Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2003;23:136-141
Published online before print October 24, 2002, doi: 10.1161/01.ATV.0000043418.84185.3C
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
23/1/136    most recent
01.ATV.0000043418.84185.3Cv1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilcox, J. N.
Right arrow Articles by Casanova, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilcox, J. N.
Right arrow Articles by Casanova, J.
Related Collections
Right arrow Other Ethics and Policy
Right arrow Coagulation
Right arrow Coumarins
Right arrow Catheter-based coronary and valvular interventions: other
Right arrow Other diagnostic testing
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2003;23:136.)
© 2003 American Heart Association, Inc.


Thrombosis

Extrahepatic Synthesis of Factor VII in Human Atherosclerotic Vessels

Josiah N. Wilcox; Sumiko Noguchi; Juan Casanova

From Emory University School of Medicine, The Winship Cancer Institute, Department of Hematology/Oncology, Atlanta, Ga.

Correspondence to Josiah N. Wilcox, PhD, Emory University, Department of Hematology/Oncology, 1639 Pierce Dr, Room 1115 WMRB, Atlanta, GA 30322. E-mail medjnw{at}emory.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Objective— Coagulation is initiated by the interaction of tissue factor (TF) with plasma coagulation factors VII (FVII) and X (FX). TF is highly expressed in atherosclerotic lesions, but little is known about the synthesis of FX or FVII outside of the liver. Previous studies suggested that macrophages synthesize FVII. We therefore hypothesized that macrophages within atherosclerotic lesions may produce FVII, leading to partial activation of the coagulation cascade.

Methods and Results— Immunohistochemistry was performed using antibodies against FVII, FX, and TF on normal and atherosclerotic vessels. In atherosclerotic lesions, FVII immunostaining was colocalized with TF in macrophages and spindle-shaped smooth muscle cells. FVII mRNA was also detected in these cells using in situ hybridization, suggesting the local synthesis of FVII in atherosclerosis. Reverse transcriptase–polymerase chain reaction confirmed the presence of FVII mRNA in normal and atherosclerotic vessels as well as smooth muscle cells, fibroblasts, and keratinocytes in vitro.

Conclusions— The localization of FVII synthesis outside the liver may be indicative of other cellular functions for this coagulation protein. The observed coexpression of TF and FVII may contribute to autocrine signaling via thrombin-independent mechanisms and may represent a novel mechanism contributing to growth in the setting of vascular disease.


Key Words: tissue factor • factor VII • factor X • thrombosis • atherosclerosis


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
The coagulation cascade is initiated by the interaction of tissue factor (TF) with plasma coagulation factors VII (FVII) and X (FX), which promotes the generation of thrombin.1 TF also activates factor IX (FIX) to IXa2 and is a key protein in the activation of both the intrinsic and extrinsic pathways of coagulation. In normal arteries, TF is found in the adventitia, where it is sequestered away from the circulating coagulation factors until rupture of the vessel.3,4 In the setting of atherosclerosis, TF mRNA and protein have been identified in the fibrous cap and necrotic core of the plaque, where they are involved in the initiation of coagulation on plaque rupture.3,5

In general, FVII and FX are synthesized only in the liver and are found circulating in the blood.69 Very little is known about the synthesis of FVII or FX outside of the liver. Previous studies have shown that isolated human peripheral blood monocytes stimulated with lipopolysaccharide express FVII activity on their surface.10 Human alveolar macrophages may display FVII activity and contain FVII mRNA.1113 Together, these data suggest that monocyte/macrophages or lymphocytes may be sites of FVII synthesis. We therefore hypothesized that macrophages or other cells within atherosclerotic lesions may produce FVII, which could contribute to thrombosis associated with plaque rupture.

In the present series of experiments, we have examined the localization of FVII in normal and atherosclerotic vessels using immunohistochemistry, in situ hybridization, and reverse transcriptase–polymerase chain reaction (RT-PCR). These studies demonstrate that FVII is locally synthesized by macrophages and smooth muscle cells (SMCs) in the setting of atherosclerosis. Additional studies on cultured human SMCs, fibroblasts, and keratinocytes confirm that these cells contain FVII mRNA. The finding of FVII synthesis outside the liver may be indicative of other cellular functions for this coagulation protein.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Tissue Preparation
Protocols for obtaining tissue samples for all studies were approved by the Emory University Hospital Human Investigation Committee. Human aorta samples representative of different stages of atherosclerosis were obtained from transplant donors. The stages of atherosclerotic development were based on the degree of intimal lesion formation, the presence of inflammatory cells, and regions of necrosis, as previously described.14 Normal aorta segments (n=3) had almost no intimal development and no inflammatory cells as defined by CD68 immunohistochemistry; early atherosclerotic aortas (n=4) had only minor intimal development with scattered macrophage staining just under the luminal surface; and advanced atherosclerotic aortas (n=4) had a thickened intima, numerous CD-68–positive macrophages in the intima and media, and regions of necrosis and cholesterol deposits. Advanced carotid atherosclerotic plaques were collected from patients undergoing carotid endarterectomy (n=6). Normal human internal mammary artery specimens (IMA) (n=8) were obtained as excess tissue from coronary artery bypass surgery. Archived samples of normal baboon brachial arteries that had been collected under prior Emory University Institutional Animal Use and Care Committee approved studies were examined for FVII staining (n=3). The baboon vessels were perfusion fixed using 4% paraformaldehyde in 0.1 mol/L sodium phosphate (pH 7.4). Tissue samples were collected, immediately immersed in 4% paraformaldehyde at 4°C for 3 to 4 hours, cryoprotected in 15% sucrose/isotonic phosphate-buffered saline overnight at 4°C, embedded in optimal cutting temperature compound (Miles Laboratories), frozen in liquid nitrogen, and stored at -70°C until sectioning. Six-µm cryosections were cut, thaw-mounted onto Superfrost/Plus slides (Fisher Scientific), refrozen, and stored at -70°C with desiccant until immunohistochemistry or in situ hybridization.

Immunohistochemistry
Immunohistochemistry was performed with specific monoclonal antibodies for FVII (Novo Nordisk, Denmark, FVII-F7A2B17, 1/460 dilution), TF (Genentech Inc, RD010, 1/450 dilution), and a polyclonal antibody for FX (DAKO Patts, 1/800 dilution) using the Vectastain ABC alkaline phosphatase system (Vector Labs). The secondary antibodies were biotinylated horse anti-mouse IgG (1:400, Vector Labs) for FVII or goat anti-rabbit IgG (1/200, Fisher Scientific) for TF and FX. The final reaction product was stained with the alkaline phosphatase substrate kit I (Vector Labs) to give a red end product, and tissues were counterstained with hematoxylin. Serial sections treated with secondary antibodies only or with nonimmune IgG did not show any staining. For cell identification, serial sections were stained with markers for endothelial cells (Ulex lectin; Vector Laboratories, 1/200 dilution), {alpha}-smooth muscle actin for SMC (SM-1; Sigma, 1/800 dilution), or macrophages (CD68; DAKO Patts, 1/50 dilution).

Western Blot
The specificity of the FVII and FX antibodies was confirmed by Western blots. Recombinant human FVIIa (Novo Nordisk, 0.6 µg), human FXa (Enzyme Research Labs, 0.3 µg), and extracts from cultured human endothelial cells were run alone or together on a 4% to 20% Tris-Glycine gel and blotted on nitro-cellulose membranes. These studies suggested that both the FVII and FX antibodies were specific for their respective proteins and did not cross-react with other cellular proteins in the ECV extracts (online Figure I, available at http://atvb.ahajournals.org).

In Situ Hybridization
In situ hybridization using antisense 35S-labeled riboprobes was undertaken as previously described.3,15 Probes specific for human FVII and von Willebrand factor (vWF) were labeled by transcription using 35S-labeled UTP (specific activity 1200 Ci/mmol; Amersham). In situ hybridization was performed using a 1200-bp EcoRI-Hind III fragment of human FVII subcloned into pGEM3Z16 and a 779-bp EcoRI-Hind III fragment of human vWF subcloned into PGEM3Z.17 The final specific activity of these probes was 300 Ci/mmol. vWF in situ hybridization was used as a positive control, because every tissue had endothelial cells, either on the luminal surface or in the adventitial vasa vasorum.

RT-PCR of FVII mRNA
RT-PCR for FVII mRNA was performed using 1 µg of total RNA isolated from internal mammary artery and carotid endarterectomy samples snap frozen in liquid nitrogen at the time of surgery. Human coronary artery SMC (Clonetics) as well as human foreskin fibroblasts and human keratinocytes (Emory Skin Disease Research Center) were also tested for FVII mRNA by RT-PCR. Human liver RNA was used as a control for FVII. Total RNA was isolated using TRIazol reagent (Gibco BRL). The entire RNA sample was used for first-strand cDNA synthesis using random primers and the 1st Strand cDNA kit (Boehringer Mannheim). The following oligomer primers were used for FVII PCR amplification: forward TAATGGGGTAGAGGAGGGCATG; backward AGCAATGAAGGCAGAGCAGCAG. PCR was performed under the following conditions: 95°C for 2 minutes, followed by 30 cycles of 62°C for 30 seconds, 72°C for 1.5 minutes, and 95°C for 30 seconds. The PCR reaction was then incubated at 72°C for 5 minutes and held at 4°C until gel electrophoresis, and the PCR product was visualized by ethidium bromide staining.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Localization of FVII, FX, and TF in Human Normal Aorta by Immunohistochemistry
Normal human aortas (n=3) and IMA (n=8) showed variable weak staining for FVII in the endothelium, medial wall, and inflammatory cells in the adventitial surrounding these vessels (Figure 1). Some vessels showed very little staining at all, whereas others, particularly the smaller IMAs, consistently showed stronger staining of the medial wall. FVII staining in these regions was typically not associated with TF (Figure 1). Consistent with previous studies, TF was not detected in the endothelial or smooth muscle layers of the normal vessels but was localized primarily in adventitial fibroblasts.3,4 Many vessels displayed significant FVII staining of monocytes and inflammatory cells in the adventitia (Figure 1). Serial sections stained with the TF antibody failed to find any corresponding TF in these cells in the same regions. We hypothesize that FVII may be deposited or induced in these tissues during the surgical procedure to isolate the vessels due to mechanical injury or thrombosis. In support of this hypothesis, perfusion-fixed baboon vessels typically show no medial FVII staining at all (Figure 1) and rarely have significant numbers of inflammatory cells in the adventitia. FX staining was not detected in any normal vessels (not shown).



View larger version (113K):
[in this window]
[in a new window]
 
Figure 1. Localization of FVII and TF in normal vessels. Immunohistochemistry was performed to localize FVII and TF in normal human internal mammary arteries. Weak and variable FVII protein staining was found in the medial wall (A), whereas TF was localized in adventitial fibroblasts surrounding the vessels (B). In contrast, no FVII staining was detected in the medial wall of perfusion-fixed baboon brachial arteries (C). FVII staining was often found in monocytes in inflammatory zones in the adventitia around both aortas and internal mammary arteries (D, arrows indicate positive monocytes). Serial sections failed to reveal any TF staining in FVII-positive inflammatory cells (not shown). FX was not detected in any normal vessels (not shown). Magnification, A, B, and D x100; C x125.

Localization of FVII, FX, and TF by Immunohistochemistry in Atherosclerotic Vessels
Human aortas with early (n=4) and advanced (n=4) atherosclerotic lesions as well as carotid arteries with advanced atherosclerotic lesions (n=6) were examined by immunohistochemistry for the distribution of FVII, FX, and TF.

FVII and TF immunostaining were found colocalized throughout atherosclerotic development from the earliest fatty streaks to the most advanced lesions. In early intimal thickenings, TF and FVII were colocalized with CD68-positive foamy macrophages, whereas FX staining was not detected in these vessels (Figure 2). In advanced lesions, FVII protein staining was found in macrophages overlying the necrotic core (Figure 3) and in spindle-shaped SMCs in the fibrous cap (Figure 4). A comparison of the distribution of FVII and {alpha}-smooth muscle actin staining on the serial sections suggested that the spindle-shaped cells were either SMCs or myofibroblasts. FX protein was consistently found distributed throughout the matrix of the necrotic core and in the regions adjacent to the cholesterol clefts in areas that also contained immunoreactive TF (Figure 3). In some advanced carotid lesions, TF, FX, and FVII were all colocalized in the inflammatory zone overlying the necrotic core (online Figure II, available at http://atvb.ahajournals.org).



View larger version (125K):
[in this window]
[in a new window]
 
Figure 2. Localization of FVII, TF, and FX protein in early atherosclerotic lesions of human aorta. Immunohistochemistry was performed to localize FVII (A), TF (B), and FX (C) in human aortas showing early fatty streak development. FVII and TF staining were found in early intimal thickenings containing numerous CD68-positive inflammatory cells (D). Comparison of FVII and TF staining with CD68 staining confirmed that FVII and TF protein were localized in macrophages in the early atherosclerotic intima. FX staining was not found in the intima of early lesions (C). Arrows indicate border of internal elastic lamina. Magnification x50.



View larger version (101K):
[in this window]
[in a new window]
 
Figure 3. Localization of FVII, TF, and FX protein in foam cell regions of advanced carotid atherosclerotic plaques. FVII (A), FX (B), and TF (C) were localized in advanced atherosclerotic plaques obtained from carotid endarterectomy surgery by immunohistochemistry. FVII protein staining was found in the luminal endothelial cells and macrophage foam cells overlying the necrotic core (nc). FX staining was not cell-associated but was found distributed throughout the necrotic core separate from FVII. TF was colocalized with FVII in foamy macrophages just beneath the luminal surface and in the necrotic core colocalized with FX. The presence of a continuous endothelial layer and macrophages in this lesion was confirmed by staining of serial sections with Ulex lectin or CD68, respectively (not shown). Magnification x125.



