Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2004;24:1783-1788
Published online before print July 22, 2004, doi: 10.1161/01.ATV.0000140063.06341.09
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
24/10/1783    most recent
01.ATV.0000140063.06341.09v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, L.
Right arrow Articles by Cui, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, L.
Right arrow Articles by Cui, J.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2004;24:1783.)
© 2004 American Heart Association, Inc.


Vascular Biology

Leukotriene B4 Strongly Increases Monocyte Chemoattractant Protein-1 in Human Monocytes

Li Huang; Annie Zhao; Frederick Wong; Julia M. Ayala; Mary Struthers; Feroze Ujjainwalla; Samuel D. Wright; Marty S. Springer; Jilly Evans; Jisong Cui

From the Departments of Cardiovascular Diseases (L.H., A.Z., S.D.W., M.S.S., J.E., J.C.), Drug Discovery Sciences (F.W., F.U.), and Infectious Diseases and Immunology (J.M.A., M.S.), Merck Research Laboratories, Rahway, NJ.

Correspondence to Jisong Cui, Department of Cardiovascular Diseases, Merck Research Laboratories, 126 E. Lincoln Avenue, P.O. Box 2000, RY80W-107, Rahway, NJ 07065. E-mail jisong_cui{at}merck.com


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Objective— Leukotriene B4 (LTB4), a product of the 5-lipoxygenase (5-LO) pathway of arachidonic acid metabolism, has been implicated in atherosclerosis. However, the molecular mechanisms for the atherogenic effect of LTB4 are not well understood. This study is to determine candidate mechanisms.

Method and Results—Primary human monocytes were treated with LTB4 and the supernatant was analyzed for cytokine/chemokine production by an immuno-protein array. This analysis revealed a strong increase of the monocyte chemoattractant protein-1 (MCP-1), a proinflammatory cytokine. Follow-up analyses with MCP-1 enzyme-linked immunosorbent assay (for quantitation of MCP-1 protein) and real-time polymerase chain reaction (PCR) (for MCP-1 mRNA) demonstrated that LTB4 strongly induced expression of MCP-1 protein and mRNA in a time-dependent and dose-dependent fashion. This induction was effectively abolished by CP-105,696, an antagonist for the LTB4 receptor BLT1. Selective inhibitors of ERK1/2 or JNK MAPK effectively blocked the LTB4-induced MCP-1 production. Furthermore, LTB4 increased NF-{kappa}B DNA binding activity, which was blocked by CP-105,696.

Conclusions— LTB4 strongly induces MCP-1 production in primary human monocytes. This induction is mediated through the BLT1 pathway increasing MCP-1 transcription. Activation of ERK1/2 or JNK MAPK is essential for this induction. The NF-{kappa}B activation may be involved in LTB4-increased MCP-1 expression. The LTB4-induced MCP-1 in human monocytes may play a critical role in the atherogenicity of LTB4.

Leukotriene B4 (LTB4), a product of the 5-lipoxygenase (5-LO) pathway of arachidonic acid metabolism, has been implicated in atherosclerosis. However, the molecular mechanisms for the atherogenic effect of LTB4 are not well understood. This study shows that the LTB4-induced MCP-1 in human monocytes may play a critical role in the atherogenicity of LTB4.


Key Words: leukotriene B4 • monocyte chemoattractant protein-1 • atherosclerosis • human monocytes


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Leukotriene B4 (LTB4), a product of the 5-lipoxygenase (5-LO) pathway of arachidonic acid metabolism, is a potent chemoattractant and proinflammatory mediator involved in the pathogenesis of several inflammatory diseases including atherosclerosis.1–3 The biological effects of LTB4 are mediated by activation of 2 G-protein coupled receptors, the high-affinity receptor BLT1 and the low-affinity receptor BLT2.4,5 Studies with BLT1-specific and BLT2-specific antagonists demonstrate that BLT1 activation is involved in inflammation and immunologic effects of LTB4, whereas the function of BLT2 is not yet well defined.6

See page 1748

Recent studies suggest a strong link between LTB4 pathways with atherosclerosis. For example, human atherogenic plaques produce LTB4,7 and expression of both BLT1 and BLT2 increases with the progression of atherosclerotic lesions.8 Treatment of atherosclerosis-prone mice (apolipoprotein E [ApoE] or low-density lipoprotein receptor [LDLR]-deficient mice) with the BLT1-specific antagonist CP-105,6969,10 markedly decreased lesion size.11 Interestingly, the anti-atherogenic effects of CP-105,696 were diminished in mice deficient in the chemoattractant monocyte chemotactic protein-1 (MCP-1),11 indicating a critical role for MCP-1 in mediating the LTB4 atherogenic signals.

MCP-1 is a prototype of the C-C chemokine ß subfamily and exhibits the most potent chemotactic activity for monocytes.12 Overexpression of MCP-1 contributes to the development of atherosclerosis in mouse models.13 Deficiency of either MCP-1 or its cognate high-affinity receptor C-C chemokine receptor 2 (CCR2) results in a marked decrease in atheromas and fewer monocytes in vascular lesions.14,15 Additionally, therapeutic gene transfer of a dominant-negative MCP-1 mutant attenuated the development of early atherosclerosis and also limited progression of preexisting atherosclerotic lesions in ApoE-null mice.16

Despite the critical role played by LTB4 in atherogenesis, the molecular mechanisms for these activities are poorly understood. In this study, we investigated specifically whether LTB4 regulates MCP-1 production in primary human monocytes to broaden the mechanistic understanding for LTB4-induced atherosclerosis. Our study shows that LTB4 induced MCP-1 protein by several hundred-fold in primary human monocytes. LTB4 induced MCP-1 mRNA by 500-fold to 600-fold, suggesting that LTB4-induced MCP-1 protein expression was accomplished by a transcriptional mechanism. The BLT1-specific antagonist CP-105,696 effectively blocked this induction, indicating that this event is mediated through the BLT1 signaling pathway. We further demonstrated that inhibitors of ERK1/2 or JNK MAPK abolished this induction. Additionally, we showed that LTB4 increased NF-{kappa}B DNA binding activity, which was blocked by CP-105,696. Taken together, these results suggest that the pathway for LTB4-induced MCP-1 production involves activation of ERK1/2 or JNK and activation of NF-{kappa}B. The LTB4-induced MCP-1 expression in primary monocytes may play a pivotal role in the atherogenicity of LTB4.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Materials
The following reagents were obtained from Invitrogen: DMEM and RPMI-1640 medium, fetal bovine serum, and fetal calf serum, and TRIZOL reagents. The RayBioTM Human Cytokine Array V was obtained from RayBiotech, Inc. The enriched human monocytes were purchased from Biological Specialty Inc. The Calcium++ Assay Kit was obtained from Molecular Devices Corporation. The leukotrienes B4, C4, D4, and E4 were from BIOMOL. CP-105,696 can be made according to the procedure of Koch et al.17 The human MCP-1 Quantikine kit was purchased from R&D Systems, Inc. SB202190 was purchased from Calbiochem, and PD98059 was from Cell Signaling. U0126 and Curcumin were from Sigma. TaqMan reagents for cDNA synthesis and real-time polymerase chain reaction (PCR) (TaqMan), TaqMan oligonucleotide primers and probes for human MCP-1, and human 18S RNA were purchased from Applied Biosystems. Human BLT1 cDNA was a gift from Dr. Takao Shimizu at University of Tokyo.

Isolation and Treatment of Primary Human Monocytes
Ten milliliters of lymphocyte separation medium (LSM/Ficoll) was slowly added to 40 mL of the enriched human monocytes from Biological Specialty Inc, and the mixture was spun at 600g for 20 minutes. The peripheral blood mononuclear cell layer was collected and filled with PBS to 50 mL, and then spun at 1000 rpm for 5 minutes. The cell pellet was resuspended in 5 mL RPMI-1640 medium containing 10% fetal calf serum. Sheep red blood cells were added to the pellet and incubated for 15 minutes at 37°C followed by centrifugation at 1000 rpm for 5 minutes. The pellet was kept at –20°C for 6 minutes, and then was gently resuspended in 25 mL of phosphate-buffered saline. The cells were further purified with 10 mL LSM/Ficoll by repeating the same steps as described. The mononuclear layer at the interface was collected. The red blood cells were lysed if necessary. Monocytes were resuspended in 50 mL of RPMI-1640 medium containing10% fetal calf serum.

The primary monocytes in RPMI-1640 medium were pelleted and resuspended in Hank’s balanced salt solution (HBSS) buffer (with calcium and magnesium) containing 2% Pen/Strep and 1% heat-inactivated fetal bovine serum. The cells were seeded in 24-well plates at a density of 2x106 cells per well and incubated with various concentrations of LTB4, LTC4, LTD4, LTE4 or carbamyl platelet-activating factor (c-PAF). For inhibitor studies, monocytes were pretreated for 30 minutes with CP-105,696 (LTB4 receptor antagonist), PD98059 (ERK1/2 MAPK inhibitor), U0126 (ERK1/2 MAPK inhibitor, 10 µmol/L), curcumin (JNK MAPK inhibitor, 10 µmol/L), and SB202190 (p38 MAPK inhibitor, 1 µmol/L) before the addition of 30 nM LTB4. Unless specified, cells were treated overnight before the medium was collected and centrifuged to remove any residual cells. The cell-free supernatant was stored at –80°C for MCP-1 determination, and cells were dissolved in TRIZOL reagent for total RNA isolation.

Analysis of Human Cytokine Array and MCP-1 Determination
The human cytokine array studies were conducted using the RayBioTM Human Cytokine Array V kit following the manufacturer’s instructions. Primary human monocytes were treated overnight with ethanol or 60 nM LTB4, and the cell-free supernatant was collected. One milliliter of each sample was used for analysis. The human MCP-1 concentrations were determined by the Quantikine kit according to the manufacturer’s instructions.

The Fluorometric Imaging Plate Reader Assay
The fluorometric imaging plate reader (FLIPR) assay was used to confirm the BLT1 antagonist activity of CP-105,696. HEK 293T cells stably overexpressing BLT1 (Zhao et al, unpublished data) were seeded at a density of 22000 cells/well in 384-well plates 24 hours before the assay. The FLIPR assays were performed using the Calcium++ Assay Kit from Molecular Devices Corporation according to manufacturer’s instructions. Briefly, 10 mL of HBSS with 20 mmol/L HEPES were added to Component A from the kit to make a 10x loading dye. Then probenecid (Sigma P-8761) was freshly added to the 10x loading dye. To each well, 25 µL of the 1x loading dye was added and incubated with cells for 1 hour at 37°C. CP-105,696 was diluted with 1x HBSS/HEPES/ probenecid buffer from which 25 µL was added 5 minutes before the addition of 25 µL of LTB4 at a final concentration of 5 nM. Plates were then read for 5 more minutes. Maximal peak values were used for calculation.

