Published online before print September 18, 2003, doi: 10.1161/01.ATV.0000096207.01487.36
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© 2003 American Heart Association, Inc.
Atherosclerosis and Lipoproteins |
Simvastatin Modulates Expression of the PON1 Gene and Increases Serum Paraoxonase
A Role for Sterol Regulatory Element–Binding Protein-2
From the Clinical Diabetes Unit, Division of Endocrinology and Diabetes, Medical Faculty, University Hospital, Geneva, Switzerland.
Correspondence to Dr Richard W. James, Division of Endocrinology and Diabetology, University Hospital, 1211 Geneva 14, Switzerland. E-mail Richard.James{at}hcuge.ch
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Background— The HDL-associated enzyme paraoxonase protects LDLs from oxidative stress. 3-Hydroxy-3-methylglutaryl coenzyme A reductase inhibitors (statins) appear to favorably influence the atherosclerotic process by different mechanisms. The present study examined the influence of simvastatin on paraoxonase expression and serum paraoxonase levels.
Methods and Results— Simvastatin upregulated in a dose-dependent manner the activity of the promoter of the paraoxonase gene in expression cassettes transfected into HepG2 cells. Upregulation could be blocked by mevalonate and other intermediates of the cholesterol biosynthetic pathway. Simvastatin increased nuclear factors, notably sterol regulatory element–binding protein-2, capable of binding to the paraoxonase promoter; this was also blocked by mevalonate. Sterol regulatory element–binding protein-2 upregulated promoter activity in vitro. Patients treated with statin showed a significant increase in serum concentrations and activities of paraoxonase.
Conclusions— The data indicate that simvastatin can modulate expression in vitro of the antioxidant enzyme paraoxonase and is associated with increased serum paraoxonase concentration and activity. It is consistent with effects of simvastatin treatment, which have the potential to influence beneficially antiatherogenic mechanisms at the HDL level. The study provides evidence for 1 molecular mechanism by which paraoxonase gene expression could be regulated.
Key Words: lipoproteins • antioxidants • genes • coronary disease • transcription factors
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
HDLs are inversely correlated with the risk of vascular disease.1 Several antiatherogenic mechanisms have been associated with HDL, including an antioxidant function.2 Recent studies have identified the enzyme paraoxonase-1 (PON1) as a primary determinant of the antioxidant potential of HDL3: it protects LDLs from oxidation.4 This proposal is supported by extensive in vitro data, which have demonstrated lower concentrations of lipid peroxides associated with LDL4 and HDL,5 as well as a reduced pathobiologic influence of LDL,6 as a function of PON1 activity. More convincingly, animal models have revealed a greater degree of lipoprotein oxidation and more extensive atheroma formation in mice lacking PON1 activity,7 whereas overexpressing PON1 has a protective influence.8 These observations link the enzyme to risk of vascular disease. In this context, our recent studies have suggested that PON1 promoter polymorphisms, which strongly affect gene expression and serum PON1 levels,9 are associated with coronary disease.10 Lower-expressor genotypes are associated with increased risk of disease. Previous studies, which had focused on coding-region polymorphisms of PON1, identified the enzyme as a genetic risk factor for cardiovascular disease,11–13 although not consistently.14 A recent meta-analysis has provided confirmation of an association between genotype and risk while underlining a potential confounding factor, which is the large intraindividual variations in serum PON1 levels, even within genotypes.15 The enzyme is entirely linked to HDL in serum, and there is a positive, albeit weak, correlation between serum HDL and PON1 concentrations.16 From this perspective, factors that increase HDL might also influence PON1. The principal lipid-lowering drugs are 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase inhibitors and fibrates, which can also raise HDL. With regard to their potential effects on serum PON1, data derived essentially from population studies are somewhat inconsistent for both drugs.17–20 However, the antioxidant properties of HMG CoA reductase inhibitors might provide an indirect mechanism by which PON1 activity could be preserved.21 We have examined in greater detail the influence of an HMG CoA reductase inhibitor, simvastatin, on PON1 gene expression and thus serum concentrations/activities of the enzyme. The null hypothesis was that simvastatin would be without effect on these parameters.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Reporter-Gene Constructs
Reporter-gene constructs containing the PON1 promoter region were made by insertion of polymerase chain reaction–amplified DNA fragments into the pGL-2 Basic vector (Promega) before the firefly luciferase gene. Oligonucleotide primers AAAACGCGTCCCACCTCCACCATTGGGG and ATCCGGATCCGGGGATAGACAAAGGGATCGATG were used for amplification of a 2900-bp DNA fragment, and primers AAAACGCGTCAGATATTGCAGAAGAGAGAAGG and ATCCGGATCCGGGGATAGACAAAGGGATCGATG were used for amplification of a 1000-bp fragment. Human chromosomal DNA extracted from blood cells and thermostable Pfu polymerase were used in the amplification reaction. The conditions for polymerase chain reaction were those reported in Leviev and James.9 Restriction endonucleases Mlu1 and BamH1 (sites included in primers) were used for cloning into MluI and BgII sites of pGL2 Basic. To obtain the constructs containing shorter fragments of the PON1 promoter, the DNA sequence upstream of the PvuII site was removed (resulting in a construct with a 600-bp promoter fragment) or upstream of the Sac1 site (resulting in a 190-bp promoter fragment). To make the deleted construct, the 1000-bp promoter construct was digested with the enzymes EspI and PstI to remove 127 bp (from -66 to -193). Sticky ends created by the enzymes were made blunt by using T4 DNA polymerase, and the plasmid was religated, resulting in the deletion of 127 bp. Restriction enzymes were purchased from Q Biogene.
Cell Cultures and Transfection
HepG2 cells were grown in Dulbecco’s modified Eagle’s medium containing 10% fetal calf serum. Cells were transfected at 70% confluence with 5 µg plasmid DNA by using 15 µL Superfect transfection reagent (Qiagen). Plasmid pRL-TK (Promega) containing Renilla luciferase was used as a control for transfection efficiency. Simvastatin was added to the medium after transfection as a solution in dimethyl sulfoxide (DMSO; final DMSO concentration in medium, 0.05%); to control experiments, DMSO alone was added. Cells were harvested 22 hours after transfection, and luciferase activities were measured with a commercially available kit (Dual Luciferase Reporter Assay kit, Promega). HepG2 cells that had not undergone transfection were also treated with simvastatin under the same conditions. At the end of the treatment period, cells were harvested, and the nuclear fraction was isolated and extracted.22
Electrophoretic Mobility Shift Assays
The electrophoretic mobility shift assay was performed as described,23 with a 32P-labeled 84-bp fragment of the PON1 promoter region (-149 to -66). The DNA-protein complexes were analyzed on 4% polyacrylamide gels. Transcription factor Sp1 was purchased from Promega. Plasmids containing the transcription factor sterol regulatory element–binding protein-2 (SREBP-2) were a generous gift from Prof T. Osborne (University of California, Irvine). They produce the cleaved, transcriptionally active form of SREBP-2.24 SREBP-2 containing a 6His tag was expressed in Escherichia coli and purified by affinity chromatography (His-Bind Quick column, Novagen).
Patients
Patients (N=21; 17 men, 4 women) were recruited from an ongoing study of statin treatment (simvastatin) at the Department of Internal Medicine, Geneva University hospital. It was an independent study (not linked to the gene expression studies) of statin treatment for hypercholesterolemia (LDL cholesterol >3.4mmol/L) in nondiabetic patients with confirmed coronary disease. All participants gave informed, written consent, and the study was conducted according to the requirements of the University Hospital Ethics Commission. The number of patients necessary to observe a 10% change in serum PON1 activities with a P
0.05 (power, 0.8) was estimated as 22 (pairwise assessment; SISA, UitenbroekDG, Binomial SISA, 1997; http://home.clara.net/sisa/binomial.htm). A fasting blood sample was obtained before initiating treatment (20 mg simvastatin, except for 2 patients who received 10 mg) and a second sample, after a mean of 6.70±1.02 weeks of treatment.
Laboratory Analyses
Serum lipid and lipoprotein analyses were performed as described previously.25 PON1 serum activities and concentrations were quantified as described.16 Western blotting was performed as described16 with anti-SREBP2 (Santa Cruz Biotechnology Inc).
Statistical Analyses
Values before and after treatment were analyzed by the paired Student’s t test.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Statin Treatment Increases Serum PON1 Activity and Concentration
The effects of statin treatment on serum levels of PON1 were examined in patients who were not receiving lipid-lowering therapy before entry into the study. The results are shown in Table 1. There was a significant decrease in serum cholesterol and an increase in HDL cholesterol during the treatment period. No significant change was observed for serum triglycerides. With respect to PON1, significant increases in activity were observed for both paraoxon (paraoxonase activity) and phenylacetate (arylesterase activity) hydrolysis (Table 1). The increased activities were accompanied by significant increases in serum concentrations of the enzyme (Table 1). Increases in the specific activities with both substrates did not attain statistical significance (Table 1). Individual responses to simvastatin are shown in Figure 1.
|
|
Statin Upregulates PON1 Promoter Activity
To analyze in greater detail possible mechanisms responsible for the observed increase in PON1 concentration and given the hepatic origin of PON1, HepG2 cells were transiently transfected with PON1 promoter fragments linked to the luciferase reporter gene. The effects on PON1 promoter activity of incubating the transfected cells with simvastatin are shown in Figure 2A. Compared with nontreated, transfected cells, simvastatin treatment was found to upregulate promoter activity in a dose-dependent manner, with a maximal effect at 12 µg/mL (+250%). Different lengths of the promoter fragment were tested (from 190 to 2900 bp), and each was found to be upregulated to a similar degree (Figure 2B). The latter point was further examined by using the 1000-bp promoter fragment from which 127 bp (from nucleotide -67 to -193) has been deleted. This deleted region includes potential recognition sites for Sp1 and SREBPs.26 Deletion of this region eliminated the promoter activity of the fragment and the response to simvastatin (Figure 2C).
|
Cholesterol Biosynthetic Intermediates Modulate the Statin Effect
Coincubation experiments were performed in which simvastatin action was analyzed in the presence of various intermediates of the cholesterol biosynthetic pathway: mevalonate, farnesyl pyrophosphate (FP), geranylgeranyl pyrophosphate (GGP), and squalene. The results are shown in Figure 3. None of the intermediates influenced PON1 promoter activity when incubated alone with the transfected cells. However, when mevalonate and FP were coincubated with simvastatin, they abolished the effect of the statin on PON1 transcriptional activity (Figure 3). GGP also downregulated the stimulatory influence of simvastatin but was less effective than the other 2 intermediates. Similar results were obtained with squalene, which decreased the stimulatory effect of simvastatin treatment by 60%.
|
Simvastatin Upregulates Binding of Nuclear Factors to the PON1 Promoter
To determine whether the statin modulated nuclear factors, PON1 promoter fragments were incubated with nuclear extracts of nontransfected HepG2 cells and subjected to agarose gel electrophoresis. As shown in Figure 4A, incubation with nuclear extracts from HepG2 cells modified the electrophoretic mobility of the radiolabeled promoter fragment, and it efficiently competed with the nonlabeled promoter fragment (Figure 4A). The intensity of the band was significantly greater after incubation with nuclear extracts from simvastatin-treated cells, wherein a 3-fold increase in intensity was observed (Figure 4B and 4C). Coincubation of the cells with mevalonate abrogated the increased intensity of the gel shift band induced by simvastatin (Figure 4B and 4C).
|
SREBP-2 Binds to the PON1 Promoter, Interacts With Sp1, and Upregulates Promoter Activity
A final series of studies examined a role for SREBP-2 in modulation of promoter activity. Purified SREBP-2 alone was shown to modify the electrophoretic mobility of the PON1 promoter fragment (Figure 5A). Although purified SREBP-2 was capable of binding to the PON1 promoter, in the presence of Sp1 a different complex (modified electrophoretic mobility, more intensely stained) was formed (Figure 5A). This complex was supershifted with antibody to Sp1 (Figure 5A). The electrophoretic mobility of the SREBP-2+Sp1 complex corresponded to that observed for the nuclear extract from simvastatin-treated cells (Figure 5B) but differed from that formed with Sp1 alone. Western blot analysis of the HepG2 extracts confirmed an increase in concentration of the processed SREBP-2 peptide in simvastatin-treated cells compared with nontreated cells (Figure 5C).
|
To complement these studies, the influence of SREBP-2 on promoter activity was analyzed in HepG2 cells. The cells were cotransfected with SREBP-2 and the PON1 promoter fragment. As shown in Figure 5D, the presence of SREBP-2 increased promoter activity in a dose-dependent manner (mean 18-fold increase at the highest SREBP-2 concentration; P<0.0001). No promoter activity and no simvastatin effect were observed when the fragment with the deleted 127 bp was transfected into the cells (Figure 5D).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The present study provides evidence compatible with the hypothesis that the HMG CoA reductase inhibitor simvastatin influences expression of PON1. Simvastatin increased PON1 promoter activity in a dose-dependent manner, with similar stimulatory effects on PON1 promoter fragments varying in length from 2900 to 190 bp. Deletion studies confirmed that the proximal 190-bp region of the promoter was required for promoter activity and for the response to simvastatin. The statin also upregulated binding of nuclear factors to the promoter. Mevalonate blocked the effect of simvastatin. Complementary studies revealed that SREBP-2 bound to the PON1 promoter in an apparently interactive manner with Sp1. SREBP-2 upregulated promoter activity, and this effect was also dependent on the proximal region of the promoter. Clinical studies revealed an increase in serum PON1 during statin treatment. The data are consistent with an effect of simvastatin at the molecular level on the PON1 gene, which could raise serum concentrations and activities of the enzyme. This would represent a beneficial impact of simvastatin on antiatherogenic mechanisms residing within HDL.
Cotreatment of transfected cells with mevalonate blocked the stimulatory effect of the statin on promoter activity. This observation associates the influence of simvastatin on PON1 with its ability to inhibit cholesterol synthesis. We also examined other intermediates of the cholesterol biosynthesis pathway. The isoprenoid lipids FP and GGP27 were able, to varying degrees, to reverse statin-mediated upregulation of PON1 promoter activity. However, squalene, a cholesterol biosynthetic intermediate beyond the isoprenoid lipids and committed to cholesterol synthesis, also prevented upregulation of PON1 promoter activity. This result would appear to point to decreased cellular cholesterol content as a factor regulating PON1 expression. In complementary studies with nuclear extracts, it was observed that statin treatment of nontransfected HepG2 cells modified the intensity of the electrophoretic mobility shift assay band, whereas coincubation of cells with mevalonate plus statin blocked the statin effect. These observations indicate (1) binding of nuclear factors to the PON1 promoter fragment and (2) upregulation of these factors by simvastatin. The data were consistent with the possible involvement of SREBPS,28 a major pathway by which cellular cholesterol content can modulate gene expression. SREBP-2 is particularly implicated in regulatory mechanisms involving cholesterol.28 Scanning the sequence of the PON1 promoter fragment used for the mobility assays revealed several features compatible with the involvement of SREBPs. Two regions (-104 to -95 and -138 to -130) were observed to have 70% homology to previously identified SRE sites.29,30 These findings led us to analyze the possible involvement of SREBP-2 in PON1 promoter function. We demonstrated that SREBP-2 alone formed a complex with the PON1 promoter. Moreover, together with Sp1, SREBP-2 formed a complex with the promoter fragment, which had an electrophoretic mobility comparable to that formed with nuclear extracts from HepG2 cells treated with simvastatin. SREBP-2 also upregulated promoter activity. Conversely, deletion of this proximal region from the 1000-bp promoter fragment eliminated promoter activity and the effect of SREBP-2. Of particular interest is the indication that SREBP-2 interacted with Sp1 in binding to the promoter. The SRE site at this position (-104 to -95) is contiguous with a sequence (-111 to -105) corresponding to that of Sp1. The latter is 1 of the additional transcription factors that are important for SREBP-mediated gene activation.28 We previously reported a polymorphism in the Sp1 recognition region (position -107) as being associated with significant variations in serum PON1 concentrations.9 In recent studies, we have demonstrated that the polymorphism modulates binding of Sp1 to the PON1 promoter.26
Our results contrast with those of a recent study proposing that statin downregulates PON1 expression.20 The study also identified a regulatory region near -550 bp that mediated the statin effect, in contradiction to our data, which limit the actions of SREBP-2 to the proximal 200-bp region. Differences in the hepatic cell lines used might play a role, although the study data20 also contradict results from statin effects on PON1 in vivo. It was also suggested that fenofibric acid upregulated promoter activity,20 which also contrasts with in vivo data of fibrate effects on PON1. The observations could not be confirmed with other fibrates, however, and did not involve the peroxisome proliferator–activated receptor transcription factors, which normally mediate the lipid-oriented influence of fibrates.
Few studies have analyzed the potential effect of statins on serum PON, and they are limited to analysis of activity measurements. From an in vitro study,21 it was postulated that metabolites of atorvastatin could protect serum PON1 activity by an antioxidant effect. This alludes to the sensitivity of PON1 activity to oxidized substrates; the enzyme can be inactivated, for example, by oxidized LDL lipids.31 Serum PON1 enzyme activity is reportedly increased in familial hypercholesterolemic patients treated with simvastatin compared with nontreated patients.18 PON1 mass was not measured, so the precise cause of increased activity could not be determined. Moreover, there was a certain inconsistency, because increased activity was not observed for a second substrate commonly used to monitor serum paraoxonase. Nevertheless, it was speculated that increased activity might arise from an antioxidant effect, possibly owing to lowering of oxidized lipids by reduction of serum LDL. Analysis of serum PON1 concentrations in the present study allowed us to demonstrate clearly an increase in PON1 mass.
On a more speculative level, there has been considerable debate in recent years concerning the mechanisms by which statins beneficially influence the atherosclerotic process. Although lowering LDL remains the predominant factor, other pathways have been invoked.32 Given that PON1 is hypothesized to be a primary determinant of the antioxidant and anti-inflammatory capacity of HDL,33,34 statin-induced increases in serum concentrations would appear beneficial. Further studies will be necessary, however, to determine whether it represents an additional mechanism by which simvastatin could influence atherosclerosis, independently of lipid lowering. Although the change in serum PON1 concentrations was relatively minor (mean, 7%), we have recently shown that an increase of this order is able to significantly improve the antioxidant capacity of HDL,35 albeit in the experimental, in vitro setting of copper-induced oxidation.
To conclude, the present study provides evidence for upregulation of PON1 at the gene level by simvastatin in vitro and increased serum PON1 activity and concentration in patients treated with the statin. The study provides evidence consistent with a role for SREBP-2 in the molecular mechanism leading to PON1 gene activation. The effects are of potential benefit to the atherosclerotic process and thus, could reflect an additional pleiotropic effect of the statin. Further work is required to determine whether the effect encompasses other statins.
|
Acknowledgments |
|---|
Acknowledgments
The study was supported by grants from the Swiss National Research Foundation, the Swiss Cardiology Society, the Hans Wilsdorf Foundation, and Merck Sharp & Dohme-Chibret, Switzerland. The authors are particularly grateful to Prof T. Osborne, University of California, Irvine, for supplying the SREBP plasmids. The authors acknowledge the excellent technical assistance of Marie-Claude Brulhart Meynet and Barbara Kalix and thank Dr C. Meier and his staff (Division of Endocrinology and Diabetology, University Hospital, Geneva) for help in obtaining blood samples.
Received July 29, 2003; accepted August 26, 2003.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
- Barter PJ, Rye KA. High density lipoproteins and coronary heart disease. Atherosclerosis. 1996; 121: 1–12.[CrossRef][Medline] [Order article via Infotrieve]
- Banka CL. High density lipoproteins and lipoprotein oxidation. Curr Opin Lipidol. 1996; 7: 139–142.[Medline] [Order article via Infotrieve]
- Navab M, Hama SY, Hough GP, Hedrick CC, Sorenson R, La Du BN, Kobashigawa JA, Fonarow GC, Berliner JA, Laks H, Fogelman AM. High density associated enzymes: their role in vascular biology. Curr Opin Lipidol. 1998; 9: 449–456.[CrossRef][Medline] [Order article via Infotrieve]
- Mackness MI, Arrol S, Durrington PN. Paraoxonase prevents accumulation of lipoperoxides in low-density lipoprotein. FEBS Lett. 1991; 286: 152–154.[CrossRef][Medline] [Order article via Infotrieve]
- Aviram M, Rosenblat M, Bisgaier CL, Newton RS, Primo-Parma SL, La Du BN. Paraoxonase inhibits high-density lipoprotein oxidation and preserves its functions: a possible peroxidative role for paraoxonase. J Clin Invest. 1998; 101: 1581–1590.[Medline] [Order article via Infotrieve]
- Watson AD, Berliner JA, Hama SY, La Du BN, Faull KF, Fogelman AM, Navab M. Protective effect of high density lipoprotein associated paraoxonase: inhibition of the biological activity of minimally oxidised low density lipoprotein. J Clin Invest. 1995; 96: 2882–2891.
- Shih DM, Gu L, Xia Y-R, Navab M, Li W-F, Hama S, Castellani LW, Furlong CE, Costa LG, Fogelman AM, Lusis AJ. Mice lacking serum paraoxonase are susceptible to organophosphate toxicity and atherosclerosis. Nature. 1998; 394: 284–287.[CrossRef][Medline] [Order article via Infotrieve]
- Tward A, Xia YR, Wang XP, Shi YS, Park C, Castellani LW, Lusis AJ, Shih DM. Decreased atherosclerotic lesion formation in human serum paraoxonase transgenic mice. Circulation. 2002; 106: 484–490.
[Abstract/Free Full Text] - Leviev I, James RW. Promoter polymorphisms of the human paraoxonase PON1 gene and serum paraoxonase activities and concentrations. Arterioscler Thromb Vasc Biol. 2000; 20: 516–521.
[Abstract/Free Full Text] - James RW, Leviev I, Ruiz J, Passa P, Froguel P, Garin M-C. The promoter polymorphism T(-107)C of the paraoxonase PON1 gene is a risk factor for coronary heart disease in type 2 patients. Diabetes. 2000; 49: 1390–1393.[Abstract]
- Ruiz J, Blanché H, James RW, Blatter MC, Charpentier G, Morabia A, Passa P, Froguel P. The polymorphism (Gln-Arg192) of the high-density lipoprotein-bound enzyme paraoxonase is an independent cardiovascular risk factor in non-insulin dependent diabetic patients. Lancet. 1995; 346: 869–872.[CrossRef][Medline] [Order article via Infotrieve]
- Serrato M, Marian AJ. A variant of human paraoxonase/arylesterase (HUMPONA) gene is a risk factor for coronary heart disease. J Clin Invest. 1995; 96: 3005–3008.
- Pfohl M, Koch M, Enderle MD, Kühn R, Füllhase J, Karsch KR, Häring HU. Paraoxonase 192 Gln/Arg gene polymorphism, coronary artery disease, and myocardial infarction in type 2 diabetes. Diabetes. 1999; 48: 623–627.[Abstract]
- Gardemann A, Philipp M, Hess K, Katz N, Tillmanns H, Haberbosch W. The paraoxonase Leu-Met54 and Gln-Arg191 gene polymorphisms are not associated with the risk of coronary heart disease. Atherosclerosis. 2000; 152: 421–431.[CrossRef][Medline] [Order article via Infotrieve]
- Durrington PN, Mackness B, Mackness MI. Paraoxonase and atherosclerosis. Arterioscler Thromb Vasc Biol. 2001; 21: 473–480.
[Abstract/Free Full Text] - Blatter Garin M-C, Abbot C, Messmer S, Mackness MI, Durrington P, Pometta D, James RW. Quantification of human serum paraoxonase by enzyme-linked immunoassay: population differences in protein concentrations. Biochem J. 1994; 304: 549–554.
- Durrington PN, Mackness MI, Bhatnagar D, Julier K, Prais H, Arrol S, Morgan J, Wood GN. Effects of two different fibric acid derivatives on lipoproteins, cholesteryl ester transfer, fibrinogen, plasminogen activator inhibitor and paraoxonase activity in type IIb hyperlipoproteinaemia. Atherosclerosis. 1998; 138: 217–225.[CrossRef][Medline] [Order article via Infotrieve]
- Tomas M, Senti M, Garcia-Faria F, Vila J, Torrents A, Covas M, Marrugat J. Effect of simvastatin therapy on paraoxonase activity and related lipoproteins in familial hypercholesterolemic patients. Arterioscler Thromb Vasc Biol. 2000; 20: 2113–2119.
[Abstract/Free Full Text] - Balogh Z, Seres I, Harangi M, Kovacs P, Kakuk G, Paragh G. Gemfibrozil increases paraoxonase activity in type 2 diabetic patients: a new hypothesis of the beneficial action of fibrates? Diabetes Metab. 2001; 27: 604–610.[Medline] [Order article via Infotrieve]
- Gouedard C, Koum-Besson N, Barouki R, Morel Y. Opposite regulation of the human paraoxonase-1 gene PON-1 by fenofibrate and statins. Mol Pharmacol. 2003; 63: 945–956.
[Abstract/Free Full Text] - Aviram M, Rosenblat M, Bisgaier CL, Newton RS. Atorvastatin and gemfibrozil metabolites, but not the parent drugs, are potent antioxidants against lipoprotein oxidation. Atherosclerosis. 1998; 138: 271–280.[CrossRef][Medline] [Order article via Infotrieve]
- Schreiber E, Matthias P, Muller MM, Schaffner W. Rapid detection of octamer binding proteins with ’mini-extracts’ prepared from a small number of cells. Nucleic Acids Res. 1989; 17: 6419.
[Free Full Text] - Denny P, Swift S, Connor F, Ashworth A. An SRY-related gene expressed during spermatogenesis in the mouse encodes a sequence-specific DNA-binding protein. EMBO J. 1992; 11: 3705–3712.[Medline] [Order article via Infotrieve]
- Sanchez HB, Yieh L, Osborne T. Cooperation by sterol regulatory element-binding protein and Sp1 in sterol regulation of low density lipoprotein receptor gene. J Biol Chem. 1995; 270: 1161–1169.
[Abstract/Free Full Text] - James RW, Pometta D. Differences in lipoprotein subfraction composition and distribution between type 1 diabetic men and control subjects. Diabetes. 1990; 39: 1158–1164.[Abstract]
- Deakin S, Leviev I, Brulhart Meynet MC, James RW. Paraoxonase-1 promoter haplotypes and serum paraoxonase: a predominant role in vivo for polymorphic position -107 implicating the transcription factor Sp1. Biochem J. 2003; 372: 643–649.[CrossRef][Medline] [Order article via Infotrieve]
- Edwards PA, Ericsson J. Sterols and isoprenoids: signaling molecules derived from the cholesterol biosynthetic pathway. Annu Rev Biochem. 1999; 68: 157–185.[CrossRef][Medline] [Order article via Infotrieve]
- Edwards PA, Tabor D, Kast HR, Venkateswaran A. Regulation of gene expression by SREBP and SCAP. Biochim Biophys Acta. 2000; 1529: 103–113.[Medline] [Order article via Infotrieve]
- Magana MM, Lin SS, Dooley KA, Osborne TF. Sterol regulation of acetyl coenzyme A carboxylase promoter requires two interdependent binding sites for sterol regulatory element binding proteins. J Lipid Res. 1997; 38: 1630–1638.[Abstract]
- Sato R, Okamoto A, Inoue J, Miyamoto W, Sakai Y, Emoto N, Shimano H, Maeda M. Transcriptional regulation of the ATP citrate-lyase gene by sterol regulatory element-binding proteins. J Biol Chem. 2000; 275: 12497–12502.
[Abstract/Free Full Text] - Aviram M, Rosenblat M, Billecke S, Erogul J, Sorenson R, Bisgaier CL, Newton RS, La Du B. Human serum paraoxonase (PON1) is inactivated by oxidised low density lipoprotein and preserved by antioxidants. Free Rad Biol Med. 1999; 26: 892–904.[CrossRef][Medline] [Order article via Infotrieve]
- Vaughan CJ, Gotto AMJ, Basson CT. The evolving role of statins in the management of atherosclerosis. J Am Coll Cardiol. 2000; 35: 1–10.
[Abstract/Free Full Text] - Berliner JA, Navab M, Fogelman AM, Frank JS, Demer LL, Edwards PA, Edwards AD, Lusis AJ. Atherosclerosis: basic mechanisms: oxidation, inflammation, and genetics. Circulation. 1995; 91: 2488–2496.
[Abstract/Free Full Text] - Van Lenten BJ, Hama SY, de Beer FC, Stafforini DM, McIntyre TM, Prescott SM, La Du BN, Fogelman AM, Navab M. Anti-inflammatory HDL becomes pro-inflammatory during the acute phase response. J Clin Invest. 1995; 96: 2758–2767.
- James RW, Leviev I, Righetti A. Smoking is associated with reduced serum paraoxonase activity and concentration in coronary artery disease patients. Circulation. 2000; 101: 2252–2257.
[Abstract/Free Full Text]
This article has been cited by other articles:
 |
|
 |
|
  M. V. Poulakou, K. I. Paraskevas, I. S. Vlachos, S.-A. P. Karabina, M. R. Wilson, D. C. Iliopoulos, S. I. Tsitsilonis, D. P. Mikhailidis, and D. N. Perrea Effect of Statins on Serum Apolipoprotein J and Paraoxonase-1 Levels in Patients With Ischemic Heart Disease Undergoing Coronary Angiography Angiology, May 1, 2008; 59(2): 137 - 144. [Abstract] [PDF]
|
|
|
|
 |
|
 B. Thyagarajan, D. R. Jacobs Jr., J. J. Carr, O. Alozie, M. W. Steffes, P. Kailash, J. H. Hayes, and M. D. Gross Factors Associated with Paraoxonase Genotypes and Activity in a Diverse, Young, Healthy Population: The Coronary Artery Risk Development in Young Adults (CARDIA) Study Clin. Chem., April 1, 2008; 54(4): 738 - 746. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. -M. Wills, J. E. Landers, H. Zhang, R. J. Richter, A. J. Caraganis, M. E. Cudkowicz, C. E. Furlong, and R. H. Brown Jr Paraoxonase 1 (PON1) organophosphate hydrolysis is not reduced in ALS Neurology, March 18, 2008; 70(12): 929 - 934. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Zhou, K. C. Tan, S. W. Shiu, and Y. Wong Increased serum advanced glycation end products are associated with impairment in HDL antioxidative capacity in diabetic nephropathy Nephrol. Dial. Transplant., March 1, 2008; 23(3): 927 - 933. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. M. Singh, M. H. Shishehbor, and B. J. Ansell High-Density Lipoprotein as a Therapeutic Target: A Systematic Review JAMA, August 15, 2007; 298(7): 786 - 798. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. M. Shih, H. R. Kast-Woelbern, J. Wong, Y.-R. Xia, P. A. Edwards, and A. J. Lusis A role for FXR and human FGF-19 in the repression of paraoxonase-1 gene expression by bile acids J. Lipid Res., February 1, 2006; 47(2): 384 - 392. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. S. Rozek, T. S. Hatsukami, R. J. Richter, J. Ranchalis, K. Nakayama, L. A. McKinstry, D. A. Gortner, E. Boyko, G. D. Schellenberg, C. E. Furlong, et al. The correlation of paraoxonase (PON1) activity with lipid and lipoprotein levels differs with vascular disease status J. Lipid Res., September 1, 2005; 46(9): 1888 - 1895. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||