proteinase K lysing by phenol–chloroform extraction/ethanol precipitation. For polymerase chain reaction of CD36, primers for the wild-type allele were: 5' CD36: CAGCTCATACATTGCTGTTTATGCATG; 3' CD36: GGTACAATCACAGTGTTTTCTACGTGG (expected product 600 bp). For the null allele, the same 5' primer was used and the 3' primer was CCGCTTCCTCGTGCTTTACGGTATC (expected product 800 bp). With all 3 primers present, polymerase chain reaction conditions were: 94°C, 1 minute; 65°C, 1 minute; and 70°C, 2 minutes, for 30 cycles.

Polymerase chain reaction at 12 weeks after irradiation showed varying degrees of chimerism, as has been reported by others (Figure I, available online at http://atvb.ahajournals.org). The majority of the animals screened had predominantly donor-derived marrow.

Assessment of Engraftment
Male mice receiving heterogeneic marrow were assessed 14 weeks after irradiation (n=6/group) by flow cytometry to determine total white blood cell count. Equal volumes of blood were collected from the tail vein into heparinized tubes. After red cells were lysed, 10 000 Flow-Check Fluorospheres (Beckman Coulter) were added for volume quantification. Gates were set to include all white cells.

Morphometry
Hearts were perfused with phosphate-buffered saline and buffered formalin. The entire aorta from the heart, extending 5 to 10 mm after bifurcation of the iliacs and including the subclavian, right, and left carotid arteries, was dissected free of fat and opened longitudinally. After staining with oil red O, aortae were scanned and percent lesion area determined using Adobe Photoshop. Lesion area is expressed as percent±SE.

Assessment of Lesion Morphology
Hearts from male mice representing each group were infiltrated with 30% sucrose after fixation and embedded in OCT. Ten-micron sections were cut at the level of the aortic sinus. Slides were either stained with oil red O or processed for immunohistochemistry with a macrophage-specific antibody (F4/80; Abcam), and counterstained with aqueous hematoxylin. Digital images of lesions at 200x magnification (Magnafire software) were assessed using Adobe Photoshop for percent oil red O or F4/80 positivity.

Glucose Tolerance Testing
Mice fasted overnight received an intraperitoneal injection of 1.5 mg glucose per gram of body weight. Tail vein blood was collected at intervals up to 120 minutes and glucose measured using a One Touch Basic glucometer (Johnson & Johnson). Area under the curve was calculated using Graph Pad Prism 4 software, with individual baseline values set to control for the fasting hypoglycemia of mice lacking CD36.

Plasma Analyses
One week before euthanization, mice were fasted and blood collected for analysis. Total, LDL, and high-density lipoprotein (HDL) cholesterol and triacylglycerol were determined using kits from Sigma Diagnostics. (Note: the EZ-HDL cholesterol kit does not involve precipitation of HDL, which proved unreliable for determination of HDL levels in Apo E⁰ mice.) Nonesterified fatty acid concentration was determined using a kit from Wako.

Macrophage Recruitment Assay
Sterile thioglycollate broth (4%; Sigma) was injected into the peritoneal cavity of male mice (2 mL, n=4) receiving heterogeneic marrow 4 days before euthanization, 16 weeks after irradiation. Total elicited macrophages were collected by phosphate-buffered saline lavage and counted using a hemocytometer.

