Thrombosis |
From the Department of Cardiovascular Medicine (T.K., S.F., D.G., N.I., K.W., T.F., T.S., A.K.), Hokkaido University Graduate School of Medicine, Sapporo, Japan; the Howard Hughes Medical Institute (A.M.), Duke University, Durham, NC; and the Department of Medicine (B.E.S.), University of Vermont, Burlington.
Correspondence to Satoshi Fujii, MD, PhD, Department of Cardiovascular Medicine, Hokkaido University Graduate School of Medicine, Sapporo, Japan 060-8638. E-mail sfujii@ med.hokudai.ac.jp
| Abstract |
|---|
|
|
|---|
, inhibited basal and bFGF-stimulated PAI-1 expression. By inducing PAI-1 expression from ECs, bFGF may control proteolysis and fibrinolysis in vessel walls.
Key Words: endothelium basic fibroblast growth factors plasminogen activator inhibitors promoters fibric acid
| Introduction |
|---|
|
|
|---|
Endothelial cells (ECs) elaborate fibrinolytic system proteins, including tissue-type plasminogen activator (tPA) and urokinase-type plasminogen activator.2,6 Basic fibroblast growth factor (bFGF), a growth factor elaborated by vascular cells, modulates the expression of plasminogen activators in ECs and smooth muscle cells.7 10 Excessive plasmin generation and proteolysis induced by bFGF-mediated overproduction of plasminogen activators may interfere with cell adhesion or atherosclerotic plaque development. However, the influence, if any, of bFGF on the synthesis of PAI-1 in ECs has not been elucidated. The potential influence may well contribute to physiological or pathophysiological consequences of the elaboration of bFGF. The local synthesis of PAI-1 and the balance between plasminogen activation and inhibition determine the generation of plasmin, which, in turn, influences regional fibrinolytic balance, thus modulating the atherothrombotic11 and angiogenic12 properties of ECs.
We have previously reported that a lipid-lowering fibric acid derivative, which activates peroxisome proliferator-activated receptor-
(PPAR
), reduces PAI-1 expression in human hepatoma cells in vitro.13 In the present study, we characterized the influence of bFGF and fibric acid on the elaboration of PAI-1 in vitro by cultured ECs and sought to delineate the potential mechanisms that may underlie increased PAI-1 expression in vivo.
| Methods |
|---|
|
|
|---|
Cell Culture Procedures
HUVECs between the second and third passages were grown to confluence under 5% CO2 at 37°C with EC basal medium (EBM-2, Clonetics). ECV cells were grown to confluence in medium 199 containing 10% calf serum (Hyclone), 100 U/mL penicillin, and 100 µg/mL streptomycin. Confluent ECs were incubated in serum-free DMEM for 24 hours and then incubated with fresh serum-free DMEM containing bFGF. Media were collected and stored at - 80°C. In some experiments, fenofibric acid was prepared as previously described,13 and ECV cells were preincubated with fenofibric acid for 24 hours in serum-free DMEM before exposure to bFGF. When inhibitors were used, ECV cells were pretreated with the inhibitor for 1 hour before the addition of bFGF. Cell viability was determined by trypan blue exclusion and MTT assay (Sigma).
Assays for PAI-1 Activity, PAI-1 Antigen, tPA Antigen, and Total Protein
PAI-1 activity was measured as previously described.14 Human PAI-1 antigen in the media was measured by an ELISA specific for human PAI-1 (Biopool). Human tPA antigen in the media was measured by ELISA (American Diagnostica). Total protein in the conditioned media was assayed with the BCA protein assay (Pierce).
Assays for PAI-1 Antigen by Western Blotting
Equivalent amounts of protein from conditioned medium were diluted 1:1 with sample buffer (0.25 mol/L Tris-HCl [pH 6.8], 40% glycerol, 4% SDS, 20% ß-mercaptoethanol, and 0.01% bromophenol blue) and loaded on a 10% SDS-polyacrylamide gel. PAI-1 antigen expression in the conditioned media was assayed by Western blotting as previously described15 with antibodies specific for human PAI-1 and quantified by the method of Huang and Amero.16
Isolation of Total RNA and Northern Blotting
Total RNA was isolated by an acid guanidinium thiocyanate-phenol-chloroform method. Northern blot analysis was performed as described previously.13 Gel-purified polymerase chain reaction (PCR) fragments for PAI-1 (1112 to 1612) and ß -actin, radiolabeled with [
-32P]dCTP by random priming, were used as probes. The radioactivity of hybridized bands was detected by autoradiography, which was then subjected to densitometry.