Electrophoretic Mobility-Shift Assay
NF-{kappa}B DNA binding activity was determined using Gel Shift Assay Systems kits from Promega following manufacture’s instruction. Briefly the nuclear extract was isolated from primary human monocytes treated with 30 nM LTB4, 30 nM LTC4, or 30 nM LTB4 plus 3 nM CP-105,696 overnight. Nuclear proteins (6 µg) were added to the 1x binding buffer provided with the kits in the presence or absence of a 100-fold excess of the unlabeled NF-{kappa}B oligonucleotide (specific competitor) or the AP-1 oligonucleotide (nonspecific competitor) and incubated at room temperature for 10 minutes. The 32P-labeled probe (5'-AGT TGA GGG GAC TTT CCC AGG C-3') was then added to the reaction and incubated at room temperature for 20 minutes. The protein–DNA complex was resolved on a 4% acrylamide gel, which was then dried and exposed for autoradiography.

RNA Isolation and Real-Time Quantitative PCR
Total RNA was extracted from the treated primary human monocytes using the TRIZOL reagent according to the manufacturer’s instructions. Reverse-transcription reactions and TaqMan PCRs were performed according to the manufacturer’s instructions (Applied Biosystems). Sequence-specific amplification was detected with an increased fluorescent signal of FAM (reporter dye) during the amplification cycles. Amplification of human 18S RNA was used in the same reaction of all samples as an internal control. Gene-specific mRNA was subsequently normalized to 18S RNA. Levels of human MCP-1 mRNA were expressed as fold difference of compound-treated cells against vehicle-treated cells.

Oligonucleotide primers/probe for human MCP-1 were designed using the Primer Express program and were synthesized by Applied Biosystems. These sequences (5' to 3') are as follows: forward primer (CAAGCAGAAGTGGGTTCAGGAT), probe (6FAM-CATGGACCACCTGGACAAGCAAACC-TAMRA), and reverse primer (AGTGAGTGTTCAAGTCTTCGGAGTT).


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
LTB4 Strongly Increases MCP-1 Production in Primary Human Monocytes
To determine whether LTB4 can regulate expression of proinflammatory cytokines/chemokines, primary human monocytes were treated with 60 nM LTB4 overnight, and the cell-free supernatant was collected and hybridized with an immunoblot array that contains 79 human cytokines/chemokines. Compared with the vehicle-treated control (Figure 1A), LTB4 induced expression of MCP-1 protein by several hundred-fold (Figure 1B). In addition, LTB4 treatment also resulted in modest changes of other cytokines/chemokines including increases in placental growth factor and transforming growth factor (TGF) B3 (TGF-B3) and a decrease in macrophage inflammatory protein-1ß (MIP-1ß) (Figure 1B). This study solely focused on the investigation of LTB4-induced MCP-1 expression.



View larger version (20K):
[in this window]
[in a new window]
 
Figure 1. LTB4 strongly induces MCP-1 protein in primary human monocytes. Primary human monocytes were isolated and treated overnight with vehicle (A) or 60 nM LTB4 (B). The cell-free supernatant was collected and hybridized with the membrane blot of human cytokine array that contains 79 human cytokines/chemokines along with 6 positive (the 4 dots at the top left and 2 dots at the bottom right) and 2 negative controls (at bottom right next to the 2 positive controls). The spots for MCP-1, placental growth factor, TGF-B3, and MIP-1ß are indicated by arrows. C, Primary human monocytes were treated with vehicle (EtOH) or 30 nM LTB4, LTC4, LTD4, LTE4, or 1 µmol/L c-PAF overnight, and the MCP-1 concentrations in supernatants were determined by an enzyme-linked immunosorbent assay. Each value represents the mean±SD of 4 determinations.

Follow-up experiments were conducted to confirm the observation of LTB4-induced MCP-1 production. In these experiments, primary monocytes were treated overnight with 30 nM LTB4, as well as with 30 nM LTC4, LTD4, or LTE4 (to assess the effect of cysteinyl leukotrienes on MCP-1 expression), and MCP-1 in the supernatant was quantified by an enzyme-linked immunosorbent assay. An agonist of platelet-activating factor (PAF), c-PAF, which is a known inducer of MCP-1,18 was included as a positive control. Consistent with the results in the immunoblot array, LTB4 increased MCP-1 protein by >200-fold (Figure 1C). In contrast, the cysteinyl leukotrienes C4, D4, and E4 did not significantly regulate MCP-1 expression (Figure 1C). Similar to the previous reports,18 1 µmol/L c-PAF increased MCP-1 protein by 50-fold (Figure 1C).

LTB4 robustly increased MCP-1 protein in a dose-dependent manner with a half-maximum stimulation (EC50) value between 3 and 10 nM (Figure 2A). Primary human monocytes were treated with vehicle (ethanol) or 30 nM LTB4 for 1, 4, 16, 24, and 36 hours to define the time kinetics for LTB4-induced MCP-1 production. LTB4 increased MCP-1 protein in a time-dependent fashion, and significant increase was observed from 16 to 36 hours (Figure 2B). In the vehicle-treated cells, the basal level of MCP-1 was also slightly increased with time (Figure 2B).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 2. LTB4 increases MCP-1 protein in a dose- and time-dependent fashion. Primary human monocytes were isolated and treated with various concentrations of LTB4 overnight (A) or with 30 nM LTB4 for various times (B). Cell-free supernatants were collected and the MCP-1 levels were determined by an enzyme-linked immunosorbent assay. Each value represents the mean±SD of 4 determinations.

LTB4 Induces MCP-1 Transcription
To investigate whether the increase of MCP-1 protein in supernatants resulted from an increased transcription of MCP-1, total RNA from treated primary human monocytes was extracted and the endogenous MCP-1 mRNA was determined by real-time PCR (TaqMan). Consistent with the observation that LTB4 strongly increased MCP-1 protein, LTB4 at 30 nM increased MCP-1 mRNA by >500-fold (Figure 3A), whereas the cysteinyl leukotrienes C4, D4, and E4 did not significantly increase MCP-1 transcription (Figure 3A). c-PAF also increased MCP-1 mRNA by 30-fold to 50-fold (Figure 3A). LTB4 increased MCP-1 mRNA in a dose-dependent manner (Figure 3B).



View larger version (14K):
[in this window]
[in a new window]
 
Figure 3. LTB4 increases MCP-1 transcription. A, Primary human monocytes were isolated and treated overnight with ethanol (EtOH) or 30 nM LTB4, LTC4, LTD4, LTE4, or 1 µmol/L c-PAF (A) or with various concentrations of LTB4 (B). At the end of treatment, cells were harvested and total RNA was extracted, and TaqMan analysis was conducted for MCP-1 mRNA. Results are normalized as fold of control values (treated cells versus vehicle), and data are the mean±SD of 3 determinations.

CP-105,696 Effectively Blocks LTB4-Induced MCP Production
CP-105,696 is a synthetic BLT1 antagonist that potently and specifically blocks LTB4-mediated functional responses.9,10 In our experiments, CP-105,696 effectively inhibited LTB4-stimulated calcium flux in HEK 293T cells stably expressing BLT1 with a half-maximum inhibition (IC50) value of 34 nM (Figure 4A). To determine whether the LTB4-induced MCP-1 expression is mediated by BLT1, primary monocytes were treated with CP-105,696 in the presence and absence of 30 nM LTB4, and the MCP-1 levels in the supernatant were determined by enzyme-linked immunosorbent assay. LTB4 alone increased MCP-1 protein by 400-fold to 500-fold (Figure 4B), and this increase was effectively blocked by CP-105,696 in a dose-dependent manner with an IC50 value between 0.1 and 0.3 nM (Figure 5B). These data suggest that the induction of MCP-1 by LTB4 is mediated through the BLT1 pathway.



View larger version (17K):
[in this window]
[in a new window]
 
Figure 4. A, The BLT1 antagonist CP-105,696 decreased LTB4-stimulated calcium flux in HEK 293T cells stably overexpressing BLT1. Cells were seeded at a density of 22000 cells/well in 384-well plates 24 hours before the assay. The FLIPR assays were conducted using the Calcium++ Assay Kit as described in Methods. B, CP-105,696 effectively decreased the LTB4-induced MCP-1 protein in primary human monocytes. Primary human monocytes were isolated and treated overnight with various concentrations of CP-105,696 in the presence of 30 nM LTB4. CP-105,696 was added 30 minutes before the addition of 30 nM LTB4. At the end of treatment, cell-free supernatants were collected and the MCP-1 levels were determined by enzyme-linked immunosorbent assay. Each value represents the mean±SD of 4 determinations.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 5. Effects of MAPK inhibitors on LTB4-induced MCP-1 protein expression. Primary human monocytes were isolated and treated overnight with various concentrations of PD98059 (A), 10 µmol/L U0126 (B), or 10 µmol/L curcumin (B) in the presence of 30 nM LTB4. The inhibitor was added 30 minutes before the addition of 30 nM LTB4. At the end of treatment, cell-free supernatants were collected and the MCP-1 levels were determined by enzyme-linked immunosorbent assay. Each value represents the mean±SD of 4 determinations.

Inhibition of ERK1/2 and/or JNK MAPKs Abolished LTB4-Induced MCP-1
It has been previously shown that activation of BLT1 may result in activation of variety protein kinases.19,20 We asked whether ERK1/2, JNK or p38 MAPKs are involved in the LTB4-induced MCP-1 protein expression. Figure 5A shows that LTB4-induced MCP-1 expression was effectively blocked by the ERK1/2 MAPK inhibitor PD98059 in a dose-dependent fashion, and that this induction was completely abolished by PD98059 at 5 µmol/L. U0126, another inhibitor of ERK1/2 MAPK, also completely blocked MCP-1 induction at 10 µmol/L (Figure 5B), indicating that activation of ERK1/2 is an essential step for LTB4-induced MCP-1 expression. The JNK MAPK inhibitor curcumin (10 µmol/L) completely blocked this induction as well (Figure 5B), suggesting that activation of JNK is also necessary for the LTB4-induced MCP-1 expression. In contrast, the p38 MAPK inhibitor SB202190 had no effect on MCP-1 expression (data not shown), suggesting that p38 activation is not required for this signaling pathway.

LTB4 Increases NF-{kappa}B DNA Binding Activity in Primary Human Monocytes
It has been reported that NF-{kappa}B plays a key role in regulating MCP-1 transcription.21 To elucidate the molecular basis for LTB4-induced MCP-1 expression, we determined whether LTB4 could increase NF-{kappa}B DNA binding activity in primary human monocytes. Consistent with these results, nuclear extracts from LTB4-treated but not LTC4-treated cells showed a strong increase in NF-{kappa}B DNA binding activity (Figure 6A, lanes 2, 3, and 5). Furthermore, this activity was effectively abolished by the BLT1 antagonist CP-105,696 (Figure 6A, lane 4). The specificity for LTB4-increased NF-{kappa}B activity was demonstrated by competition experiments (Figure 6B). This NF-{kappa}B activity was completely abolished by a 100-fold molar excess of unlabeled NF-{kappa}B oligonucleotide (Figure 6B, lanes 3 and 4) but was not affected by the same molar excess of an unrelated oligonucleotide (Figure 6B, lanes 5 and 6). In addition to NF-{kappa}B, LTB4 treatment did not significantly increase the DNA binding activity for AP-1, AP-2, CREB, and SP-1 (data not shown). Taken together, these results indicate that NF-{kappa}B was activated by LTB4 and suggest that NF-{kappa}B may play an important role in LTB4-induced MCP-1 expression in monocytes.



View larger version (80K):
[in this window]
[in a new window]
 
Figure 6. LTB4 increases NF-{kappa}B DNA binding activity. A, Electrophoretic Mobility-Shift Assays were performed as described in Methods using 32P-labeled NF-{kappa}B probe (5'-AGT TGA GGG GAC TTT CCC AGG C-3') with nuclear extracts from primary human monocytes treated with vehicle control (C, lane 2), 30 nM LTB4 (B4, lane 3), 30 nM LTB4 plus 3 nM CP-105,696 (B4 + antag, lane 4), or 30 nM LTC4 (C4, lane 5). The Hela extract was included as a positive control (lane 1). B, Competition analysis was performed using a 100-fold molar excess of unlabeled NF-{kappa}B oligonucleotide (specific competitor, lanes 3 and 4), or a 100-fold molar excess of unlabeled AP-1 oligonucleotide (nonspecific competitor, lanes 5 and 6) or with no competitors (lanes 1 and 2). Arrows indicate the specific DNA–protein complex.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Recent biologic and genetic findings implicate that the 5-LO pathway plays a critical role in atherosclerosis.18,22–24 Mehrabian et al reported that heterozygotes for the 5-LO gene on the LDLR–/– background had considerably reduced aortic lesions despite hypercholesterolemia as compared with the advanced lesions of LDLR–/– mice.25 Dwyer et al showed that variant alleles of 5-LO genes were associated with a significant increase of carotid intima thickness.26 Most recently, Helgadottir et al demonstrated a significant association between the gene encoding 5-LO activating protein (FLAP) and myocardial infarction by analysis of single-nucleotide polymorphism haplotype in humans.22 The involvement of BLT1 signaling pathways in atherosclerosis is illustrated by the studies showing that BLT1 gene deficiency and a BLT1-specific antagonist significantly reduced atherosclerosis in mouse models.11,27

Despite strong evidence linking LTB4 biosynthesis and receptor pathways to atherosclerosis, the detailed molecular mechanisms for these events are not well defined. MCP-1 is one of the most potent chemotactic factors and has been shown to plays a major role in the initiation and progression of atherosclerosis. We hypothesized that the atherogenic activity of LTB4 may, at least in part, be caused by its regulation on MCP-1 expression. Our study shows that LTB4 strongly induces expression of MCP-1 mRNA and protein. This induction was mediated through the BLT1 pathway. Furthermore, we demonstrate that this induction requires activation of ERK1/2 or JNK and may involve NF-{kappa}B activation. These data are consistent with the observation that the anti-atherogenic effects of the BLT1 antagonist CP-105,696 were diminished in MCP-1–deficient mice.11

Under normal physiological conditions, the level of leukotrienes in human plasma is undetectable (<1 pg/mL). However, after activation of cells by an inflammatory stimulus, the increase of intracellular calcium would lead to a great increase of leukotriene biosynthesis. For instance, neutrophils produce 50 ng of LTB4/106 cells28 and eosinophils produce 25 to 50 µg of CysLTs/106 cells29 in response to the calcium ionophore challenge. The concentration for LTB4-induced MCP-1 expression in this study is in a low nM range (3 to 10 nM), which may well be relevant to the pathological conditions.

It has been well established that LTB4 is a potent chemoattractant that promotes leukocyte adherence to the vascular endothelium. Friedrich et al recently reported that LTB4 triggers both ß1-integrin–dependent and ß2-integrin–dependent monocyte adhesion in equipotency with MCP-1.30 In their study, a PI3 kinase inhibitor (LY294002) partially blocked MCP-1–mediated but not LTB4-mediated cell adhesion, arguing that the chemotactic activity of LTB4 is independent of MCP-1. However, their study only analyzed cell adhesion 1 minute after the addition of LTB4, but our results show that significant induction of MCP-1 production requires a longer interval of time. Thus, it is possible that the transient chemotactic activity of LTB4 is independent of MCP-1, but a prolonged effect can be mediated or enhanced by MCP-1. It is tentative to speculate that MCP-1 and LTB4 may trigger cell adhesion in an additive or synergistic fashion to effectively recruit monocytes into the subendothelial space, the hallmark of atherosclerosis.

This study provides evidence demonstrating for the first time to our knowledge that LTB4 strongly induces MCP-1 production in primary human monocytes. The increased MCP-1 may then lead to a great amplification of the proinflammatory effect of LTB4. Data reported by Matsukawa et al suggested that MCP-1 increases LTB4 production in mice.31 Taken together, it is likely that in atherosclerotic lesions, LTB4 and MCP-1 amplify each other by a feed-forward loop leading to a greatly accelerated initiation and progression of the disease. This study not only enhances the mechanistic understanding of the role of LTB4 in atherogenesis but also adds evidence to the idea that the LTB4 biosynthetic and receptor signaling pathways may be attractive targets for the therapeutic intervention of atherosclerosis.

During preparation of this manuscript, a publication27 describing gene expression in rat basophilic leukemia cells (RBL-2H3) expressing the human BLT1 showed that MCP-1 was one of the genes most robustly induced by LTB4.


*    Acknowledgments
 
We thank Drs Dutch Boltz and Anil Tarachandani, Mr. Richard Wnek, and Mr. Stephen Matheravidathu for their technical assistance on FLIPR assays. We also thank Mr. Thomas Wisniewski for his help in preparation of primary human monocytes.

Received May 20, 2004; accepted July 9, 2004.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Samuelsson B. Leukotrienes: mediators of immediate hypersensitivity reactions and inflammation. Science. 1983; 220: 568–575.[Abstract/Free Full Text]

2. Ford-Hutchinson AW. Leukotriene B4 in inflammation. Crit Rev Immunol. 1990; 10: 1–12.[Medline] [Order article via Infotrieve]

3. Mehrabian M, Allayee H. 5-lipoxygenase and atherosclerosis. Curr Opin Lipidol. 2003; 14: 447–457.[CrossRef][Medline] [Order article via Infotrieve]

4. Yokomizo T, Izumi T, Chang K, Takuwa Y, Shimizu T. A G-protein-coupled receptor for leukotriene B4 that mediates chemotaxis. Nature. 1997; 387: 620–624.[CrossRef][Medline] [Order article via Infotrieve]

5. Yokomizo T, Kato K, Terawaki K, Izumi T, Shimizu T. A second leukotriene B(4) receptor, BLT2. A new therapeutic target in inflammation and immunological disorders. J Exp Med. 2000; 192: 421–432.[Abstract/Free Full Text]

6. Tager AM, Luster AD. BLT1 and BLT2: the leukotriene B(4) receptors. Prostaglandins Leukot Essent Fatty Acids. 2003; 69: 123–134.[CrossRef][Medline] [Order article via Infotrieve]

7. De Caterina R, Mazzone A, Giannessi D, Sicari R, Pelosi W, Lazzerini G, Azzara A, Forder R, Carey F, Caruso D, et al. Leukotriene B4 production in human atherosclerotic plaques. Biomed Biochim Acta. 1988; 47: S182–S185.[Medline] [Order article via Infotrieve]

8. Spanbroek R, Grabner R, Lotzer K, Hildner M, Urbach A, Ruhling K, Moos MP, Kaiser B, Cohnert TU, Wahlers T, Zieske A, Plenz G, Robenek H, Salbach P, Kuhn H, Radmark O, Samuelsson B, Habenicht AJ. Expanding expression of the 5-lipoxygenase pathway within the arterial wall during human atherogenesis. Proc Natl Acad Sci U S A. 2003; 100: 1238–1243.[Abstract/Free Full Text]

9. Yokomizo T, Kato K, Hagiya H, Izumi T, Shimizu T. Hydroxyeicosanoids bind to and activate the low affinity leukotriene B4 receptor, BLT2. J Biol Chem. 2001; 276: 12454–12459.[Abstract/Free Full Text]

10. Showell HJ, Pettipher ER, Cheng JB, Breslow R, Conklyn MJ, Farrell CA, Hingorani GP, Salter ED, Hackman BC, Wimberly DJ, et al. The in vitro and in vivo pharmacologic activity of the potent and selective leukotriene B4 receptor antagonist CP-105696. J Pharmacol Exp Ther. 1995; 273: 176–184.[Abstract/Free Full Text]

11. Aiello RJ, Bourassa PA, Lindsey S, Weng W, Freeman A, Showell HJ. Leukotriene B4 receptor antagonism reduces monocytic foam cells in mice. Arterioscler Thromb Vasc Biol. 2002; 22: 443–449.[Abstract/Free Full Text]

12. Rollins BJ. JE/MCP-1: an early-response gene encodes a monocyte-specific cytokine. Cancer Cells. 1991; 3: 517–524.[Medline] [Order article via Infotrieve]

13. Aiello RJ, Bourassa PA, Lindsey S, Weng W, Natoli E, Rollins BJ, Milos PM. Monocyte chemoattractant protein-1 accelerates atherosclerosis in apolipoprotein E-deficient mice. Arterioscler Thromb Vasc Biol. 1999; 19: 1518–1525.[Abstract/Free Full Text]

14. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, Rollins BJ. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell. 1998; 2: 275–281.[CrossRef][Medline] [Order article via Infotrieve]

15. Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion formation in CCR2–/– mice reveals a role for chemokines in the initiation of atherosclerosis. Nature. 1998; 394: 894–897.[CrossRef][Medline] [Order article via Infotrieve]

16. Egashira K. Molecular mechanisms mediating inflammation in vascular disease: special reference to monocyte chemoattractant protein-1. Hypertension. 2003; 41: 834–841.[Abstract/Free Full Text]

17. Koch K, Melvin LS, Jr., Reiter LA, Biggers MS, Showell HJ, Griffiths RJ, Pettipher ER, Cheng JB, Milici AJ, Breslow R, et al. (+)-1-(3S,4R)-[3-(4-phenylbenzyl)-4-hydroxychroman-7-yl]cyclopentane carboxylic acid, a highly potent, selective leukotriene B4 antagonist with oral activity in the murine collagen-induced arthritis model. J Med Chem. 1994; 37: 3197–3199.[CrossRef][Medline] [Order article via Infotrieve]

18. Proudfoot JM, Croft KD, Puddey IB, Beilin LJ. Angiotensin II type 1 receptor antagonists inhibit basal as well as low-density lipoprotein and platelet-activating factor-stimulated human monocyte chemoattractant protein-1. J Pharmacol Exp Ther. 2003; 305: 846–853.[Abstract/Free Full Text]

19. Lindsay MA, Haddad EB, Rousell J, Teixeira MM, Hellewell PG, Barnes PJ, Giembycz MA. Role of the mitogen-activated protein kinases and tyrosine kinases during leukotriene B4-induced eosinophil activation. J Leukoc Biol. 1998; 64: 555–562.[Abstract]

20. Woo CH, Yoo MH, You HJ, Cho SH, Mun YC, Seong CM, Kim JH. Transepithelial migration of neutrophils in response to leukotriene B4 is mediated by a reactive oxygen species-extracellular signal-regulated kinase-linked cascade. J Immunol. 2003; 170: 6273–6279.[Abstract/Free Full Text]

21. Ueda A, Okuda K, Ohno S, Shirai A, Igarashi T, Matsunaga K, Fukushima J, Kawamoto S, Ishigatsubo Y, Okubo T. NF-kappa B and Sp1 regulate transcription of the human monocyte chemoattractant protein-1 gene. J Immunol. 1994; 153: 2052–2063.[Abstract]

22. Helgadottir A, Manolescu A, Thorleifsson G, Gretarsdottir S, Jonsdottir H, Thorsteinsdottir U, Samani NJ, Gudmundsson G, Grant SF, Thorgeirsson G, Sveinbjornsdottir S, Valdimarsson EM, Matthiasson SE, Johannsson H, Gudmundsdottir O, Gurney ME, Sainz J, Thorhallsdottir M, Andresdottir M, Frigge ML, Topol EJ, Kong A, Gudnason V, Hakonarson H, Gulcher JR, Stefansson K. The gene encoding 5-lipoxygenase activating protein confers risk of myocardial infarction and stroke. Nat Genet. 2004.

23. Spanbroek R, Habenicht AJ. The potential role of antileukotriene drugs in atherosclerosis. Drug News Perspect. 2003; 16: 485–489.[CrossRef][Medline] [Order article via Infotrieve]

24. De Caterina R, Zampolli A. From asthma to atherosclerosis–5-lipoxygenase, leukotrienes, and inflammation. N Engl J Med. 2004; 350: 4–7.[Free Full Text]

25. Mehrabian M, Allayee H, Wong J, Shi W, Wang XP, Shaposhnik Z, Funk CD, Lusis AJ, Shih W. Identification of 5-lipoxygenase as a major gene contributing to atherosclerosis susceptibility in mice. Circ Res. 2002; 91: 120–126.[Abstract/Free Full Text]

26. Dwyer JH, Allayee H, Dwyer KM, Fan J, Wu H, Mar R, Lusis AJ, Mehrabian M. Arachidonate 5-lipoxygenase promoter genotype, dietary arachidonic acid, and atherosclerosis. N Engl J Med. 2004; 350: 29–37.[Abstract/Free Full Text]

27. Subbarao K, Jala VR, Mathis S, Suttles J, Zacharias W, Ahamed J, Ali H, Tseng MT, Haribabu B. Role of Leukotriene B4 Receptors in the Development of Atherosclerosis: Potential Mechanisms. Arterioscler Thromb Vasc Biol. 2003.

28. Dahinden CA, Zingg J, Maly FE, de Weck AL. Leukotriene production in human neutrophils primed by recombinant human granulocyte/macrophage colony-stimulating factor and stimulated with the complement component C5A and FMLP as second signals. J Exp Med. 1988; 167: 1281–1295.[Abstract/Free Full Text]

29. Weller PF, Lee CW, Foster DW, Corey EJ, Austen KF, Lewis RA. Generation and metabolism of 5-lipoxygenase pathway leukotrienes by human eosinophils: predominant production of leukotriene C4. Proc Natl Acad Sci U S A. 1983; 80: 7626–7630.[Abstract/Free Full Text]

30. Friedrich EB, Tager AM, Liu E, Pettersson A, Owman C, Munn L, Luster AD, Gerszten RE. Mechanisms of leukotriene B4–triggered monocyte adhesion. Arterioscler Thromb Vasc Biol. 2003; 23: 1761–1767.[Abstract/Free Full Text]

31. Matsukawa A, Hogaboam CM, Lukacs NW, Lincoln PM, Strieter RM, Kunkel SL. Endogenous monocyte chemoattractant protein-1 (MCP-1) protects mice in a model of acute septic peritonitis: cross-talk between MCP-1 and leukotriene B4. J Immunol. 1999; 163: 6148–6154.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Cardiovasc ResHome page
E. Sanchez-Galan, A. Gomez-Hernandez, C. Vidal, J. L. Martin-Ventura, L. M. Blanco-Colio, B. Munoz-Garcia, L. Ortega, J. Egido, and J. Tunon
Leukotriene B4 enhances the activity of nuclear factor-{kappa}B pathway through BLT1 and BLT2 receptors in atherosclerosis
Cardiovasc Res, January 1, 2009; 81(1): 216 - 225.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Uozumi, Y. Kita, and T. Shimizu
Modulation of Lipid and Protein Mediators of Inflammation by Cytosolic Phospholipase A2{alpha} during Experimental Sepsis
J. Immunol., September 1, 2008; 181(5): 3558 - 3566.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
M. A. Sardo, S. Campo, G. Mandraffino, C. Saitta, A. Bonaiuto, M. Castaldo, M. Cinquegrani, G. Pizzimenti, and A. Saitta
Tissue Factor and Monocyte Chemoattractant Protein-1 Expression in Hypertensive Individuals with Normal or Increased Carotid Intima-Media Wall Thickness
Clin. Chem., May 1, 2008; 54(5): 814 - 823.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
R. Horrillo, A. Planaguma, A. Gonzalez-Periz, N. Ferre, E. Titos, R. Miquel, M. Lopez-Parra, J. L. Masferrer, V. Arroyo, and J. Claria
Comparative Protection against Liver Inflammation and Fibrosis by a Selective Cyclooxygenase-2 Inhibitor and a Nonredox-Type 5-Lipoxygenase Inhibitor
J. Pharmacol. Exp. Ther., December 1, 2007; 323(3): 778 - 786.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Ahluwalia, A. Y. Lin, A. M. Tager, I. E. Pruitt, T. J. T. Anderson, F. Kristo, D. Shen, A. R. Cruz, M. Aikawa, A. D. Luster, et al.
Inhibited Aortic Aneurysm Formation in BLT1-Deficient Mice
J. Immunol., July 1, 2007; 179(1): 691 - 697.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
N. L. Rao, P. J. Dunford, X. Xue, X. Jiang, K. A. Lundeen, F. Coles, J. P. Riley, K. N. Williams, C. A. Grice, J. P. Edwards, et al.
Anti-Inflammatory Activity of a Potent, Selective Leukotriene A4 Hydrolase Inhibitor in Comparison with the 5-Lipoxygenase Inhibitor Zileuton
J. Pharmacol. Exp. Ther., June 1, 2007; 321(3): 1154 - 1160.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Arita, T. Ohira, Y.-P. Sun, S. Elangovan, N. Chiang, and C. N. Serhan
Resolvin E1 Selectively Interacts with Leukotriene B4 Receptor BLT1 and ChemR23 to Regulate Inflammation
J. Immunol., March 15, 2007; 178(6): 3912 - 3917.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. Vidal, A. Gomez-Hernandez, E. Sanchez-Galan, A. Gonzalez, L. Ortega, J. A. Gomez-Gerique, J. Tunon, and J. Egido
Licofelone, a Balanced Inhibitor of Cyclooxygenase and 5-Lipoxygenase, Reduces Inflammation in a Rabbit Model of Atherosclerosis
J. Pharmacol. Exp. Ther., January 1, 2007; 320(1): 108 - 116.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. D. Funk
Lipoxygenase Pathways as Mediators of Early Inflammatory Events in Atherosclerosis.
Arterioscler. Thromb. Vasc. Biol., June 1, 2006; 26(6): 1204 - 1206.
[Full Text] [PDF]


Home page
GeneticsHome page
A. Ghazalpour, X. Wang, A. J. Lusis, and M. Mehrabian
Complex Inheritance of the 5-Lipoxygenase Locus Influencing Atherosclerosis in Mice
Genetics, June 1, 2006; 173(2): 943 - 951.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W.-H. Shao, A. Del Prete, C. B. Bock, and B. Haribabu
Targeted Disruption of Leukotriene B4 Receptors BLT1 and BLT2: A Critical Role for BLT1 in Collagen-Induced Arthritis in Mice
J. Immunol., May 15, 2006; 176(10): 6254 - 6261.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
N. D. Kim, R. C. Chou, E. Seung, A. M. Tager, and A. D. Luster
A unique requirement for the leukotriene B4 receptor BLT1 for neutrophil recruitment in inflammatory arthritis
J. Exp. Med., April 17, 2006; 203(4): 829 - 835.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. A. Islam, S. Y. Thomas, C. Hess, B. D. Medoff, T. K. Means, C. Brander, C. M. Lilly, A. M. Tager, and A. D. Luster
The leukotriene B4 lipid chemoattractant receptor BLT1 defines antigen-primed T cells in humans
Blood, January 15, 2006; 107(2): 444 - 453.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Woszczek, R. Pawliczak, H.-Y. Qi, S. Nagineni, S. Alsaaty, C. Logun, and J. H. Shelhamer
Functional Characterization of Human Cysteinyl Leukotriene 1 Receptor Gene Structure
J. Immunol., October 15, 2005; 175(8): 5152 - 5159.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
A. Pettersson, A. Sabirsh, J. Bristulf, K. Kidd-Ljunggren, B. Ljungberg, C. Owman, and U. Karlsson
Pro- and anti-inflammatory substances modulate expression of the leukotriene B4 receptor, BLT1, in human monocytes
J. Leukoc. Biol., June 1, 2005; 77(6): 1018 - 1025.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Peters-Golden, C. Canetti, P. Mancuso, and M. J. Coffey
Leukotrienes: Underappreciated Mediators of Innate Immune Responses
J. Immunol., January 15, 2005; 174(2): 589 - 594.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M. Mehrabian and H. Allayee
Vascular Cross-Talk: A Conversation
Arterioscler. Thromb. Vasc. Biol., October 1, 2004; 24(10): 1748 - 1749.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
24/10/1783    most recent
01.ATV.0000140063.06341.09v1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, L.
Right arrow Articles by Cui, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, L.
Right arrow Articles by Cui, J.