View larger version (117K):
[in this window]
[in a new window]
 
Figure 4. Localization of FVII in SMCs in the fibrous cap of advanced human atherosclerotic lesions. Human carotid endarterectomy specimens were stained with antibodies against FVII (A), TF (B), {alpha}-smooth muscle actin (C), or CD68 (D). FVII protein was consistently localized in spindle-shaped SMCs (A) in the fibrous cap. Note that the region where the FVII-positive cells are located is rich in {alpha}-actin–positive SMCs (C) but devoid of CD68-positive macrophages (D). Magnification x125.

Localization of FVII mRNA in Human Normal and Atherosclerotic Aorta by In Situ Hybridization
To confirm that FVII immunostaining was attributable to local synthesis of FVII in the vessel wall, in situ hybridization was performed using an 35S-labeled human FVII antisense riboprobe (Figure 5). FVII mRNA was found in inflammatory and mesenchymal-appearing cells in the intima of early and advanced atherosclerotic aorta. The mRNA localization by in situ hybridization colocalized with FVII protein staining. FVII mRNA was not found in medial SMCs of normal or atherosclerotic vessels but could often be found in the adventitia in mesenchymal-appearing cells surrounding the vasa vasorum. Control in situ hybridizations were performed using either an 35S-labeled human FVII sense riboprobe or a riboprobe directed against VWF mRNA, which either showed no hybridization or localization to endothelial cells, respectively (not shown).



View larger version (98K):
[in this window]
[in a new window]
 
Figure 5. The distribution of FVII mRNA in human atherosclerotic aorta. In situ hybridization was performed on human aortas with early atherosclerotic lesions using 35S-labeled human FVII riboprobe. FVII mRNA was localized in inflammatory cells and mesenchymal-appearing cells in the intima of early atherosclerotic aorta (A). FVII mRNA was also found in the adventitia localized to adventitial fibroblasts and cells associated with the vasa vasorum (B). FVII protein (C) and mRNA (D) were colocalized in the intima of early atherosclerotic lesions in the aorta by immunohistochemistry and in situ hybridization. Magnification, A and B, x80; C and D, x50.

RT-PCR Studies
To confirm the presence of FVII mRNA in vascular tissues, we also examined snap-frozen normal human IMAs and carotid endarterectomy samples as well as cultured cells for the presence of FVII mRNA by RT-PCR (Figure 6). These results confirmed the presence of FVII mRNA in both normal and atherosclerotic vessels. FVII mRNA was also detected in human aortic SMC as well as dermal fibroblasts and keratinocytes in vitro. Together these results suggest that many different types of cells make FVII outside the liver.



View larger version (54K):
[in this window]
[in a new window]
 
Figure 6. RT-PCR demonstrating the presence of FVII mRNA in normal and atherosclerotic vessels and non-liver cells in vitro. Total RNA was isolated from snap-frozen human liver (LIV), internal mammary artery (IMA), advanced carotid atherosclerotic plaques obtained by carotid endarterectomy (TEA), and human keratinocytes (KER), SMCs, and fibroblasts (FIB) maintained in vitro and analyzed by RT-PCR, as described in Methods. A predicted 325-bp band corresponding to FVII was detected in extracts from normal and atherosclerotic vessels, confirming the localization of FVII mRNAs in these tissues. FVII mRNA was also detected in SMCs, fibroblasts, and keratinocytes. The FVII band in the vessels and cells was sequenced and confirmed to be identical to human FVII mRNA.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
TF is a highly thrombogenic protein. In normal vessels, TF is typically found in the adventitia sequestered away from the blood and the circulating coagulation proteins.3,4 Thus the coagulation cascade is only activated when a blood vessel breaks and the circulating factors come into contact with TF localized in the adventitia. Previous studies have shown that TF is upregulated in the setting of atherosclerosis and may be involved in thrombus formation associated with plaque rupture.3,5,18,19 Additional studies have demonstrated that TF is upregulated at sites of vascular injury after angioplasty20 and may play a role in the proliferative process associated with restenosis, possibly attributable to local thrombin generation in the intima. Very little information exists, however, about the distribution or synthesis of other coagulation factors outside of the liver, specifically FX and FVII, which are required for TF activity.

Previous work concluded that FVII is a liver-specific gene.6,7,21 However, there are several reports indicating that macrophages or monocytes may produce FVII.1013 Mouse peritoneal macrophages in culture make several vitamin K–dependent coagulation factors.22 Human alveolar macrophages in vitro make FVII protein, and these cells also display procoagulant activities in FVII-depleted serum, which is blocked by FVII antibodies.13 Human peripheral blood monocytes produce a proteolytically active form of FVII when stimulated with endotoxin.10 Macrophages can be induced to synthesize TF on stimulation with inflammatory cytokines2326 and produce TF in human atherosclerotic plaques.3 We therefore began this study with the hypothesis that macrophages in the atherosclerotic lesion might make both FVII and TF, thus increasing the prothrombotic potential of the lesions. Our results confirmed our initial hypothesis but indicate that the expression of FVII is much more widespread than initially thought.

The present series of experiments provides evidence that FVII is synthesized outside of the liver and is found in a variety of cells in normal and atherosclerotic vessels. Normal vessels showed only weak staining for FVII, possibly associated with some tissue injury during surgical isolation. No FVII staining was found in perfusion-fixed baboon vessels. In early and advanced atherosclerotic lesions, however, there were extensive deposits of FVII, mostly found in SMCs and macrophage-rich regions colocalized with TF. Foam cells and macrophages in the necrotic core adjacent to the cholesterol clefts and foamy macrophages in early intimal thickenings all showed strong cytoplasmic staining with FVII antibodies. Although it is possible that FVII protein staining found in normal and atherosclerotic vessels originated from the blood, the finding of FVII mRNA by both in situ hybridization and RT-PCR suggests that these tissues are sites of FVII synthesis.

These studies demonstrated that FX was found in macrophage-rich regions in the necrotic core of advanced atherosclerotic vessels, where it was colocalized with FVII and TF. FX staining was primarily localized in the extracellular matrix of these regions and was not cell associated. It has been generally thought that FX is synthesized primarily in the liver,9 but other organs, such as kidney, spleen, and intestine, have been shown to produce small amounts of FX.8 FX has been described localized on the cell surface of lymphocytes within germinal centers of human lymph nodes.27 Future studies will need to be performed to determine if FX mRNA may be found outside the liver or in atherosclerotic lesions.

Several studies have suggested a correlation between lipids and the coagulation factors TF, FX, and FVII. Macrophages express TF on stimulation by plasma lipoproteins,26,28 modified LDL,29 or oxidized LDL in vitro.30,31 Oxidized LDL has also been demonstrated to stimulate endothelial production of TF in vitro.32 In the setting of atherosclerosis, TF can be detected in foam cells present in the early fatty streak and is also found in advanced lesions in macrophages and foam cells in regions adjacent to cholesterol clefts.3 These observations suggest a role for oxidized lipids in the induction of TF expression in macrophages. Levels of FVII and FX in plasma are positively related to plasma cholesterol and triglyceride concentrations.3335 Plasma levels of HDL-cholesterol and LDL-cholesterol are correlated with FVII and FX activity in the plasma,36 and chylomicron and VLDL have a strong binding affinity for FVII.37 Tissue factor pathway inhibitor circulates in the blood in association with plasma lipoproteins, and tissue factor pathway inhibitor levels are also correlated with plasma lipid levels as well.38,39 The colocalization of FVII and FX with TF in macrophages in the atherosclerotic plaques in the present study may suggest that lipids may play a role in the activation of the TF-dependent coagulation pathway in these vessels.

FVII mRNA and protein were found in SMC/myofibroblasts in the fibrous cap of the advanced atherosclerotic lesions. It is interesting to note that several coagulation factors that contain EGF-like domains, including FVII, have mitogenic activities on SMC in culture.4043 The localization of FVII in mesenchymal-appearing cells, SMCs, and fibroblasts may suggests that this protein has a role different from that as a cofactor of TF for the activation of coagulation cascade. Recent work suggests that the interaction of FVII with TF may directly activate a thrombin-independent signaling cascade, resulting in an increase in cytosolic calcium and upregulation of egr-144 and several other growth-related genes.45 The colocalization of TF and FVII in SMCs and macrophages in atherosclerotic lesions raises the possibility of autocrine or paracrine signaling, which might affect cell proliferation within the lesions.

In conclusion, these studies indicate that FVII and FX are found in the setting of atherosclerosis in association with TF, suggesting the possibility of a partial activation of the coagulation cascade within the intima of the developing plaque, which may increase the thrombotic potential of the lesions. Alternatively, autocrine production of TF and FVII may stimulate a thrombin-independent signaling pathway, resulting in expression of several growth-associated genes. The novel finding of widespread synthesis of FVII in extrahepatic tissues raises the possibility of alternative cellular functions for this coagulation factor.


*    Acknowledgments
 
This work was supported by NIH grants HL49743 and HL48667 (to Dr Wilcox). The authors wish to thank Hongzhi Xu for expert technical assistance and Mirella Esban of Novo Nordisk for useful discussions and providing the FVII antibody and the Western blot in online Figure I.

Received September 3, 2002; accepted October 9, 2002.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Weiss HJ, Lages B. Evidence for tissue factor-dependent activation of the classic extrinsic coagulation mechanism in blood obtained from bleeding time wounds. Blood. 1988; 71: 629–635.[Abstract/Free Full Text]

2. Osterud B, Rapaport SI. Activation of factor IX by the reaction product of tissue factor and factor VII: additional pathway for initiating blood coagulation. Proc Natl Acad Sci U S A. 1977; 74: 5260–5264.[Abstract/Free Full Text]

3. Wilcox JN, Smith KM, Schwartz SM, Gordon D. Localization of tissue factor in the normal vessel wall and in the atherosclerotic plaque. Proc Natl Acad Sci U S A. 1989; 86: 2839–2843.[Abstract/Free Full Text]

4. Drake TA, Morrissey JH, Edgington TS. Selective cellular expression of tissue factor in human tissues: implications for disorders of hemostasis and thrombosis. Am J Pathol. 1989; 134: 1087–1097.[Abstract]

5. Thiruvikraman SV, Guha A, Roboz J, Taubman MB, Nemerson Y, Fallon JT. In situ localization of tissue factor in human atherosclerotic plaques by binding of digoxigenin-labeled factors VIIa and X. Lab Invest. 1996; 75: 451–461.[Medline] [Order article via Infotrieve]

6. Greenberg D, Miao CH, Ho WT, Chung DW, Davie EW. Liver-specific expression of the human factor VII gene. Proc Natl Acad Sci U S A. 1995; 19: 12347–12351.

7. Erdmann D, Heim J. Orphan nuclear receptor HNF-4 binds to the human coagulation factor VII promoter. J Biol Chem. 1995; 270: 22988–22996.[Abstract/Free Full Text]

8. Ogasawara T, Gotoh B, Suzuki H, Asaka J, Shimokata K, Rott R, Nagai Y. Expression of factor X and its significance for the determination of paramyxovirus tropism in the chick embryo. EMBO J. 1992; 11: 467–472.[Medline] [Order article via Infotrieve]

9. Miao CH, Leytus SP, Chung DW, Davie EW. Liver-specific expression of the gene coding for human factor X, a blood coagulation factor. J Biol Chem. 1992; 267: 7395–7401.[Abstract/Free Full Text]

10. Tsao BP, Fair DS, Curtiss LK, Edgington TS. Monocytes can be induced by lipopolysaccharide-triggered T lymphocytes to express functional factor VII/VIIa protease activity. J Exp Med. 1984; 159: 1042–1057.[Abstract/Free Full Text]

11. McGee MP, Wallin R, Devlin R, Rothberger H. Identification of mRNA coding for factor VII protein in human alveolar macrophages–coagulant expression may be limited due to deficient postribosomal processing. Thromb Haemost. 1989; 61: 170–174.[Medline] [Order article via Infotrieve]

12. McGee MP, Devlin R, Saluta G, Koren H. Tissue factor and factor VII messenger RNAs in human alveolar macrophages: effects of breathing ozone. Blood. 1990; 75: 122–127.[Abstract/Free Full Text]

13. Chapman HA Jr, Allen CL, Stone OL, Fair DS. Human alveolar macrophages synthesize factor VII in vitro: possible role in interstitial lung disease. J Clin Invest. 1985; 75: 2030–2037.

14. Wilcox JN, Subramanian RR, Sundell CL, Tracey WR, Pollock JS, Harrison DG, Marsden PA. Expression of multiple isoforms of nitric oxide synthase in normal and atherosclerotic vessels. Arterioscler Thromb Biol. 1997; 17: 2479–2488.[Abstract/Free Full Text]

15. Wilcox JN. Fundamental principles of in situ hybridization. J Histochem Cytochem. 1993; 41: 1725–1733.[Abstract]

16. Hagen FS, Gray CL, OHara P, Grant FJ, Saari GC, Woodbury RG, Hart CE, Insley M, Kisiel W, Kurachi K, Davie EW. Characterization of a cDNA coding for human factor VII. Proc Natl Acad Sci U S A. 1986; 83: 2412–2416.[Abstract/Free Full Text]

17. Verweij CL, Diergaarde PJ, Hart M, Pannekoek H. Full-length von Willebrand factor (vWF) cDNA encodes a highly repetitive protein considerably larger than the mature vWF subunit. EMBO J. 1986; 5: 1839–1847.[Medline] [Order article via Infotrieve]

18. Marmur JD, Thiruvikraman SV, Fyfe BS, Guha A, Sharma SK, Ambrose JA, Fallon JT, Nemerson Y, Taubman MB. Identification of active tissue factor in human coronary atheroma. Circulation. 1996; 94: 1226–1232.[Abstract/Free Full Text]

19. Annex BH, Denning SM, Channon KM, Sketch MH Jr, Stack RS, Morrissey JH, Peters KG. Differential expression of tissue factor protein in directional atherectomy specimens from patients with stable and unstable coronary syndromes. Circulation. 1995; 91: 619–622.[Abstract/Free Full Text]

20. Marmur JD, Rossikhina M, Guha A, Fyfe B, Friedrich V, Mendlowitz M, Nemerson Y, Taubman MB. Tissue factor is rapidly induced in arterial smooth muscle after balloon injury. J Clin Invest. 1993; 91: 2253–2259.

21. Pollak ES, Hung HL, Godin W, Overton GC, High KA. Functional characterization of the human factor VII 5'-flanking region. J Biol Chem. 1996; 271: 1738–1747.[Abstract/Free Full Text]

22. Osterud B, Lindahl U, Seljelid R. Macrophages produce blood coagulation factors. FEBS Lett. 1980; 120: 41–43.[CrossRef][Medline] [Order article via Infotrieve]

23. Scarpati EM, Wen D, Broze GJJ, Miletich JP, Flandermeyer RR, Siegel NR, Sadler JE. Human tissue factor: cDNA sequence and chromosome localization of the gene. Biochemistry. 1987; 26: 5234–5238.[CrossRef][Medline] [Order article via Infotrieve]

24. Lyberg T, Nilsson K, Prydz H. Synthesis of thromboplastin by U-937 cells. Br J Haematol. 1982; 51: 631–641.[Medline] [Order article via Infotrieve]

25. Tipping PG, Campbell DA, Boyce NW, Holdsworth SR. Alveolar macrophage procoagulant activity is increased in acute hyperoxic lung injury. Am J Pathol. 1988; 131: 206–212.[Abstract]

26. Levy GA, Schwartz BS, Curtiss LK, Edgington TS. Plasma lipoprotein induction and suppression of the generation of cellular procoagulant activity in vitro. J Clin Invest. 1981; 67: 1614–1622.

27. Yamakawa M, Takagi M, Tajima K, Ohe S, Osanai T, Kudo S, Ito M, Sato T, Imai Y. Localization of blood coagulation factors and fibrinolysis factors within lymphoid germinal centers in human lymph nodes. Histochemistry. 1991; 96: 123–127.[CrossRef][Medline] [Order article via Infotrieve]

28. Schwartz BS, Levy GA, Curtiss LK, Fair DS, Edgington TS. Plasma lipoprotein induction and suppression of the generation of cellular procoagulant activity in vitro: two procoagulant activities are produced by peripheral blood mononuclear cells. J Clin Invest. 1981; 67: 1650–1658.

29. Schuff-Werner P, Claus G, Armstrong VW, Kostering H, Seidel D. Enhanced procoagulatory activity (PCA) of human monocytes/macrophages after in vitro stimulation with chemically modified LDL. Atherosclerosis. 1989; 78: 109–112.[CrossRef][Medline] [Order article via Infotrieve]

30. Drake TA, Hannani K, Fei HH, Lavi S, Berliner JA. Minimally oxidized low-density lipoprotein induces tissue factor expression in cultured human endothelial cells. Am J Pathol. 1991; 138: 601–607.[Abstract]

31. Weis JR, Pitas RE, Wilson BD, Rodgers GM. Oxidized low-density lipoprotein increases cultured human endothelial cell tissue factor activity and reduces protein C activation. FASEB J. 1991; 5: 2459–2465.[Abstract]

32. Fei H, Berliner JA, Parhami F, Drake TA. Regulation of endothelial cell tissue factor expression by minimally oxidized LDL and lipopolysaccharide. Arterioscler Thromb. 1993; 13: 1711–1717.[Abstract/Free Full Text]

33. Meade TW, Mellows S, Brozovic M, Miller GJ, Chakrabarti RR, North WR, Haines AP, Stirling Y, Imeson JD, Thompson SG. Haemostatic function and ischaemic heart disease: principal results of the Northwick Park Heart Study. Lancet. 1986; 2: 533–537.[Medline] [Order article via Infotrieve]

34. Constantino M, Merskey C, Kudzma DJ, Zucker MB. Increased activity of vitamin K-dependent clotting factors in human hyperlipoproteinaemia: association with cholesterol and triglyceride levels. Thromb Haemost. 1977; 38: 465–474.[Medline] [Order article via Infotrieve]

35. Simpson HC, Mann JI, Meade TW, Chakrabarti R, Stirling Y, Woolf L. Hypertriglyceridaemia and hypercoagulability. Lancet. 1983; 1: 786–790.[Medline] [Order article via Infotrieve]

36. Hoffman CJ, Lawson WE, Miller RH, Hultin MB. Correlation of vitamin K-dependent clotting factors with cholesterol and triglycerides in healthy young adults. Arterioscler Thromb. 1994; 14: 1737–1740.[Abstract/Free Full Text]

37. de Sousa JC, Soria C, Ayrault-Jarrier M, Pastier D, Bruckert E, Amiral J, Bereziat G, Caen JP. Association between coagulation factors VII and X with triglyceride rich lipoproteins. J Clin Pathol. 1988; 41: 940–944.[Abstract/Free Full Text]

38. Hansen JB, Huseby NE, Sandset PM, Svensson B, Lyngmo V, Nordoy A. Tissue-factor pathway inhibitor and lipoproteins: evidence for association with and regulation by LDL in human plasma. Arterioscler Thromb. 1994; 14: 223–229.[Abstract/Free Full Text]

39. Lesnik P, Vonica A, Guerin M, Moreau M, Chapman MJ. Anticoagulant activity of tissue factor pathway inhibitor in human plasma is preferentially associated with dense subspecies of LDL and HDL and with Lp(a). Arterioscler Thromb. 1993; 13: 1066–1075.[Abstract/Free Full Text]

40. Gasic GP, Arenas CP, Gasic TB, Gasic GJ. Coagulation factors X, Xa, and protein S as potent mitogens of cultured aortic smooth muscle cells. Proc Natl Acad Sci U S A. 1992; 89: 2317–2320.[Abstract/Free Full Text]

41. Furie B, Furie BC. The molecular basis of blood coagulation. Cell. 1988; 53: 505–518.[CrossRef][Medline] [Order article via Infotrieve]

42. Dahlback B, Lundwall A, Stenflo J. Primary structure of bovine vitamin K-dependent protein S. Proc Natl Acad Sci U S A. 1986; 83: 4199–4203.[Abstract/Free Full Text]

43. Esmon CT. The regulation of natural anticoagulant pathways. Science. 1987; 235: 1348–1352.[Abstract/Free Full Text]

44. Camerer E, Rottingen JA, Gjernes E, Larsen K, Skartlien AH, Iversen JG, Prydz H. Coagulation factors VIIa and Xa induce cell signaling leading to up-regulation of the egr-1 gene. J Biol Chem. 1999; 274: 32225–32233.[Abstract/Free Full Text]

45. Camerer E, Gjernes E, Wiiger M, Pringle S, Prydz H. Binding of factor VIIa to tissue factor on keratinocytes induces gene expression. J Biol Chem. 2000; 275: 6580–6505.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
IOVSHome page
A. Ayala, D. J. Warejcka, M. Olague-Marchan, and S. S. Twining
Corneal Activation of Prothrombin to Form Thrombin, Independent of Vascular Injury
Invest. Ophthalmol. Vis. Sci., January 1, 2007; 48(1): 134 - 143.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Koizume, M.-S. Jin, E. Miyagi, F. Hirahara, Y. Nakamura, J.-H. Piao, A. Asai, A. Yoshida, E. Tsuchiya, W. Ruf, et al.
Activation of Cancer Cell Migration and Invasion by Ectopic Synthesis of Coagulation Factor VII
Cancer Res., October 1, 2006; 66(19): 9453 - 9460.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. M.H. Spronk
Vitamin K Epoxide Reductase Complex and Vascular Calcification: Is This the Important Link Between Vitamin K and the Arterial Vessel Wall?
Circulation, March 28, 2006; 113(12): 1550 - 1552.
[Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. E. Tilley, B. Pedersen, R. Pawlinski, Y. Sato, J. H. Erlich, Y. Shen, S. Day, Y. Huang, D. T. Eitzman, W. A. Boisvert, et al.
Atherosclerosis in Mice Is Not Affected by a Reduction in Tissue Factor Expression
Arterioscler Thromb Vasc Biol, March 1, 2006; 26(3): 555 - 562.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
I. Ott, B. Weigand, R. Michl, I. Seitz, N. Sabbari-Erfani, F.-J. Neumann, and A. Schomig
Tissue Factor Cytoplasmic Domain Stimulates Migration by Activation of the GTPase Rac1 and the Mitogen-Activated Protein Kinase p38
Circulation, January 25, 2005; 111(3): 349 - 355.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. V. M. Rao and U. R. Pendurthi
Tissue Factor-Factor VIIa Signaling
Arterioscler Thromb Vasc Biol, January 1, 2005; 25(1): 47 - 56.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
M. W. Hahn, M. V. Rockman, N. Soranzo, D. B. Goldstein, and G. A. Wray
Population Genetic and Phylogenetic Evidence for Positive Selection on Regulatory Mutations at the Factor VII Locus in Humans
Genetics, June 1, 2004; 167(2): 867 - 877.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
23/1/136    most recent
01.ATV.0000043418.84185.3Cv1
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilcox, J. N.
Right arrow Articles by Casanova, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilcox, J. N.
Right arrow Articles by Casanova, J.
Related Collections
Right arrow Other Ethics and Policy
Right arrow Coagulation
Right arrow Coumarins
Right arrow Catheter-based coronary and valvular interventions: other
Right arrow Other diagnostic testing