Promoter-Luciferase Vector and Expression Plasmid
The human PAI-1 promoter 5' flanking region17 from -747 to 15 (762 bp) was amplified by PCR from human genomic DNA isolated from umbilical vein with the forward primer 5'-TCCAACCTCAGCCAGACAAG-3' (-747 to -727) and the reverse primer 5'-TCTCCTCGTGTCGACACAAA-3' (-5 to 15), respectively. The PCR product was gel-purified and subcloned into the multiple cloning sites of the pT7Blue T-Vector (Novagen). The T-vector was digested with EcoRI and HindIII and subcloned into the multiple cloning sites of the promoterless Renilla luciferase reporter gene vector pRL-null (Promega). Basal expression of luciferase activity of the PAI-1 promoter vector was detected by the PAI Full (-747/15) luciferase vector. The 5' deletion mutants were generated by PCR with the 5' primers complementary to the PAI-1 gene sequence. Deletion mutants of PAI-1 promoter vectors were constructed as follows: PAI 1F (-553/15) luciferase, PAI 2F (-313/15) luciferase, PAI 3F (- 260/15) luciferase, and PAI 4F (-205/15) luciferase. Point mutation of PAI-1 promoter vectors was also constructed. Basal expression of luciferase activity of PAI-1 promoter vector was detected by the PAI Full luciferase vector, which has a normal Ets-1-like site (5'-GGACATCCGGGAG-3'). The mutation vector has 2 point mutations in the Ets-1-like site as underlined (5'-GTTCATCCGGGAG-3').
DNA Transfection and Luciferase Assay
ECV cells were cultured to
80% confluence. The cells were cotransfected with each PAI-1 promoter Renilla luciferase fusion DNA reporter construct (20 µg of pRL vector) and a Firefly luciferase pGL vector to control for transfection efficiency (20 µg) introduced by electroporation (240 V, 960 microfarad). These cells were cultured in DMEM supplemented with 10% calf serum for 20 hours, stimulated with bFGF (10 ng/mL) in DMEM containing 10% calf serum for 24 hours, and harvested. Cell lysate luciferase activity was measured with the use of a Dual-Luciferase Reporter Assay System (Promega) and luminometer (Turner Design). Normalized luciferase activity was calculated as the ratio of luciferase activity to control vector activity. Results for each reporter construct were expressed as percent induction compared with results in transfected unstimulated cells.
Electrophoretic Mobility Shift Assay
For electrophoretic mobility shift assay (EMSA), ECV cells were stimulated for 2 hours with bFGF before nuclear extracts were prepared. The oligonucleotide (ACGCTAGGACATCCGGGAGCATG) spanning the Ets-1-like site (as underlined above) in the human PAI-1 promoter was end-labeled with [
-32P]dCTP by the Klenow fragment of DNA polymerase I and purified. Nuclear extracts (0.3 µg) were incubated with the labeled oligonucleotide. DNA-protein complexes were separated from free probe by 5% nondenaturing polyacrylamide gel, and autoradiography was performed. Specificity was determined by the addition of an excess of unlabeled (cold) oligonucleotide to the nuclear extracts before formation of DNA-protein complexes.
Statistical Analysis
Data are mean±SEM. Differences were assessed by ANOVA with the Bonferroni least significant post hoc tests for comparisons within multiple groups. Significance was defined as P< 0.05.
| Results |
|---|
|
|
|---|
An increase in PAI-1 mRNA expression was seen in ECV cells as assessed by Northern blotting (see online Figure IC). The expression of PAI-1 mRNA by bFGF was increased in a concentration-dependent fashion, with a 1.4-fold increase over control at 10 ng/mL and a 2.0-fold increase at 100 ng/mL. The baseline concentration of PAI-1 in the conditioned media of ECV cells was 254±28 ng/mL (n=5, ELISA). bFGF increased PAI-1 protein accumulation in the media in a concentration-dependent fashion (see online Figure ID). Peak effects were seen with 10 ng/mL bFGF (1.9±0.2-fold over control). The response was diminished somewhat with concentrations of 100 ng/mL (1.4±0.2-fold over control). The baseline concentration of tPA in the conditioned media of ECV cells was 0.71±0.05 ng/mL (n=4, ELISA). bFGF increased tPA protein accumulation in the media (0.88±0.05 at 1 ng/mL and 0.93±0.02 at 10 ng/mL, P<0.01). Total protein content in the conditioned media was not altered by bFGF in HUVECs and EVC cells (results not shown).
Effects of PD 98059 and Actinomycin D on PAI-1 mRNA
To investigate the intracellular mechanisms involved in the induction of PAI-1 mRNA, ECV cells were treated for 1 hour with each of the various inhibitors of intracellular signaling pathway before the addition of bFGF (Figure 1A). Inhibition of extracellular signal-regulated kinase (ERK) kinase with PD98059 blocked basal and bFGF-stimulated PAI-1 mRNA levels. In contrast, GF109203X, an inhibitor of the protein kinase C pathway, and genistein, an inhibitor of tyrosine kinase, had no significant effect. ß-Actin mRNA levels did not change in any experimental conditions. To determine whether bFGF influences PAI-1 mRNA half-life, ECV cells were stimulated with bFGF for 2 hours, medium was changed, actinomycin D (5 µg/mL) was added with or without bFGF, and cells were incubated for up to 6 hours (Figure 1B). The rate of PAI-1 mRNA decrease was not changed by bFGF, suggesting that the PAI-1 mRNA increase by bFGF was due to an increase of transcription from the PAI-1 promoter.
|
Determination of DNA Regions Critical for Basal and bFGF-Inducible PAI-1 Transcriptional Activity
To identify the 5' flanking region of the PAI-1 gene responsible for the effects of bFGF, transient transfections with several PAI-1 promoter-luciferase reporter constructs were performed in ECV cells (see online Figure IIA, which can be accessed at http://atvb.ahajournals.org). Higher basal promoter activity was observed in 1F and 2F, suggesting that the region between -747 and -553 bp may contain a repressor element (see online Figure IIB). bFGF increased promoter-driven luciferase activity by 67±16% (see online Figure IIC, n=18). Relative to the largest promoter fragment tested, bFGF effect was reduced with deletion of the region at -747 to -553 bp and -553 to -313 bp. Deletion of the region at -313 to -260 bp completely abolished the bFGF effect. Deletion of the region at -260 to -205 bp resulted in no further reduction. These data indicate that the major sequence determinant of responsiveness resides between -313 and -260 bp. To determine whether a protein that can bind to the Ets-1-like site was responsible for the effect of bFGF, EMSA was performed by using oligonucleotides corresponding to the PAI-1 Ets-1-like site. The oligonucleotide bound, besides a constitutive protein complex, a bFGF-inducible nuclear protein complex, suggesting that bFGF induced nuclear translocation and DNA binding of the Ets-1-like transcription factor to the PAI-1 promoter (Figure 2A). The addition of a 10- to 100-fold excess of cold probe inhibited DNA-protein complex formation in a dose-dependent manner. The addition of the Ets-1/Ets-2 antibody inhibited DNA-protein complex formation. To further characterize the responsible region, a mutant construct containing a 2-nucleotide substitution in the Ets-1-like site was generated. Compared with the bFGF-induced increased promoter activity in the wild-type, substitution in the Ets-1-like site reduced bFGF stimulation (Figure 2B). These results suggest that the Ets-1-like site is critical for the effect of bFGF.
|
Effects of Fenofibric Acid
Fenofibric acid diminished PAI-1 mRNA expression in ECV cells in a dose-dependent manner, as assessed by Northern blotting (Figure 3A). Fenofibric acid markedly diminished but did not totally abolish the accumulation of PAI-1 protein elaboration from ECV cells exposed to bFGF (Figure 3B). At a concentration of 100 µmol/L, it suppressed baseline PAI-1 accumulation by 75±17% (n=3) and suppressed the increase induced by bFGF by 65±15% (n=3). When fenofibric acid was present in the media of ECV cells transfected with the PAI-1 promoter-luciferase reporter construct, basal PAI-1 promoter activity and bFGF-stimulated PAI-1 promoter activity were diminished (n=4, Figure 3C). Thus, fenofibric acid inhibited PAI-1 expression at least partly at the level of transcription. Fenofibric acid did not inhibit bFGF-induced nuclear translocation or DNA binding of Ets-1-like transcription factor to the PAI-1 promoter (Figure 2A). Fenofibric acid decreased the baseline concentration of tPA in the media by 84±08% and suppressed the increased induced by bFGF by 82±10% (n=3). Cell viability and total protein in the conditioned media were unaffected by fenofibric acid at the concentrations used (results not shown).
|
| Discussion |
|---|
|
|
|---|
PAI-1 inhibits fibrinolysis and proteolysis,2,3 which are critical in vascular remodeling,4 fibrosis,5 and atherosclerosis.11 Control of proteolysis is important for angiogenesis. PAI-1 may diversely modulate angiogenesis. Low PAI-1 levels may result in excessive proteolysis, failure of cell adhesion, prevention of coordinated EC sprouting,22,23 and inhibition of angiogenesis. Tumor cells fail to invade in PAI-1 knockout mice because of a lack of vascularization.24 PAI-1 promoted angiogenesis by the inhibition of proteolysis,25 suggesting that an inhibition of excessive proteolysis by PAI-1 may contribute to neovascularization. Alternatively, inhibition of proteolysis can also inhibit angiogenesis because of the inhibition of fibrinolysis in the provisional matrix,26 which might affect EC migration. Ets-1 modulates the angiogenic properties of ECs,27 and growth factors that promote angiogenesis may also contribute to atherosclerotic plaque development.28 Thus, proteolysis mediated by plasmin requires tight control during angiogenic processes, and induction of PAI-1 by bFGF as shown in the present study may contribute to this fine control of neovascularization.
Fenofibric acid diminished the increased accumulation of PAI-1 induced by the exposure of cells to bFGF. Because basal accumulation of PAI-1 was affected also by fenofibric acid, constitutive synthesis was modified as well. Fenofibric acid binds and activates PPAR
, and activation of PPAR
negatively influences the AP-1-dependent pathway.29 In the present study, deletion of the promoter region containing an AP-1-like site inhibited the effect of bFGF, and EMSA suggested that fenofibric acid did not inhibit nuclear translocation or DNA binding of the Ets-1-like transcription factor to the PAI-1 promoter. Thus, the inhibition of PAI-1 synthesis by fenofibric acid may involve the AP-1 activation pathway.
The potential consequences of fenofibric acid action are of particular clinical interest. Use of fibric acid derivatives decreases the incidence of cardiac events in patients with coronary artery disease and low LDL levels although only a modest increase in HDL is induced.30 Although increased local fibrinolysis may induce degradation of the extracellular matrix and destabilization of advanced plaques, reduced PAI-1 expression by ECs may shift the local balance to increased fibrinolytic capacity in blood that could limit the extent of acute thrombosis after plaque rupture. A shift in the local fibrinolytic balance toward increased fibrinolysis may decrease thrombotic risk, thereby contributing to the clinical benefit seen with fibrates independent of their salutary effects on lipids.
| Acknowledgments |
|---|
Received September 25, 2001; accepted February 17, 2002.
| References |
|---|
|
|
|---|
2. Loskutoff DJ. Regulation of PAI-1 gene expression. Fibrinolysis. 1991; 5: 197206.[CrossRef]
3.
Collen D, Lijnen HR. Basic and clinical aspects of fibrinolysis and thrombolysis. Blood. 1991; 78: 31143124.
4.
Drew AF, Tucker HL, Kombrinck KW, Simon DI, Bugge TH, Degen JL. Plasminogen is a critical determinant of vascular remodeling in mice. Circ Res. 2000; 87: 133139.
5. Hattori N, Degen JL, Sisson TH, Liu H, Moore BB, Pandrangi RG, Simon RH, Drew AF. Bleomycin-induced pulmonary fibrosis in fibrinogen-null mice. J Clin Invest. 2000; 106: 13411350.[Medline] [Order article via Infotrieve]
6. Pannekoek H, Veerman H, Lambers H, Diergaarde P, Verweij CL, Zonneveld AJ, Mourik JA. Endothelial plasminogen activator inhibitor (PAI): a new member of the serpin family. EMBO J. 1986; 5: 25392544.[Medline] [Order article via Infotrieve]
7.
Pepper MS, Belin D, Montesano R, Orci L, Vassalli JD. Transforming growth factor-beta 1 modulates basic fibroblast growth factor-induced proteolytic and angiogenic properties of endothelial cells in vitro. J Cell Biol. 1990; 111: 743755.
8. Yamamoto C, Kaji T, Furuya M, Sakamoto M, Kozuka H, Koizumi F. Basic fibroblast growth factor suppresses tissue plasminogen activator release from cultured human umbilical vein endothelial cells but enhances that from cultured human aortic endothelial cells. Thromb Res. 1994; 73: 255263.[CrossRef][Medline] [Order article via Infotrieve]
9.
Bochaton-Piallat ML, Gabbiani G, Pepper MS. Plasminogen activator expression in rat arterial smooth muscle cells depends on their phenotype and is modulated by cytokines. Circ Res. 1998; 82: 10861093.
10.
Wang W, Chen HJ, Schwartz A, Cannon PJ, Rabbani LE. T cell lymphokines modulate bFGF-induced smooth muscle cell fibrinolysis and migration. Am J Physiol. 1997; 272: C392C398.
11.
Eitzman DT, Westrick RJ, Xu Z, Tyson J, Ginsburg D. Plasminogen activator inhibitor-1 deficiency protects against atherosclerosis progression in the mouse carotid artery. Blood. 2000; 96: 42124215.
12. Mandriota SJ, Pepper MS. Vascular endothelial growth factor-induced in vitro angiogenesis and plasminogen activator expression are dependent on endogenous basic fibroblast growth factor. J Cell Sci. 1997; 110: 22932302.[Abstract]
13.
Nordt TK, Kornas K, Peter K, Fujii S, Sobel BE, Kubler W, Bode C. Attenuation by gemfibrozil of expression of plasminogen activator inhibitor type 1 induced by insulin and its precursors. Circulation. 1997; 95: 677683.
14.
Schneider DJ, Sobel BE. Augmentation of synthesis of plasminogen activator inhibitor type 1 by insulin and insulin-like growth factor type I: implications for vascular disease in hyperinsulinemic states. Proc Natl Acad Sci U S A. 1991; 88: 99599963.
15.
Sawa H, Sobel BE, Fujii S. Potentiation by hypercholesterolemia of the induction of aortic intramural synthesis of plasminogen activator inhibitor type 1 by endothelial injury. Circ Res. 1993; 73: 671680.
16. Huang D, Amero SA. Measurement of antigen by enhanced chemiluminescent Western blot. Biotechniques. 1997; 22: 454458.[Medline] [Order article via Infotrieve]
17. Strandberg L, Lawrence D, Ny T. The organization of the human-plasminogen-activator-inhibitor-1 gene: implications on the evolution of the serine-protease inhibitor family. Eur J Biochem. 1988; 176: 609616.[Medline] [Order article via Infotrieve]
18.
Takeda K, Ichiki T, Tokunou T, Iino N, Fujii S, Kitabatake A, Shimokawa H, Takeshita A. Critical role of Rho kinase and MEK/ERK pathways for angiotensin II-induced plasminogen activator inhibitor-1 gene expression. Arterioscler Thromb Vasc Biol. 2001; 21: 868873.
19. Tanaka K, Oda N, Iwasaka C, Abe M, Sato Y. Induction of Ets-1 in endothelial cells during reendothelialization after denuding injury. J Cell Physiol. 1998; 176: 235244.[CrossRef][Medline] [Order article via Infotrieve]
20. Liu J, Gao B, Mirshahi F, Sanyal AJ, Khanolkar AD, Makriyannis A, Kunos G. Functional CB1 cannabinoid receptors in human vascular endothelial cells. Biochem J. 2000; 346: 835840.
21. Wang H, Ye Y, Zhu M, Cho C. Increased interleukin-8 expression by cigarette smoke extract in endothelial cells. Environ Toxicol Pharmacol. 2000; 9: 1923.[CrossRef][Medline] [Order article via Infotrieve]
22. Schnaper HW, Barnathan ES, Mazar A, Maheshwari S, Ellis S, Cortez SL, Baricos WH, Kleinman HK. Plasminogen activators augment endothelial cell organization in vitro by two distinct pathways. J Cell Physiol. 1995; 165: 107118.[CrossRef][Medline] [Order article via Infotrieve]
23. Pepper MS, Sappino AP, Montesano R, Orci L, Vassalli JD. Plasminogen activator inhibitor-1 is induced in migrating endothelial cells. J Cell Physiol. 1992; 153: 129139.[CrossRef][Medline] [Order article via Infotrieve]
24. Bajou K, Noel A, Gerard RD, Masson V, Brunner N, Holst-Hansen C, Skobe M, Fusenig NE, Carmeliet P, Collen D, Foidart JM. Absence of host plasminogen activator inhibitor 1 prevents cancer invasion and vascularization. Nat Med. 1998; 4: 923928.[CrossRef][Medline] [Order article via Infotrieve]
25.
Bajou K, Masson V, Gerard RD, Schmitt PM, Albert V, Praus M, Lund LR, Frandsen TL, Brunner N, Dano K, Fusenig NE, Weidle U, Carmeliet G, Loskutoff D, Collen D, Carmeliet P, Foidart JM, Noel A. The plasminogen activator inhibitor PAI-1 controls in vivo tumor vascularization by interaction with proteases, not vitronectin. implications for antiangiogenic strategies. J Cell Biol. 2001; 152: 777784.
26.
Stefansson S, Petitclerc E, Wong MK, McMahon GA, Brooks PC, Lawrence DA. Inhibition of angiogenesis in vivo by plasminogen activator inhibitor-1. J Biol Chem. 2001; 276: 81358141.
27. Oda N, Abe M, Sato Y. ETS-1 converts endothelial cells to the angiogenic phenotype by inducing the expression of matrix metalloproteinases and integrin ß3. J Cell Physiol. 1999; 178: 121132.[CrossRef][Medline] [Order article via Infotrieve]
28. Celletti FL, Waugh JM, Amabile PG, Brendolan A, Hilfiker PR, Dake MD. Vascular endothelial growth factor enhances atherosclerotic plaque progression. Nat Med. 2001; 7: 425429.[CrossRef][Medline] [Order article via Infotrieve]
29.
Delerive P, Martin-Nizard F, Chinetti G, Trottein F, Fruchart JC, Najib J, Duriez P, Staels B. Peroxisome proliferator-activated receptor activators inhibit thrombin-induced endothelin-1 production in human vascular endothelial cells by inhibiting the activator protein-1 signaling pathway. Circ Res. 1999; 85: 394402.
30.
Rubins HB, Robins SJ, Collins D, Fye CL, Anderson JW, Elam MB, Faas FH, Linares E, Schaefer EJ, Schectman G, Wilt TJ, Wittes J. Gemfibrozil for the secondary prevention of coronary heart disease in men with low levels of high-density lipoprotein cholesterol: Veterans Affairs High-Density Lipoprotein Cholesterol Intervention Trial Study Group. N Engl J Med. 1999; 341: 410418.
This article has been cited by other articles:
![]() |
S. Imagawa, S. Fujii, J. Dong, T. Furumoto, T. Kaneko, T. Zaman, Y. Satoh, H. Tsutsui, and B. E Sobel Hepatocyte Growth Factor Regulates E Box-Dependent Plasminogen Activator Inhibitor Type 1 Gene Expression in HepG2 Liver Cells Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2407 - 2413. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dong, S. Fujii, H. Li, H. Nakabayashi, M. Sakai, S. Nishi, D. Goto, T. Furumoto, S. Imagawa, T. A.K.M. Zaman, et al. Interleukin-6 and Mevastatin Regulate Plasminogen Activator Inhibitor-1 Through CCAAT/Enhancer-Binding Protein-{delta} Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 1078 - 1084. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wu, Q. Zhang, D. K. Ann, A. Akhondzadeh, H. S. Duong, D. V. Messadi, and A. D. Le Increased vascular endothelial growth factor may account for elevated level of plasminogen activator inhibitor-1 via activating ERK1/2 in keloid fibroblasts Am J Physiol Cell Physiol, April 1, 2004; 286(4): C905 - C912. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Sobel, D. J. Taatjes, and D. J. Schneider Intramural Plasminogen Activator Inhibitor Type-1 and Coronary Atherosclerosis Arterioscler. Thromb. Vasc. Biol., November 1, 2003; 23(11): 1979 - 1989. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2002 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |