| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Vascular Biology |
From the Department of Vascular Biology (T.N., M.A., T.Y., H.M., Y.S.), Institute of Development, Aging and Cancer, Tohoku University, Sendai; the Department of Orthopedic Surgery (T.N., S.K.), Tohoku University Graduate School of Medicine, Sendai; and the Laboratory for Cell Pluripotency Studies (H.N.), RIKEN Center for Developmental Biology, Kobe, Japan.
Correspondence to Yasufumi Sato, Department of Vascular Biology, Institute of Development, Aging and Cancer, Tohoku University, 4-1 Seiryo-machi, Aoba-ku, Sendai 980-8575, Japan. E-mail y-sato{at}idac.tohoku.ac.jp
| Abstract |
|---|
|
|
|---|
Methods and Results We transiently overexpressed HEX in human umbilical vein ECs (HUVECs). To our surprise, HEX completely abrogated the response of HUVECs to vascular endothelial growth factor (VEGF) with regard to proliferation, migration, and invasion and abolished network formation by HUVECs on Matrigel. cDNA microarray analysis and quantitative real-time reverse transcriptionpolymerase chain reaction combined with Western blotting revealed that HEX significantly repressed the expression of VEGF receptor-1, VEGF receptor-2, neuropilin-1, tyrosine kinase with Ig and EGF homology domains (TIE)-1, TIE-2, and the integrin
v subunit, whereas it augmented the expression of endoglin in HUVECs. We established murine embryonic stem cells that were stably transfected with HEX sense cDNA or antisense cDNA, and we examined the in vitro differentiation to ECs. Although the expression of VEGF receptor-2 was decreased in sense transfectants, the number of cells expressing VE-cadherin, a specific marker of ECs, was not altered.
Conclusions Our present results suggest that HEX may not affect the differentiation of ECs but acts as a negative regulator of angiogenesis.
Key Words: angiogenesis HEX transcription factor endothelial cell
| Introduction |
|---|
|
|
|---|
ECs express a variety of transcription factors during vascular formation.5 Homeobox gene products comprise a broad family of transcription factors that all contain a conserved 60amino acid homeodomain, which binds DNA in a sequence-specific manner. Although many homeobox genes are arranged in clusters, some are located outside these regions. It has been previously demonstrated that clustered homeobox genes such as HOXB3 and HOXD3 are expressed in ECs and regulate angiogenesis in distinct manners. HOXB3 promotes the invasive behavior of ECs in response to angiogenic stimulation, whereas HOXD3 promotes capillary morphogenesis.6,7
The hematopoietically expressed homeobox (HEX) protein, also known as the proline-rich homeodomain protein, is a member of the nonclustered homeodomain proteins and was initially isolated from murine hematopoietic tissue.810 HEX is expressed in the anterior visceral endoderm and rostral definitive endoderm in early mouse embryos and is later expressed in the liver, thyroid, and endothelial progenitors.11 Targeted disruption of the HEX gene in mouse embryos revealed that HEX is essential in the endoderm for normal development of the forebrain, liver, and thyroid gland.12 In contrast, ectopic expression of Xenopus HEX gene in frog embryos13 or zebrafish HEX gene in zebrafish embryos14 caused increased numbers of ectopic ECs, suggesting that HEX played some roles in embryonic vascular development.
Here we examined whether HEX played any role in the regulation of angiogenesis. For this purpose, we modulated the expression of HEX in human umbilical vein endothelial cells (HUVECs) or murine embryonic stem (ES) cells and analyzed the angiogenic activity of ECs, the expression of angiogenesis-related genes, and the differentiation of ECs. Our results indicate that HEX does not affect the differentiation of ECs but negatively regulates angiogenesis.
| Methods |
|---|
|
|
|---|
MEM) containing 20% FCS.
Transfection of HEX cDNA in ECs
Murine HEX cDNA was kindly provided by Dr Wiedemann (Chester Beatty Laboratories, Institute of Cancer Research, London, UK). The adenovirus vector expression kit (Takara) was used, and replication-deficient recombinant adenoviruses were constructed according to the COS/TPC method.17 AdHEX was obtained by in vivo homologous recombination between the transfer cassette bearing the HEX expression unit and almost the entire adenovirus genome, and the restriction enzymedigested adenovirus genome was tagged with terminal protein in 293 cells.18 ECs were infected with adenovirus vectors at indicated multiplicities of infection (MOIs). Adenoviral infection was carried out in serum-free medium 199 (Nissui) for 1 hour at 37°C.
Cell Migration
Migration of cells was examined by using the wound assay as previously described.19 HUVECs were transfected with AdHEX or Adnull. After 48 hours, confluent cell monolayers were wounded with a razor blade, and the medium was changed to medium 199 containing 5% FCS with or without 1 nmol/L VEGF (R&D Systems, Inc). After 24 hours of incubation, cells that had migrated across the edge of the wound and into the gap were counted as migrating cells.
Cell Invasion
Cell invasion assays were performed by using a Matrigel-coated invasion chamber equipped with an 8-µm-pore-size micropore filter (BioCoat Matrigel invasion chamber; 24 wells; 8.0-µm pore size; Becton Dickinson). The lower compartment of the invasion chamber was filled with medium 199 containing 5% FCS with or without 1 nmol/L VEGF. After the adenovirus transfection, HUVECs were harvested, resuspended in medium 199 containing 5% FCS with or without 1 nmol/L VEGF, and inoculated into the upper chamber (2.5x104 cells per chamber). After incubation at 37°C for 24 hours, the Matrigel on the filter was scraped off, and the filter was fixed with methanol and stained with hematoxylin. Cells that had penetrated the filter were then counted.
DNA Synthesis
DNA synthesis was examined by 5'-bromo-2'-deoxyuridine (BrdU) incorporation and chemiluminescence detection (Roche Diagnostics). After the adenovirus transfection, 2000 HUVECs were inoculated into each well of a 96-well multititer black plate. Cells were allowed to adhere for 24 hours in endothelial basal medium with 10% FCS and then starved in medium 199 with 5% FCS for 6 hours. After starvation, cells were incubated with or without 1 nmol/L VEGF, and 10 µL of 10x BrdU was added to each well. After 24 hours of incubation, BrdU chemiluminescence was analyzed by ELISA.
Network Formation by HUVECs on Matrigel
After the adenovirus transfection, 3x104 HUVECs were inoculated into each well of a Matrigel-coated dish (Becton Dickinson) and incubated in medium 199 with 5% FCS for 8 hours. Network formation was observed by phase-contrast microscopy.
cDNA Microarray Analysis
Total RNA was prepared from HUVECs infected with AdHEX or Adnull with the use of Isogen (Nippongene), and poly(A)+ RNA was purified from the total RNA by using an Oligotex-dT30 mRNA purification kit (Takara). cDNA probe synthesis, hybridization with a human UniGEM V cDNA microarray, and signal analysis were conducted by Genome Systems (IncyteGenomics, St. Louis, Mo).
Quantitative RT-PCR Analysis
Total RNA samples were prepared from HUVECs transfected with AdHEX or Adnull by using Isogen. First-strand cDNA was generated by using the first-strand cDNA synthesis kit for reverse transcriptionpolymerase chain reaction (RT-PCR, Roche Diagnostics). Quantitative RT-PCR was performed with a LightCycler system (Roche Diagnostics) according to the manufacturers instructions. The amount of PCR product was measured as a fluorescence signal proportional to the amount of the specific target sequence present. The sense and antisense primer pairs used were as follows: VEGFR-1, GAGCATCACTCAGCGCATGGCAA, GTTCTGTTATTAACTGTCCGCAGT; VEGFR-2, GTTTGTCACTGAGACAGCTTGG, ACTATAGATGGTGTAACCCGGA; TIE-1, AGGTCACGCTTCGCGGCTT, CCAAAACGGCCCTCTCTG; TIE-2, TAGAGCCTGAAACAGCATACCAGG, CTATTGGCAATGGCAAATGCTGGG; ephrinB2, GCCAGACAAGAGCCATGAAGATCC, GATGCAGATGTGGAGTGGAGGT; integrinß1, GTAACCAACCGTAGCAAAGGAACAGC, ATGTCTGTGGCTCCCCTGATCTTA; urokinase-type plasminogen activator (UPA), TCCCGGACTATACAGACCAT, TCTCTTCCTTGGTGTGACTG; matrix metalloproteinase (MMP)-1, GACAGATTCTACATGCGCAC, GTGGCCAATTCCAGGAAAGT; tissue inhibitor of metalloproteinase (TIMP)-1, CAGAGAGACACCAGAGAACCCACC, GGGGATGGATAAACAGGGAAACACT; TIMP-2, CCCTCCTCGGCAGTGTGTGGGGTCT, GCACGGGATCATGGGGCAGCGCGTGA; stem cell leukemia (SCL)/tal-1, CAAGTAAGAGGCTGGAGTTGTCA, AACGTGATGTCGAGGAGTTGAAG; endothelial Per-AHR-ARNT-Sim domain protein (EPAS)-1//hypoxia inducible factor (HIF)-2
, ACCAATCCAGCACCCATCCCACAT, CAGGTTGCGAGGGTTGTAGATGAC; E26 transformation specific (ETS)-1, GGACTGGGTGATGTGGGCTGTGAA, AAGAGTCCTGGCCCCCGAGTTTAC; and new ets-related factor (NERF)2, ATTCATCCCCTATAAACTGCTCCA, CTGCATTAACTGACTGAACTGCCA.