Statistical Analyses
Significance was determined by Student unpaired t test before irradiation and ANOVA, followed by Bonferroni multiple comparison test after irradiation. P<0.05 was considered significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Apo E⁰ mice receiving Apo E⁰ bone marrow had 3.2-fold greater lesion area compared with CD36⁰/Apo E⁰ mice receiving CD36⁰/Apo E⁰ marrow (Figure 1A, first bar versus third bar: 16.51±3.045% (n=12) versus 5.17±1.248%; n=18; P=0.01). This represents a 68.7% reduction in lesion in CD36⁰/Apo E⁰ mice and compares well with our previous study in nonirradiated Apo E⁰ and CD36⁰/Apo E⁰ mice, in which we found 76% reduction in lesion area in the CD36⁰/Apo E⁰ group overall. In terms of gender, there was 3.87-fold greater lesion area in Apo E⁰ males versus CD36⁰/Apo E⁰ males receiving syngeneic marrow (Figure 1B, first bar versus third bar: 9.83±1.736% versus 2.539±0.999%; P<0.05) and 2.55-fold greater lesion area in Apo E⁰ females versus CD36⁰/Apo E⁰ females receiving syngeneic marrow (Figure 1C, first bar versus third bar: 19.85±4.053% versus 7.79±1.974%; P<0.01). The most exciting finding from these studies, however, was that absence of CD36 in macrophages alone was profoundly protective: overall, Apo E⁰ mice receiving CD36⁰/Apo E⁰ marrow had an 88.1% decrease in lesion area when compared with Apo E⁰ mice receiving syngeneic marrow (Figure 1A, second bar versus first bar: 1.96±0.384 (n=29) versus 16.51±3.045%; n=12; P<0.001). The parallel study supported these results: there was a 2.11-fold increase in lesion development when CD36 expression was restored in macrophages alone (CD36⁰/Apo E⁰ mice receiving Apo E⁰ marrow versus CD36⁰/Apo E⁰ mice receiving syngeneic marrow) (Figure 1A, fourth bar versus third bar: 10.91±1.362, n=25 versus 5.165±1.248, n=18; P=0.05). If the data were separated according to gender, we observed a 77.6% reduction in male Apo E⁰ mice receiving CD36⁰/Apo E⁰ marrow when compared with male Apo E⁰ mice receiving Apo E⁰ marrow (Figure 1B, second bar versus first bar: 2.216±0.567% versus 9.83±1.736%; P<0.01) and a 91.9% reduction in female Apo E⁰ mice receiving CD36⁰/Apo E⁰ marrow when compared with female Apo E⁰ mice receiving Apo E⁰ marrow (Figure 1C, second bar versus first bar: 1.598±0.473% versus 19.85±4.053%; P=0.001). In male CD36⁰/Apo E⁰ mice receiving Apo E⁰ marrow, there was a 3.69-fold increase in lesion area when compared with male CD36⁰/Apo E⁰ mice receiving CD36⁰/Apo E⁰ marrow (Figure 1B, fourth bar versus third bar: 9.362±1.633% versus 2.539±0.999%; P=0.01); in female CD36⁰/Apo E⁰ mice receiving Apo E⁰ marrow, there was a 1.62-fold increase in lesion area when compared with female CD36⁰/Apo E⁰ mice receiving CD36⁰/Apo E⁰ marrow (Figure 1C, fourth bar versus third bar: 12.59±2.187% versus 7.791±1.974%; P>0.05). Representative aortae are shown in Figure 1D and 1E.

View larger version (27K): [in this window] [in a new window]   Figure 1. Morphometric analysis of lesion area throughout the aortic tree. Six-week-old Apo E0 and CD360/Apo E0 mice were lethally irradiated and reconstituted with Apo E0 or CD360/Apo E0 stem cells. Mice were fed normal chow for 4 weeks, followed by a Western diet for 12 weeks. At euthanization, the aortic tree was dissected and stained enface with oil red O. Lesion area was measured and is presented as percent total aortic area. Stem cells from CD360/Apo E0 mice provided significant protection against atherosclerotic lesion formation in Apo E0 mice. Conversely, stem cells from Apo E0 mice resulted in increased aortic lesion area in CD360/Apo E0 mice. The genotypes of the bone marrow engrafted are indicated under each bar. The genotype of the recipient is indicated by bar color (black bars=Apo E0; white bars=Apo E0/CD36) and is also written above the bars. A, Lesion area in both male and female mice. B, Lesion area in male mice. C, Lesion area in female mice. D, Enface oil red O-stained representative aortae. Male Apo E0 mice receiving Apo E0 bone marrow: 14.9%. Male Apo E0 mice receiving CD360/Apo E0 bone marrow: 2.18%. Female Apo E0 mice receiving Apo E0 bone marrow: 17.96%. Female Apo E0 mice receiving CD360/Apo E0 bone marrow: 5.2%. E, Enface oil red O-stained representative aortae. Male CD360/Apo E0 mice receiving CD360/Apo E0 bone marrow: 3.78%. Male CD360/Apo E0 mice receiving Apo E0 bone marrow: 11.24%. Female CD360/Apo E0 mice receiving CD360/Apo E0 bone marrow: 5.82%. Female CD360/Apo E0 mice receiving Apo E0 bone marrow: 18.2%

Extensive analyses were performed to rule out an effect of irradiation and reconstitution with bone marrow-derived stem cells on parameters such as weight gain, plasma glucose, and lipid metabolism. Before irradiation, baseline values of weight, cholesterol, triacylglycerol, glucose, and nonesterified fatty acids were determined (Table I, available online at http://atvb.ahajournals.org). CD36⁰/Apo E⁰ male mice were significantly heavier and had significantly higher triacylglycerol and nonesterified fatty acid levels compared with Apo E⁰ male mice. Both male and female CD36⁰/Apo E⁰ mice had significantly higher total cholesterol levels and fasting hypoglycemia as compared with Apo E⁰ mice. The increased weight in the CD36⁰/Apo E⁰ males may reflect many parameters, including litter size, which was not controlled for in this study. The increased cholesterol, triacylglycerol and fatty acids, and hypoglycemia may be attributed to the phenotype of absence of CD36 in its capacity as a fatty acid transporter, and were noted previously in the CD36-null. As demonstrated by fast protein liquid chromatography analysis in a previously published study, excess triacylglycerol in CD36⁰/Apo E⁰ mice was contained within the very-low-density lipoprotein fraction, whereas excess cholesterol was contained within the very-low-density lipoprotein and LDL fractions. These studies indicated that CD36⁰/Apo E⁰ mice had fatty acid and lipoprotein profiles that may be considered more pro-atherogenic as compared with Apo E⁰ mice.

Before irradiation, both male and female Apo E⁰ and CD36⁰/Apo E⁰ mice cleared a bolus of glucose with similar kinetics (Figure IIA and IIB, available online at http://atvb.ahajournals.org), and there were no significant differences in area under the curve. After irradiation and 8 weeks after the start of the high-fat diet, glucose tolerance testing was repeated in the different groups of mice, and there still were no significant differences in area under the curve (Figure IIC and IID).

At euthanization, there were no significant differences in weight, total cholesterol, HDL cholesterol, LDL cholesterol, and nonesterified fatty acids among the groups (Table II, available online at http://atvb.ahajournals.org). There were significant differences in triacylglycerol in female mice. There were significantly higher levels of triacylglycerol in Apo E⁰ females receiving Apo E⁰ marrow when compared with Apo E⁰ females receiving CD36⁰/Apo E⁰ marrow or CD36⁰/Apo E⁰ females receiving CD36⁰/Apo E⁰ marrow. CD36⁰/Apo E⁰ mice of both sexes retained their fasting hypoglycemia after irradiation, regardless of genotype of bone marrow received.

To rule out possible differences in stem cell engraftment, we compared total white blood counts in mice (n=6/group) 14 weeks after irradiation. Apo E⁰ mice receiving CD36⁰/Apo E⁰ bone marrow had 5981±689 white blood cells per microliter of blood compared with 6170±578 white blood cells per microliter in CD36⁰/Apo E⁰ mice receiving Apo E⁰ marrow. These values do not differ statistically and rule out this as a possible explanation for the decrease in lesions.

We also ruled out differences in macrophage recruitment as a potential explanation of our results in 2 ways. First, we used thioglycollate elicitation of peritoneal macrophages 16 weeks after irradiation as an assay of macrophage recruitment to a pro-inflammatory stimulus (n=4). In Apo E⁰ mice receiving CD36⁰/Apo E⁰ bone marrow, we collected a total of 3.05±0.21x10⁷ macrophages. This was not different statistically from the 3.19±0.15x10⁷ macrophages collected from CD36⁰/Apo E⁰ mice receiving Apo E⁰ marrow.

To rule out the possibility that after irradiation there were differences in the ability of macrophages to migrate into lesions, hearts from a random sample of male mice from each group were sectioned at the level of the aortic sinus, stained with oil red O or immunohistochemically with a macrophage-specific antibody, and assessed microscopically. There were no obvious differences in lesion morphology among the groups; in all cases, a substantial proportion (mean percent area: 47 to 60) of the lesion consisted of oil red O-positive lipid. Apo E⁰ mice receiving Apo E⁰ marrow had the greatest percent oil red O lesion area, and this was statistically significant when compared with Apo E⁰ mice receiving CD36⁰/Apo E⁰ marrow and CD36⁰/Apo E⁰ receiving CD36⁰/Apo E⁰ marrow (Figure 2A). CD36⁰/Apo E⁰ receiving Apo E⁰ also had significantly greater oil red O-positive lesion area when compared with these 2 groups. However, there were no significant differences in F4/80 positivity among the groups (mean percent area: 15.31 to 17.13) (Figure 2B). Thus, our data strongly suggest that differences in lesion development were not related to a defect in macrophage stem cell engraftment after irradiation in any of the groups, and instead appear to reflect differences in lipid accumulation within individual macrophages.

View larger version (19K): [in this window] [in a new window]   Figure 2. Morphology of lesions. Hearts were infiltrated with 30% sucrose after fixation in 10% formalin and embedded in OCT. Ten-micron sections were cut at the level of the aortic sinus, stained with oil red O or assayed immunohistochemically with an antibody specific for macrophages (F4/80; Abcam), and counterstained with aqueous hematoxylin. Morphometric analysis was accomplished using Adobe Photoshop. Results represent the mean±SE. A, Oil red O-positive lesion area. * P<0.05, **P<0.05. B, Macrophage antigen-positive lesion area.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
In previous work, we demonstrated that absence of CD36 had a profound effect on atherosclerotic lesion formation in the Apo E⁰ model.²⁷ Because CD36 expression is broad and has functions other than that of a scavenger receptor, there was the potential that these other roles were involved in the observed protective effect. In the present study, we controlled for the other functions of CD36 by transplanting hematopoietic stem cells, allowing us to isolate the scavenger receptor function of macrophage CD36 from most other functions. Our data provide strong support for the hypothesis that inhibition of CD36 function in macrophages alone will have large therapeutic impact.

This contention is supported in 2 ways. Absence of CD36 in macrophages transplanted into mice that expressed CD36 in all other nonhematopoietic tissues resulted in an 88.1% decrease in aortic lesions. Alternatively, presence of CD36 only in macrophages resulted in a 52.7% increase in lesion area. The lesion area in this group was nearly indistinguishable from atherosclerosis in Apo E⁰ mice transplanted with syngeneic marrow. These results provide strong rationale for therapeutic blockade of macrophage CD36 to slow atherogenesis.

There is a nonstatistically significant trend in the data that suggests that absence of CD36 in macrophages is more protective than whole-body absence of CD36. This intriguing result points to the multifaceted nature of this protein. It is possible that CD36 expression and function as a fatty acid transporter in adipocytes and muscle may provide a level of protection against atherosclerosis. For example, perhaps use of lipoproteins by these tissues decreases potential for oxidation.

It is theoretically possible that the effect we observed is a result of endothelial cell CD36 rather than macrophage CD36. We rule this out for several reasons. First, CD36 is expressed on microvascular endothelium and, thus, the vessels examined are not likely to express endothelial CD36. Second, 0.1% of in vivo endothelium turns over each day. Even if we were to assume that all new endothelium was stem cell-derived (which is probably not the case), 4 months after irradiation <15% of the endothelium in irradiated mice would be donor-derived. The dramatic nature of our results, we believe, is more consistent with an effect on macrophages, although an additional effect from CD36 absence on endothelial cells is also possible.

It is also possible that our results reflect differences in stem cell engraftment (and thus macrophage number) or macrophage recruitment because of a mismatch of the genotype of donor and recipient. We compared total white cell number between Apo E⁰ mice receiving CD36⁰/Apo E⁰ marrow with that of CD36⁰/Apo E⁰ receiving Apo E⁰ marrow and observed no statistical difference. We also found no difference in macrophage numbers in the peritoneal cavity after thioglycollate elicitation in these chimeras, indicating that there is no defect in macrophage ability to detect, react, and traffic to the site of an inflammatory stimulus caused by genotype mismatch. Finally, quantitative assessment of oil red O-positive lipid in lesion and area positive for a macrophage-specific antigen suggest similarity in overall lesion morphology but a difference in lipid accumulation.

In the studies contained in this report, we saw very few differences between the groups of mice after irradiation, with the exception of fasting hypoglycemia in CD36⁰ hosts. Nonesterified fatty acids and total, HDL, and LDL cholesterol showed no statistically significant differences. Apo E⁰ female mice receiving Apo E⁰ bone marrow had significantly higher triacylglycerol levels when compared with CD36⁰/Apo E⁰ females receiving Apo E⁰ or CD36⁰/Apo E⁰ marrow. However, Apo E⁰ females receiving CD36⁰/Apo E⁰ marrow had similar triacylglycerol levels to CD36⁰/Apo E⁰ females receiving Apo E⁰ marrow, yet the lesion data were strictly dependent on the genotype of the engrafted cells. This strongly argues against alterations in plasma triacylglycerol levels playing a significant role. After irradiation and on the Western diet, all groups of mice showed some degree of insulin resistance. However, the absence of significant differences between the groups again strongly argues against an effect on pathogenesis in any one group.

The mechanism of protection afforded by absence of CD36 may be more than simple lack of macrophage uptake of OxLDL. OxLDL promotes a pro-inflammatory phenotype in macrophages and endothelial cells. Absence of CD36 may indirectly delay lesion progression by interfering with the expression of pro-inflammatory products, thereby delaying or inhibiting recruitment of other cells and secretion of cytokines and pro-oxidative factors involved in atherogenesis. We and others have shown that OxLDL and 2 oxidized linoleic acid metabolites, 9-HODE and 13-HODE, can stimulate CD36 gene expression via a mechanism involving activation of peroxisome proliferator-activated receptor (PPAR)-, a member of the nuclear hormone superfamily, which acts as a transcriptional regulator of genes encoding proteins involved in lipid and fatty acid metabolism/regulation, as well as inflammation.^{13–15,29–32} Absence of CD36 negates this feed-forward loop and may not only alter the lipid metabolism state of the macrophage but also alter the inflammatory state of these cells, and this may account for the profound decrease in lesion formation observed.

	Acknowledgments

 
This work was supported by grants from the National Heart, Lung, and Blood Institute of the NIH, R01 HL070083, (M.F.), and P01 HL 72942 (R.L.S.). We thank Jonathan Smith and his laboratory (CCF) for excellent technical expertise in the sectioning of the aortic sinus.

Received September 17, 2003; accepted October 7, 2004.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Loewen CJ, Levine TP. Cholesterol homeostasis: not until the SCAP lady INSIGs. Curr Biol. 2002; 12: R779–R781.[CrossRef][Medline] [Order article via Infotrieve]

2. Tabas I. Consequences of cellular cholesterol accumulation: basic concepts and physiological implications. J Clin Invest. 2002; 110: 905–911.[CrossRef][Medline] [Order article via Infotrieve]

3. Lusis AJ. Atherosclerosis. Nature. 2000; 407: 233–241.[CrossRef][Medline] [Order article via Infotrieve]

4. Steinberg D. Low density lipoprotein oxidation and its pathobiological significance. J Biol Chem. 1997; 272: 20963–20966.[Free Full Text]

5. Kunjathoor VV, Febbraio M, Podrez EA, Moore KJ, Andersson L, Koehn S, Rhee JS, Silverstein R, Hoff HF, Freeman MW. Scavenger receptors class A-I/II and CD36 are the principal receptors responsible for the uptake of modified low density lipoprotein leading to lipid loading in macrophages. J Biol Chem. 2002; 277: 49982–49988.[Abstract/Free Full Text]

6. Endemann G, Stanton LW, Madden KS, Bryant CM, White RT, Protter AA. CD36 is a receptor for oxidized low density lipoprotein. J Biol Chem. 1993; 268: 11811–11816.[Abstract/Free Full Text]

7. Nicholson AC, Pearce SFA, Silverstein RL. Oxidized LDL binds to CD36 on human monocyte-derived macrophages and transfected cell lines. Evidence implicating the lipid moiety of the lipoprotein as the binding site. Arterioscler Thromb Vasc Biol. 1995; 15: 269–275.[Abstract/Free Full Text]

8. Podrez EA, Febbraio M, Sheibani N, Schmitt D, Silverstein RL, Hajjar DP, Cohen PA, Frazier WA, Hoff HF, Hazen SL. Macrophage scavenger receptor CD36 is the major receptor for LDL modified by monocyte-generated reactive nitrogen species. J Clin Invest. 2000; 105: 1095–1108.[Medline] [Order article via Infotrieve]

9. Han J, Hajjar DP, Febbraio M, Nicholson AC. Native and modified low density lipoproteins increase the functional expression of the macrophage class B scavenger receptor, CD36. J Biol Chem. 1997; 272: 21654–21659.[Abstract/Free Full Text]

10. Han J, Hajjar DP, Tauras JM, Nicholson AC. Cellular cholesterol regulates expression of the macrophage type B scavenger receptor, CD36. J Lipid Res. 1999; 40: 830–838.[Abstract/Free Full Text]

11. Huh HY, Pearce SF, Yesner LM, Schindler JL, Silverstein RL. Regulated expression of CD36 during monocyte-to-macrophage differentiation: potential role of CD36 in foam cell formation. Blood. 1996; 87: 2020–2028.[Abstract/Free Full Text]

12. Yesner LM, Huh HY, Pearce SF, Silverstein RL. Regulation of monocyte CD36 and thrombospondin-1 expression by soluble mediators. Arterioscler Thromb Vasc Biol. 1996; 16: 1019–1025.[Abstract/Free Full Text]

13. Han J, Hajjar DP, Tauras JM, Feng J, Gotto AM, Jr., Nicholson AC. Transforming growth factor-ß1 (TGF-ß1) and TGF-ß2 decrease expression of CD36, the type B scavenger receptor, through mitogen-activated protein kinase phosphorylation of peroxisome proliferator-activated receptor-. J Biol Chem. 2000; 275: 1241–1246.[Abstract/Free Full Text]

14. Nagy L, Tontonoz P, Alvarez JG, Chen H, Evans RM. Oxidized LDL regulates macrophage gene expression through ligand activation of PPAR. Cell. 1998; 93: 229–240.[CrossRef][Medline] [Order article via Infotrieve]

15. Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM. PPAR promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell. 1998; 93: 241–252.[CrossRef][Medline] [Order article via Infotrieve]

16. Nakagawa-Toyama Y, Yamashita S, Miyagawa J, Nishida M, Nozaki S, Nagaretani H, Sakai N, Hiraoka H, Yamamori K, Yamane T, Hirano K, Matsuzawa Y. Localization of CD36 and scavenger receptor class A in human coronary arteries–a possible difference in the contribution of both receptors to plaque formation. Atherosclerosis. 2001; 156: 297–305.[CrossRef][Medline] [Order article via Infotrieve]

17. Gelhaus A, Scheding A, Browne E, Burchard GD, Horstmann RD. Variability of the CD36 gene in West Africa. Hum Mutat. 2001; 18: 444–450.[CrossRef][Medline] [Order article via Infotrieve]

18. Yanai H, Chiba H, Fujiwara H, Morimoto M, Abe K, Yoshida S, Takahashi Y, Fuda H, Hui SP, Akita H, Kobayashi K, Matsuno K. Phenotype-genotype correlation in CD36 deficiency types I and II. Thromb Haemost. 2000; 84: 436–441.[Medline] [Order article via Infotrieve]

19. Nozaki S, Kashiwagi H, Yamashita S, Nakagawa T, Kostner B, Tomiyama Y, Nakata A, Ishigami M, Miyagawa J, Kameda-Takemura K, et al. Reduced uptake of oxidized low density lipoproteins in monocyte-derived macrophages from CD36-deficient subjects. J Clin Invest. 1995; 96: 1859–1865.

20. Febbraio M, Hajjar DP, Silverstein RL. CD36: a class B scavenger receptor involved in angiogenesis, atherosclerosis, inflammation, and lipid metabolism. J Clin Invest. 2001; 108: 785–791.[CrossRef][Medline] [Order article via Infotrieve]

21. El Khoury J, Hickman SE, Thomas CA, Cao L, Silverstein SC, Loike JD. Scavenger receptor-mediated adhesion of microglia to beta-amyloid fibrils. Nature. 1996; 382: 716–719.[CrossRef][Medline] [Order article via Infotrieve]

22. El Khoury JB, Moore KJ, Means TK, Leung J, Terada K, Toft M, Freeman MW, Luster AD. CD36 mediates the innate host response to beta-amyloid. J Exp Med. 2003; 197: 1657–1666.[Abstract/Free Full Text]

23. Ryeom SW, Silverstein RL, Scotto A, Sparrow JR. Binding of anionic phospholipids to retinal pigment epithelium may be mediated by the scavenger receptor CD36. J Biol Chem. 1996; 271: 20536–20539.[Abstract/Free Full Text]

24. Podrez EA, Poliakov E, Shen Z, Zhang R, Deng Y, Sun M, Finton PJ, Shan L, Gugiu B, Fox PL, Hoff HF, Salomon RG, Hazen SL. Identification of a novel family of oxidized phospholipids that serve as ligands for the macrophage scavenger receptor CD36. J Biol Chem. 2002; 277: 38503–38516.[Abstract/Free Full Text]

25. Podrez EA, Hoppe G, O’Neil J, Hoff HF. Phospholipids in oxidized LDL not adducted to apoB are recognized by the CD36 scavenger receptor. Free Radic Biol Med. 2003; 34: 356–364.[CrossRef][Medline] [Order article via Infotrieve]

26. Jimenez B, Volpert OV, Crawford SE, Febbraio M, Silverstein RL, Bouck N. Signals leading to apoptosis-dependent inhibition of neovascularization by thrombospondin-1. Nat Med. 2000; 6: 41–48.[CrossRef][Medline] [Order article via Infotrieve]

27. Febbraio M, Podrez EA, Smith JD, Hajjar DP, Hazen SL, Hoff HF, Sharma K, Silverstein RL. Targeted disruption of the class B scavenger receptor CD36 protects against atherosclerotic lesion development in mice. J Clin Invest. 2000; 105: 1049–1056.[Medline] [Order article via Infotrieve]

28. Dressman J, Kincer J, Matveev SV, Guo L, Greenberg RN, Guerin T, Meade D, Li XA, Zhu W, Uittenbogaard A, Wilson ME, Smart EJ. HIV protease inhibitors promote atherosclerotic lesion formation independent of dyslipidemia by increasing CD36-dependent cholesteryl ester accumulation in macrophages. J Clin Invest. 2003; 111: 389–397.[CrossRef][Medline] [Order article via Infotrieve]

29. Plutzky J. The potential role of peroxisome proliferator-activated receptors on inflammation in type 2 diabetes mellitus and atherosclerosis. Am J Cardiol. 2003; 92: 34J–41J.[CrossRef][Medline] [Order article via Infotrieve]

30. Blanquart C, Barbier O, Fruchart JC, Staels B, Glineur C. Peroxisome proliferator-activated receptors: regulation of transcriptional activities and roles in inflammation. J Steroid Biochem Mol Biol. 2003; 85: 267–273.[CrossRef][Medline] [Order article via Infotrieve]

31. Nencioni A, Wesselborg S, Brossart P. Role of peroxisome proliferator-activated receptor and its ligands in the control of immune responses. Crit Rev Immunol. 2003; 23: 1–13.[CrossRef][Medline] [Order article via Infotrieve]

32. Tham DM, Wang YX, Rutledge JC. Modulation of vascular inflammation by PPARs. Drug News Perspect. 2003; 16: 109–116.[CrossRef][Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				C. Erridge CD36: promotion from scavenger receptor to mediator of migration? Cardiovasc Res, July 1, 2009; 83(1): 5 - 6. [Full Text] [PDF]

				D. Harb, K. Bujold, M. Febbraio, M. G. Sirois, H. Ong, and S. Marleau The role of the scavenger receptor CD36 in regulating mononuclear phagocyte trafficking to atherosclerotic lesions and vascular inflammation Cardiovasc Res, July 1, 2009; 83(1): 42 - 51. [Abstract] [Full Text] [PDF]

				R. L. Silverstein and M. Febbraio CD36, a Scavenger Receptor Involved in Immunity, Metabolism, Angiogenesis, and Behavior Sci. Signal., May 26, 2009; 2(72): re3 - re3. [Abstract] [Full Text] [PDF]

				M. J. Lipinski, J. C. Frias, V. Amirbekian, K. C. Briley-Saebo, V. Mani, D. Samber, A. Abbate, J. G. S. Aguinaldo, D. Massey, V. Fuster, et al. Macrophage-Specific Lipid-Based Nanoparticles Improve Cardiac Magnetic Resonance Detection and Characterization of Human Atherosclerosis. J. Am. Coll. Cardiol. Img., May 1, 2009; 2(5): 637 - 647. [Abstract] [Full Text] [PDF]

				R. L. SILVERSTEIN Inflammation, atherosclerosis, and arterial thrombosis: Role of the scavenger receptor CD36 Cleveland Clinic Journal of Medicine, April 1, 2009; 76(Suppl_2): S27 - S30. [Abstract] [Full Text] [PDF]

				B. Boyanovsky, M. Zack, K. Forrest, and N. R. Webb The Capacity of Group V sPLA2 to Increase Atherogenicity of ApoE-/- and LDLR-/- Mouse LDL In Vitro Predicts its Atherogenic Role In Vivo Arterioscler. Thromb. Vasc. Biol., April 1, 2009; 29(4): 532 - 538. [Abstract] [Full Text] [PDF]

				A. B. Reiss, D. W. Wan, K. Anwar, J. T. Merrill, P. A. Wirkowski, N. Shah, B. N. Cronstein, E. S. L. Chan, and S. E. Carsons A BRIEF COMMUNICATION: Enhanced CD36 Scavenger Receptor Expression in THP-1 Human Monocytes in the Presence of Lupus Plasma: Linking Autoimmunity and Atherosclerosis Experimental Biology and Medicine, March 1, 2009; 234(3): 354 - 360. [Abstract] [Full Text] [PDF]

				A. Soro-Paavonen, A. M.D. Watson, J. Li, K. Paavonen, A. Koitka, A. C. Calkin, D. Barit, M. T. Coughlan, B. G. Drew, G. I. Lancaster, et al. Receptor for Advanced Glycation End Products (RAGE) Deficiency Attenuates the Development of Atherosclerosis in Diabetes Diabetes, September 1, 2008; 57(9): 2461 - 2469. [Abstract] [Full Text] [PDF]

				X. Jin, T. S. Ha, and D. P. Smith SNMP is a signaling component required for pheromone sensitivity in Drosophila PNAS, August 5, 2008; 105(31): 10996 - 11001. [Abstract] [Full Text] [PDF]

				V. Luangrath, M. R. Brodeur, D. Rhainds, and L. Brissette Mouse CD36 Has Opposite Effects on LDL and Oxidized LDL Metabolism In Vivo Arterioscler. Thromb. Vasc. Biol., July 1, 2008; 28(7): 1290 - 1295. [Abstract] [Full Text] [PDF]

				E. Kim, A. T. Tolhurst, L. Y. Qin, X.-Y. Chen, M. Febbraio, and S. Cho CD36/Fatty Acid Translocase, An Inflammatory Mediator, Is Involved in Hyperlipidemia-Induced Exacerbation in Ischemic Brain Injury J. Neurosci., April 30, 2008; 28(18): 4661 - 4670. [Abstract] [Full Text] [PDF]

				S. Kuchibhotla, D. Vanegas, D. J. Kennedy, E. Guy, G. Nimako, R. E. Morton, and M. Febbraio Absence of CD36 protects against atherosclerosis in ApoE knock-out mice with no additional protection provided by absence of scavenger receptor A I/II Cardiovasc Res, April 1, 2008; 78(1): 185 - 196. [Abstract] [Full Text] [PDF]

				S. Collot-Teixeira, J. Martin, C. McDermott-Roe, R. Poston, and J. L. McGregor CD36 and macrophages in atherosclerosis Cardiovasc Res, August 1, 2007; 75(3): 468 - 477. [Abstract] [Full Text] [PDF]

				S. Agrawal, M. Febbraio, E. Podrez, M. K. Cathcart, G. R. Stark, and G. M. Chisolm Signal Transducer and Activator of Transcription 1 Is Required for Optimal Foam Cell Formation and Atherosclerotic Lesion Development Circulation, June 12, 2007; 115(23): 2939 - 2947. [Abstract] [Full Text] [PDF]

				B. M. Proctor, J. Ren, Z. Chen, J. G. Schneider, T. Coleman, T. S. Lupu, C. F. Semenkovich, and A. J. Muslin Grb2 Is Required for Atherosclerotic Lesion Formation Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1361 - 1367. [Abstract] [Full Text] [PDF]

				P. I. Bonta, C. M. van Tiel, M. Vos, T. W.H. Pols, J. V. van Thienen, V. Ferreira, E. K. Arkenbout, J. Seppen, C. A. Spek, T. van der Poll, et al. Nuclear Receptors Nur77, Nurr1, and NOR-1 Expressed in Atherosclerotic Lesion Macrophages Reduce Lipid Loading and Inflammatory Responses Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2288 - 2288. [Abstract] [Full Text] [PDF]

				A. M. Aslanian and I. F. Charo Targeted Disruption of the Scavenger Receptor and Chemokine CXCL16 Accelerates Atherosclerosis Circulation, August 8, 2006; 114(6): 583 - 590. [Abstract] [Full Text] [PDF]

				K. J. Moore and M. W. Freeman Scavenger Receptors in Atherosclerosis: Beyond Lipid Uptake Arterioscler. Thromb. Vasc. Biol., August 1, 2006; 26(8): 1702 - 1711. [Abstract] [Full Text] [PDF]

				E. Lutgens, S.P.M. Lutgens, B.C.G. Faber, S. Heeneman, M.M.J. Gijbels, M.P.J. de Winther, P. Frederik, I. van der Made, A. Daugherty, A.M. Sijbers, et al. Disruption of the Cathepsin K Gene Reduces Atherosclerosis Progression and Induces Plaque Fibrosis but Accelerates Macrophage Foam Cell Formation Circulation, January 3, 2006; 113(1): 98 - 107. [Abstract] [Full Text] [PDF]

				A. Daugherty, N. R. Webb, D. L. Rateri, and V. L. King Thematic review series: The Immune System and Atherogenesis. Cytokine regulation of macrophage functions in atherogenesis J. Lipid Res., September 1, 2005; 46(9): 1812 - 1822. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Data Supplement All Versions of this Article: 24/12/2333    most recent 01.ATV.0000148007.06370.68v1 Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Febbraio, M. Articles by Silverstein, R. L. Search for Related Content PubMed PubMed Citation Articles by Febbraio, M. Articles by Silverstein, R. L. Related Collections Animal models of human disease Pathophysiology Cell biology/structural biology Gene expression Genetically altered mice Lipid and lipoprotein metabolism Mechanism of atherosclerosis/growth factors