Western Blot Analysis
HUVECs were transfected with AdHEX or Adnull. After 48 hours, total protein was extracted with modified radioimmunoprecipitation assay (RIPA) buffer as previously described.20 Equal amounts of sample were applied to SDSpolyacrylamide gel electrophoresis gels under reducing conditions and then transferred to nitrocellulose membranes (Hybond ECL, Amersham Pharmacia Biotech). Membranes were blocked and probed with primary antibodies. Signals were visualized by using horseradish peroxidaseconjugated secondary antibodies and enhanced chemiluminescence (ECL, Amersham Pharmacia Biotech) with an LAS-1000 image analyzer (Fuji). Antibodies against VEGFR-1, VEGFR-2, TIE-1, TIE-2, and neuropilin-1 were obtained from Santa Cruz Biotechnology, Inc, and anti-integrin
v antibody was from Chemicon International Inc. Rabbit polyclonal anti-endoglin antibody was a gift from Dr K. Miyazono (Graduate School of Medicine, University of Tokyo, Tokyo, Japan).
Differentiation of ES Cells to ECs In Vitro
To constantly maintain expression of introduced genes in ES cells, we used the supertransfection system.21,22 In brief, pHPCAG containing the gene to be expressed in ES cells was transfected in MG1.19, which was the CCE ES cell line carrying the primary episomal pMGD20neo for supertransfection.15 pHPCAG contains a CAG promoter, which is highly active not only in ECs but also in a wide range of cell types. The gene introduced into pHPCAG is expressed by large T from pMGD20neo in MG1.19 cells cultured with hygromycin in addition to geneticin. Murine HEX cDNA was introduced into pHPCAG in a sense (pHPCAG-m-HEX-S) or an antisense (pHPCAG-m-HEX-AS) orientation. MG1.19 cells were transfected with pHPCAG (mock), pHPCAG-m-HEX-S, or pHPCAG-m-HEX-AS by using Lipofectamine Plus (Life Technologies, Inc). Transfectants were selected by addition of 100 µg/mL hygromycin B (Life Technologies, Inc).
To induce differentiation, 1.4x104 cells/10-cm dish of MG1.19 cells transfected with mock, pHPCAG-m-HEX-S, or pHPCAG-m-HEX-AS were cultured on confluent OP9 cells (a gift from Dr H. Kodama, RIKEN, Wako, Japan) in MEM supplemented with10% FCS and 5x105 mol/L 2-mercaptoethanol in the absence of LIF. On days 3, 4, and 5, the effect of HEX on the differentiation of ES cells toward EC lineage was examined by flow cytometry as described previously.23 The cultured cells were harvested by incubation in cell-dissociation buffer (Life Technologies, Inc). The harvested cells were incubated in mouse serum for 30 minutes on ice to block nonspecific antibody binding and then incubated with allophycocyanin-conjugated anti-mouse CD144/VE-cadherin antibody and R-phycoerythrinconjugated anti-mouse Flk-1/VEGFR-2 antibody (Avas12
1) for 15 minutes on ice. Living cells excluding propidium iodide (Sigma) were analyzed by FACS vantage (Becton Dickinson).
Immunohistochemical Analysis of HEX In Vivo
Male C57BL/6 mice were used at 4 weeks of age. Growth factorreduced Matrigel (500 µL, Collaborative Biomedical Products) containing 8.3 nmol/L basic fibroblast growth factor (Collaborative Biomedical Products) in liquid form at 4°C was injected into abdominal subcutaneous tissues at the midperitoneal area of the mice. On day 5 after injection, the mice were humanely killed after they were anesthetized with ether, and the gel was recovered. Matrigel gels were then fixed in 4% paraformaldehyde containing phosphate-buffered saline and embedded in paraffin. Gel sections (3 µm thick) were processed for immunohistochemistry by using the ABC method. Rabbit polyclonal anti-human HEX antibody (a gift from Dr Nagai, Graduate School of Medicine, University of Tokyo, and Dr Kurabayashi, Gunma University School of Medicine), anti-mouse platelet endothelial cell adhesion molecule (PECAM)-1/CD31 antibody (Santa Cruz Biotechnology, Inc), and normal rabbit IgG fraction (Vector Laboratories, Inc) were used as primary antibodies.
Calculations and Statistical Analysis
The statistical significance of differences in the data were evaluated by an unpaired ANOVA, and probability values were calculated by Students t test. A probability value <0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
|
|
Role of HEX in the Expression of Angiogenesis-Related Genes in HUVECs
Because HEX has transcription factor characteristics, its expression might alter the angiogenic properties of HUVECs by modulating the expression of angiogenesis-related genes. To determine the role of HEX in HUVEC gene transcription, we compared the mRNA expression profile of Adnull- and AdHEX-infected HUVECs by using a combination of cDNA microarray analysis and quantitative real-time RT-PCR. TheTable summarizes the relative expression of individual genes. We observed no contradictions in terms of gene expression of VEGFR-1 mRNA between cDNA microarray and quantitative RT-PCR analyses. Expression of receptor and membrane protein genes, such as VEGFR-1, VEGFR-2, TIE-1, TIE-2, and nueropilin-1, were repressed <0.5-fold in AdHEX-infected HUVECs (Table 1). A time-course experiment revealed that decreased levels of VEGFR-2 were evident as early as 12 hours after infection (Figure 3A). Decreased VEGFR-2 mRNA levels were detected at an MOI as low as 10 and were maximal at an MOI of 50 (Figure 3B). In contrast, mRNA levels of endoglin, ephrin B2, urokinase-type plasminogen activator, tissue-type plasminogen activator, plasminogen activator inhibitor-1, TIMP-1, TIMP-2, and TIMP-3 were upregulated >2-fold (Table 1).
|
|
Protein levels of VEGFR-1, VEGFR-2, nueropilin-1, integrin
v, and endoglin were further analyzed by Western blotting. As shown in Figure 4, protein levels of VEGFR-1, VEGFR-2, nueropilin-1, TIE-1, TIE-2, and integrin
v were decreased, whereas that of endoglin was increased. These changes correlated very well to those of mRNA levels.
|
Effects of HEX on the Differentiation of ES Cells to ECs
The ectopic expression of Xenopus HEX gene in frog embryos13 or zebrafish HEX gene in zebrafish embryos14 caused increased numbers of ectopic endothelial progenitors or ECs. Here we examined whether HEX affected the differentiation of ECs. For this purpose, we transfected HEX sense cDNA or antisense cDNA to the murine ES cell line MG1.19 as described in Methods. Quantitative RT-PCR analysis revealed that HEX mRNA was expressed in MG1.19 cells, and its level was increased by 1.4-fold after 5 days cultivation on OP9. Northern blot analysis further revealed that the expression of HEX mRNA could be detected in sense transfectant but not in mock or antisense transfectants (data not shown). The expression of VE-cadherin, a specific marker of ECs, became apparent on day 5 in each transfectant, but HEX did not lead to any alteration in the number of VE-cadherinexpressing cells (Figure 5A). The expression of HEX in ES cells resulted in reduction of VEGFR-2 expression on days 4 and 5 (Figure 5B). Among VE-cadherinpositive cell populations at day 5, 14% of sense transfectants were VEGFR-2negative, whereas 7% of antisense transfectants were VEGFR-2negative.
|
| Discussion |
|---|
|
|
|---|
The precise mechanism of how HEX represses the expression of those genes remains to be elucidated. However, HEX is known to act as a transcriptional repressor in liver cells, ES cells, and hematopoietic cells.2426 Generally, mechanisms of transcriptional repression can be classified into 4 main categories: steric hindrance, quenching, direct repression, and modulation of chromatin structure. Guiral et al26 have recently shown that HEX repressed transcription from TATA boxcontaining promoters by binding to the TATA box and sterically hindering the binding of TATA boxbinding proteins. Because the N-terminal proline-rich domain of HEX appears to be responsible for this repressor activity, it is therefore possible that HEX represses the expression of angiogenesis-related receptors and membrane proteins in HUVECs by steric hindrance.
We further examined the effect of HEX on the differentiation of ECs. For this purpose, we applied a murine ES cell in vitro differentiation system, and we evaluated the differentiation of ECs by analyzing the appearance of VE-cadherinpositive cells. In this connection, HEX did not affect the expression of VE-cadherin mRNA in HUVECs (Table). It was previously described that ectopic expression of Xenopus HEX gene in frog embryos13 or zebrafish HEX gene in zebrafish embryos14 caused increased numbers of ECs. However, our results indicate that HEX does not significantly alter the number of differentiated ECs (Figure 5). We assume that ectopic HEX gene transfection experiments might have modulated gene expression in cells other than ECs or its progenitors, which then indirectly affected the differentiation or proliferation of ECs.
Because a variety of transcription factors are expressed in ECs during vascular development or angiogenesis, the cross-regulation of transcription factors is important. Although HEX has been reported to induce SCL/tal-1 expression in zebrafish embryos,14 we observed no increases in SCL/tal-1 mRNA levels in HUVECs after infection with AdHEX (Table). However, we did observe HEX-mediated repression of Runx-1/PEBP2
A gene in HUVECs. We have previously reported that Runx-1/PEBP2
A is induced in ECs in response to VEGF or basic fibroblast growth factor and is required for angiogenesis.27 Therefore, the decreased expression of Runx-1/PEBP2
A may, in part, explain the negative role of HEX in angiogenesis.
The function of HEX may not be simple, because our cDNA microarray analysis revealed that HEX simultaneously increased the expression of various genes. Indeed, HEX can act as a transcription activator as well.28 Among various genes of increased expression, endoglin is a binding site of transforming growth factor ß29 and is highly expressed in ECs during angiogenesis.30 Endoglin is involved in vascular maturation, because targeted disruption of the endoglin gene in mice exhibited defective vascular maturation, poor smooth muscle cell accumulation, and arrested endothelial remodeling.31 Consequently, our results may suggest that HEX not only acts a negative regulator of angiogenesis but also promotes vascular maturation by inducing endoglin in ECs.
| Acknowledgments |
|---|
Received September 19, 2002; accepted December 2, 2002.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Chen and D. H. Gorski Regulation of angiogenesis through a microRNA (miR-130a) that down-regulates antiangiogenic homeobox genes GAX and HOXA5 Blood, February 1, 2008; 111(3): 1217 - 1226. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Chen, A. D. Leal, S. Patel, and D. H. Gorski The Homeobox Gene GAX Activates p21WAF1/CIP1 Expression in Vascular Endothelial Cells through Direct Interaction with Upstream AT-rich Sequences J. Biol. Chem., January 5, 2007; 282(1): 507 - 517. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hamik, B. Wang, and M. K. Jain Transcriptional Regulators of Angiogenesis Arterioscler. Thromb. Vasc. Biol., September 1, 2006; 26(9): 1936 - 1947. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shibuya, K. Watanabe, H. Yamashita, K. Shimizu, H. Miyashita, M. Abe, T. Moriya, H. Ohta, H. Sonoda, T. Shimosegawa, et al. Isolation and Characterization of Vasohibin-2 as a Homologue of VEGF-Inducible Endothelium-Derived Angiogenesis Inhibitor Vasohibin Arterioscler. Thromb. Vasc. Biol., May 1, 2006; 26(5): 1051 - 1057. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kubo, V. Chen, M. Kennedy, E. Zahradka, G. Q. Daley, and G. Keller The homeobox gene HEX regulates proliferation and differentiation of hemangioblasts and endothelial cells during ES cell differentiation Blood, June 15, 2005; 105(12): 4590 - 4597. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Hallaq, E. Pinter, J. Enciso, J. McGrath, C. Zeiss, M. Brueckner, J. Madri, H. C. Jacobs, C. M. Wilson, H. Vasavada, et al. A null mutation of Hhex results in abnormal cardiac development, defective vasculogenesis and elevated Vegfa levels Development, October 15, 2004; 131(20): 5197 - 5209. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. E. Swingler, K. L. Bess, J. Yao, S. Stifani, and P.-S. Jayaraman The Proline-rich Homeodomain Protein Recruits Members of the Groucho/Transducin-like Enhancer of Split Protein Family to Co-repress Transcription in Hematopoietic Cells J. Biol. Chem., August 13, 2004; 279(33): 34938 - 34947. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Minami, T. Murakami, K. Horiuchi, M. Miura, T. Noguchi, J.-i. Miyazaki, T. Hamakubo, W. C. Aird, and T. Kodama Interaction between Hex and GATA Transcription Factors in Vascular Endothelial Cells Inhibits flk-1/KDR-mediated Vascular Endothelial Growth Factor Signaling J. Biol. Chem., May 14, 2004; 279(20): 20626 - 20635. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2003 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |