Vascular Biology |
From the Departments of Medicine and Surgery, The University of Chicago, Chicago, Ill.
Correspondence to Paul T. Schumacker, PhD, Department of Medicine, MC6026, 5841 S Maryland Ave, Chicago, IL 60637. E-mail pschumac{at}medicine.bsd.uchicago.edu
| Abstract |
|---|
|
|
|---|
B (NF-
B) activation, although they did not abrogate NF-
B activation in response to endotoxin (lipopolysaccharide). ET inhibition also abolished the hypoxia-induced increases in IL-6 mRNA expression, hypoxia-stimulated IL-6 secretion into the media, and the hypoxia-induced increases in transendothelial electrical resistance of human umbilical vein endothelial cell monolayers. By contrast, the above responses to hypoxia were not significantly affected by treatment with the NAD(P)H oxidase inhibitor apocynin (30 µmol/L), the xanthine oxidase inhibitor allopurinol (100 µmol/L), or the NO synthase inhibitor N-nitro-L-arginine (100 µmol/L). We conclude that ROS signals originating from the mitochondrial ET chain trigger the increase in NF-
B activation, the transcriptional activation of IL-6, the secretion of IL-6 into the cell culture media, and the increases in endothelial permeability observed during hypoxia.
Key Words: reactive oxygen species human umbilical vein endothelial cells ischemia signal transduction microcirculation
| Introduction |
|---|
|
|
|---|
See page 525
Recent studies have suggested that reactive oxygen species (ROS) may be important intracellular signaling messengers linking tissue hypoxia to the subsequent inflammatory responses. For example, in mesenteric venules of rats exposed to systemic hypoxia, Wood et al7 found evidence of increased ROS generation that contributed to the stimulation of leukocyteendothelial cell adhesion. We recently reported that ROS participate in the signaling responsible for the transient increase in endothelial monolayer permeability induced by continuous hypoxia.8 That study showed that interleukin-6 and interleukin-8 (IL-6 and IL-8, respectively) secretion from endothelial cells is increased during hypoxia and that IL-6 released to the media acts in an autocrine or paracrine fashion to initiate the changes in endothelial permeability. Because this increase in IL-6 secretion was attenuated by antioxidants, it appears likely that ROS function as intracellular messengers, triggering the secretion of this cytokine, and are indirectly responsible for the increase in permeability.
Endothelial cells could conceivably generate ROS from an NAD(P)H oxidase system, xanthine oxidase, or the mitochondrial electron transport (ET) chain. A growing body of evidence suggests that mitochondria respond to cellular hypoxia by paradoxically increasing their generation of ROS.9 Evidence of cellular ROS signaling was absent at O2 tensions >60 mm Hg but increased progressively as the PO2 decreased to 7 mm Hg.10 These ROS appear to initiate intracellular redox signaling and to contribute to a broad range of adaptive responses in hypoxic cells, including ischemic preconditioning in cardiomyocytes,11 hypoxia-inducible factor-1 activation,12,13 nuclear factor-
B (NF-
B) activation, 14,15 and p53 activation in a variety of cells.16
Therefore, we hypothesized that mitochondria in hypoxic endothelial cells may be responsible for the observed increase in intracellular ROS. The present study tested whether endothelial mitochondria increase ROS production in response to hypoxia and whether these ROS participate in an intracellular signaling process that leads to increased IL-6 transcription and release and to alterations in endothelial barrier permeability.
| Methods |
|---|
|
|
|---|
Induction of Hypoxia
Cells were subjected to hypoxia in a modular chamber (Billups-Rothenberg) that was flushed with a gas mixture (1% O2/5% CO2/94% N2) to produce the desired level of hypoxia (PO2 14±3 mm Hg) within 30 minutes. Samples of medium were analyzed for PO2 and pH at 3-hour intervals over 24 hours by use of an O2 phosphorescence quenching method (Oxyspot, Medical Systems) with a palladium-meso-tetra(4-carboxyphenyl)porphine probe.18 The pH was measured in aliquots of medium with the use of a blood gas analyzer (Radiometer). For the experiments in which DCF or dihydroethidium (DHE) fluorescence was measured, hypoxia was induced by flushing the head space of the T flasks with known gas mixtures at a flow rate of 100 mL/min. Gas mixtures and flow rates were controlled by a mass flow controller (GF-3, Cameron Instrument Co).
Measurement of Oxidant Signaling
ROS production in HUVECs was assessed by using the probe 2,7'-dichlorodihydrofluorescein-diacetate (DCFH-DA, 10 µmol/L, Molecular Probes). The diacetate form of DCFH is membrane permeable and was added to the medium immediately before the experiments. Inside the cell, esterases cleave the acetate groups, trapping the reduced form of the dye (DCFH) intracellularly.19 ROS in the cells induce the oxidation of DCFH, yielding the fluorescent product DCF.20 The fluorescence of the intracellular fluid was used as a measurement of the intracellular ROS generation. In other studies, the probe DHE (20 µmol/L, Molecular Probes) was used to detect oxidant signaling. When oxidized, this compound intercalates into DNA, resulting in an increase in quantum yield.21 After exposure to hypoxia, T flasks were immediately immersed in an ice bath, the cells were removed with a rubber scraper, and the supernatant was transferred to a 15-mL centrifuge tube. The supernatant was then centrifuged at 10 000g (1200 rpm) to separate the cells from the intracellular fluid. The supernatant was removed, and intact cells in the pellet were lysed by using RLT lysis buffer (350 µL, RNeasy Mini Kit, Quiagen) with ß-mercaptoethanol (10 µL/mL). To ensure complete lysis, the mixture was aspirated through a 25-gauge needle. The solution was then diluted in 1 mL of distilled water, and the fluorescence was quantified by using a fluorescence spectrophotometer (excitation 488 nm and emission 530 nm for DCF, excitation 475 and emission 610 for DHE; Perkin-Elmer).
Northern Blot Analysis
HUVEC monolayers were grown to confluence and exposed to hypoxia (PO2 15 mm Hg for 12 hours) as described above. Cellular RNA was then harvested (RNeasy Mini Kit, Quiagen). Two identical membranes were created in which 2-µg samples of total RNA were electrophoresed and transferred to nylon membranes with the use of a semidry technique (Bio-Rad). Membranes were prehybridized (Sigma) at 42°C for 2 hours. The cDNA probe for either 28S rRNA or IL-6 mRNA was added to prewarmed hybridization buffer (Sigma) after the cDNA was randomly labeled (Rediprime II, Amersham) with [
-32P]dCTP (Redivue, specific activity 3000 Ci/mmol, Amersham). Hybridization was continued overnight at 42°C, followed by washing (2x SSC and 0.1% SDS at room temperature twice for 15 minutes, then 0.2x SSC and 0.1% SDS at either 65°C or 50°C twice for 15 minutes). The signal was then detected by autoradiography.
Generation of cDNA Probes
A 28S rRNA cDNA oligonucleotide probe was acquired from Ambion. A probe for IL-6 mRNA was generated by using RNA isolated from HUVEC monolayers. Upstream (CACACAGACAGCCACTCACCTC) and downstream (GTGCCTGCAGCTTCGTCAGCTGG) oligonucleotide primers were purchased (GIBCO), and IL-6 cDNA was synthesized and amplified by using reverse transcriptasepolymerase chain reaction (Access RT-PCR System, Promega).
IL-6 Quantification
HUVEC monolayers cultured on gelatin-coated 60-mm plates were exposed to hypoxia as described above. Culture medium was collected at 3-hour intervals over 24 hours. Hypoxia-induced production of IL-6 was assessed by ELISA (R&D Systems). Each sample was measured in duplicate and is expressed as an average of these values.
Measurement of TEER as an Index of Permeability
First-passage endothelial cells were split 3:1 to 12-mm Transwell tissue culture inserts. They were rinsed with HEPES-buffered saline and fed every other day until they were confluent by visual inspection. The resistances of the monolayers were monitored daily until stable resistances were obtained (>25
· cm2); the cells were then exposed to hypoxia for 3 to 24 hours. Transendothelial electrical resistance (TEER) was measured with a resistance meter together with the Endohm-12 chamber (World Precision Instruments). Measurements were taken in triplicate and reported as percentage (mean±SE) for each time point relative to the same insert at time 0.
Electrophoretic Mobility Shift Assay
Nuclear extracts were isolated by suspending the cells in buffer A (10 mmol/L HEPES, pH 7.9, 10 mmol/L KCl, 0.1 mmol/L EDTA, 1 mmol/L dithiothreitol, 0.5 mmol/L phenylmethylsulfonyl fluoride, 1 µg/mL leupeptin, and 5 µg/mL aprotinin) for 15 minutes on ice. After adding 25 µL of 10% NP-40, the cells were subsequently centrifuged at 12 000 rpm for 30 seconds. The pellet was then resuspended in buffer B (20 mmol/L HEPES, pH 7.9, 0.4 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L dithiothreitol, 1 mmol/L phenylmethylsulfonyl fluoride, 1 µg/mL leupeptin, and 5 µg/mL aprotinin) for 15 minutes at 4°C. Samples were prepared and loaded onto 4% polyacrylamide gels and were run in 0.5x TBE for 4 hours at 120 V as described previously.22,23
Statistical Analysis
Data are reported as mean±SE and were analyzed by Student t tests or ANOVA (Minitab II) where appropriate. Significance was defined as a value of P<0.05.
| Results |
|---|
|
|
|---|
|
Effects of Hypoxia on IL-6 mRNA Message and Secretion
Under normoxic conditions, basal IL-6 transcriptional activation was found to be minimal (Figure 2a). Hypoxia elicited a significant increase in IL-6 mRNA message, which was abrogated by the addition of the mitochondrial inhibitors rotenone and DPI to the media. By contrast, neither allopurinol nor apocynin significantly attenuated the increase in IL-6 mRNA message in HUVECs incubated under hypoxic conditions. Neither rotenone nor DPI inhibited the increase in IL-6 mRNA induced by treatment with lipopolysaccharide (LPS, Figure 2b), indicating that the cells were capable of activating IL-6 mRNA expression by a separate pathway despite the presence of ET inhibition.
|
Effects of Antioxidants on IL-6 Secretion During Hypoxia
Prolonged hypoxia (PO2 14±3 mm Hg, range 11 to 19 mm Hg) stimulated endothelial cells to secrete IL-6 into the culture medium. Within 18 hours, levels of IL-6 in the medium reached 140±15 pg/mL (P<0.01 compared with normoxic controls, Figure 3). To determine the requirement for mitochondrial ROS in this response, the IL-6 concentration in the media of hypoxic cells was compared with that in cells pretreated with various antioxidants. We had previously found that treatment of the endothelial cells with the antioxidant compound N-acetylcysteine (NAC) inhibited the increased secretion of IL-6 in response to hypoxia, which suggested that the observed changes in IL-6 secretion were dependent on an increase in ROS signaling.8 In the present study, we pretreated the cells with rotenone to determine whether mitochondrial ROS were required for the increase in IL-6 secretion during hypoxia. Rotenone (2 µmol/L) prevented the hypoxia-induced increases in IL-6 secretion evident at 18 hours (P<0.05, Figure 3a). DPI (5 µmol/L) produced a similar attenuation in IL-6 secretion at 18 hours (Figure 3b). We then pretreated the cells with apocynin or allopurinol to determine whether NADPH oxidase or xanthine oxidase function was required for the observed increases in IL-6 secretion during hypoxia. Neither apocynin nor allopurinol significantly affected the increased IL-6 secretion (Figure 3c), indicating that neither of these systems contributed to our earlier findings. Collectively, these results suggest that mitochondrial ROS mediate the enhanced release of IL-6 during hypoxia.
|
Effects of Hypoxia on Permeability
The effects of hypoxia (PO2 14±3 mm Hg) on TEER were measured in HUVEC monolayers over 24 hours. A blank Transwell insert was used as an indicator of background effects on TEER and consistently demonstrated a resistance of 6±1
· cm2. TEER was measured every 3 hours, and values at each time point were reported as a percentage of the original value at 0 hours. Normoxic control monolayers maintained in a standard incubator environment (5% CO2/95% room air) showed no significant change in TEER over 24 hours (data not shown). During prolonged hypoxia, TEER changed significantly over 24 hours (Figure 4) by demonstrating an initial drop in resistance at 9 hours and a greater decrease at 18 hours (P<0.01). Thereafter, resistance began to recover until 24 hours, when it reached 91±4% of the original value. By contrast, TEER failed to change significantly over 24 hours in cells incubated at PO2 25 or 35 mm Hg (data not shown). Thus, alterations of endothelial permeability depend on the duration and severity of hypoxia.
|
Role of Mitochondria in Altered Endothelial Permeability
We previously reported that the antioxidant NAC blocks the increase in endothelial permeability observed during hypoxia, suggesting that ROS mediate this response.8 To clarify the source of this oxidant signal, the TEER of HUVEC monolayers was compared with the TEER of identical cells pretreated with rotenone (2 µmol/L) or DPI (5 µmol/L). Rotenone and DPI prevented hypoxia-induced increases in TEER (Figure 4a). DPI treatment also abrogated the hypoxia-induced decreases in TEER at 18 hours (Figure 4b). No increase in cell death was detected after treatment with these inhibitors for 24 hours (data not shown). The increase in permeability during hypoxia was not affected by pretreatment with inhibitors of NADPH oxidase (Figure 4c) or xanthine oxidase (Figure 4d). These findings suggest that the mitochondrial ET chain acts as a source of ROS that mediate the increased endothelial permeability observed during hypoxia.
EMSA for NF-
B
To demonstrate that ROS generated by the mitochondria during hypoxia were primarily responsible for the increase in IL-6 mRNA observed in our experiments, we conducted EMSAs for NF-
B, one of the chief regulatory transcription factors for IL-6.25 After 2 hours, an increase in the NF-
B p65/p50 heterodimer was observed in hypoxic cells compared with normoxic control cells. This response was abrogated in hypoxic HUVECs pretreated with rotenone or DPI (Figure 5a). However, pretreatment with allopurinol or apocynin did not alter the hypoxic activation of NF-
B (Figure 5a and data not shown, respectively). Neither DPI nor rotenone altered the activation of NF-
B by LPS. Also, these inhibitors had no effect on normoxic cells (Figure 5b). To clarify the possible involvement of peroxynitrite in the response to hypoxia, NF-
B activation was assessed in the presence of L-NNA (100 µmol/L). Treatment with L-NNA had no effect on NF-
B activation during either normoxia or hypoxia (Figure 5c). Collectively, these results suggest that an ROS signal from the mitochondria affects IL-6 transcription through an NF-
Bmediated pathway.
|
| Discussion |
|---|
|
|
|---|
Some of the transcriptional responses to hypoxia may involve NF-
B, which becomes activated during hypoxia.15 For example, Zhang et al33 found increases in NF-
B activation in association with increases in calpain mRNA expression during hypoxia in pulmonary artery endothelial cells. More recent evidence suggests that NF-
B activation during hypoxia requires ROS14 signals generated from the mitochondrial ET chain. Our previous study8 demonstrated that the IL-6 secretion response and the changes in permeability of HUVEC monolayers during hypoxia were virtually abolished by the antioxidant NAC and the glutathione peroxidase mimetic compound ebselen. In addition, these compounds abrogated the DCF fluorescence response to hypoxia, which suggests that the ROS signals detected by the DCF probe were required for the functional responses. The present study extends those findings by demonstrating that mitochondrial ET is required for the ROS response to hypoxia, which in turn triggers the activation of NF-
B and the mRNA expression of IL-6. Collectively, these studies implicate the mitochondria as the O2 sensor underlying the responses to hypoxia in endothelial cells.
Our experiments show that the treatment of endothelial cells with inhibitors of the ET chain (rotenone and DPI) blocked the increases in intracellular oxidant signaling during hypoxia and prevented the increases in the DNA binding of NF-
B along with the subsequent IL-6 transcription and secretion. Mitochondrial inhibitors also prevented the increased endothelial barrier permeability seen during prolonged hypoxic treatment of cell monolayers. One possible interpretation is that ET blockade abolished these responses by limiting mitochondrial ATP production. However, several pieces of evidence suggest that this is not the case. Most cells obtain the majority of their ATP from mitochondrial oxidative phosphorylation, which becomes limited by the oxygen supply when the PO2 falls below 5 to 7 mm Hg.34,35 Interestingly, endothelial cells appear to be capable of sustaining normal responses even during sustained anoxia.36 In control experiments, we found that ET inhibitors failed to abolish the activation of NF-
B by LPS. LPS has been shown to activate NF-
B by ROS-dependent and ROS-independent pathways.14 Therefore, the observation that LPS could still trigger NF-
B activation and IL-6 expression during ET inhibition indicates that a loss of mitochondrial ATP cannot explain the loss of the hypoxic response. In further support of this conclusion, the endothelial monolayers were capable of sustaining a high electrical resistance for 24 hours in the presence of rotenone or DPI. If ET inhibition had caused cellular damage, we would have expected rotenone or DPI to cause decreases in TEER. Finally, cell death was not increased in the HUVECs treated with rotenone or DPI for 24 hours, as assessed with the use of propidium iodide. These observations support the conclusion that ET inhibition blocked the hypoxic responses by abolishing the mitochondrial signals that require a functional ET chain.
Collectively, our results suggest that ROS generation occurs at an early step in the signaling pathway activated during hypoxia. However, the mitochondrial ET chain represents only one of many potential sources of intracellular ROS in hypoxic cells. Therefore, to identify whether other oxidase systems produce ROS that contribute to the increases in IL-6 expression and the changes in endothelial permeability, we inhibited 2 alternative pathways of ROS generation by using apocynin to block the NADPH oxidase system and allopurinol to inhibit xanthine oxidase. Neither inhibitor prevented the increases in intracellular oxidant signaling, the IL-6 response, or the changes in endothelial permeability, supporting the conclusion that stimulation of the mitochondrial ROS generation is primarily responsible for triggering the hypoxic responses. Likewise, inhibition of NO synthase failed to abolish the responses to hypoxia, suggesting that peroxynitrite is not responsible for these results.
That the mitochondria act as a source of intracellular ROS responsible for changes in endothelial permeability is an interesting discovery for several reasons. First, the mitochondrial response to hypoxia may represent one of the initial steps in the cascade of events leading to increased endothelial permeability and, ultimately, contributing to the development of organ dysfunction in pathophysiological conditions. Second, these findings suggest that low levels of intracellular ROS serve as intracellular signals capable of mediating adaptive responses to cellular hypoxia. The sequence of events suggested by our data involves the following: hypoxia
mitochondrial ET chain
increased ROS
NF-
B activation/DNA binding
IL-6 mRNA message
IL-6 secretion and increased endothelial permeability. Although ROS previously have been thought to function as cytotoxic molecules in host defense or as byproducts of other biologic reactions, the present study suggests that ROS function as signaling messengers in hypoxic endothelium.
Pathophysiological conditions resulting in uncontrolled increases in endothelial permeability, such as sepsis and adult respiratory distress syndrome, must begin at a cellular or subcellular level. Recent strategies to attack these processes on a molecular level, such as monoclonal antibodies to tumor necrosis factor and receptor antagonists for interleukin-1, have not succeeded in the clinical arena,37,38 but these strategies may fail because they are not acting at a step early enough in these processes. Our results suggest that the mitochondrial production of ROS represents an early signaling step in the proinflammatory effects of hypoxia on integrin expression and increased permeability, making this a potentially interesting target for future therapeutic intervention.
| Acknowledgments |
|---|
Received December 20, 2001; accepted January 22, 2002.
| References |
|---|
|
|
|---|
2. Yan SF, Ogawa S, Stern DM, Pinsky DJ. Hypoxia-induced modulation of endothelial cell properties: regulation of barrier function and expression of interleukin-6. Kidney Int. 1997; 51: 419425.[Medline] [Order article via Infotrieve]
3. Pinsky DJ, Yan SF, Lawson C, Naka Y, Chen JX, Connolly ES Jr, Stern DM. Hypoxia and modification of the endothelium: implications for regulation of vascular homeostatic properties. Semin Cell Biol. 1995; 6: 283294.[CrossRef][Medline] [Order article via Infotrieve]
4.
al-Haboubi HA, Tomlinson DR, Ward BJ. The influence of hypoxia on transvascular leakage in the isolated rat heart: quantitative and ultrastructural studies. J Physiol (Lond). 1995; 482: 157166.
5. Ogawa S, Shreeniwas R, Brett J, Clauss M, Furie M, Stern DM. The effect of hypoxia on capillary endothelial cell function: modulation of barrier and coagulant function. Br J Haematol. 1990; 75: 517524.[Medline] [Order article via Infotrieve]
6. Partridge CA. Hypoxia and reoxygenation stimulate biphasic changes in endothelial monolayer permeability. Am J Physiol. 1995; 269: L52L58.[Medline] [Order article via Infotrieve]
7.
Wood JG, Johnson JS, Mattioli LF, Gonzalez NC. Systemic hypoxia increases leukocyte emigration and vascular permeability in conscious rats. J Appl Physiol. 2000; 89: 15611568.
8. Ali MH, Schlidt SA, Chandel NS, Hynes KL, Schumacker PT, Gewertz BL. Endothelial permeability and IL-6 production during hypoxia: role of ROS in signal transduction. Am J Physiol. 1999; 277: L1057L1065.[Medline] [Order article via Infotrieve]
9.
Chandel NS, Schumacker PT. Cellular oxygen sensing by mitochondria: old questions, new insight. J Appl Physiol. 2000; 88: 18801889.
10.
Duranteau J, Chandel NS, Kulisz A, Shao Z, Schumacker PT. Intracellular signaling by reactive oxygen species during hypoxia in cardiomyocytes. J Biol Chem. 1998; 273: 1161911624.
11.
Vanden Hoek TL, Becker LB, Shao Z, Li C, Schumacker PT. Reactive oxygen species released from mitochondria during brief hypoxia induce preconditioning in cardiomyocytes. J Biol Chem. 1998; 273: 1809218098.
12.
Chandel NS, McClintock DS, Feliciano CE, Wood TM, Melendez JA, Rodriguez AM, Schumacker PT. Reactive oxygen species generated at mitochondrial complex III stabilize hypoxia-inducible factor-1alpha during hypoxia: a mechanism of O2 sensing. J Biol Chem. 2000; 275: 2513025138.
13.
Chandel NS, Maltepe E, Goldwasser E, Mathieu CE, Simon MC, Schumacker PT. Mitochondrial reactive oxygen species trigger hypoxia-induced transcription. Proc Natl Acad Sci U S A. 1998; 95: 1171511720.
14.
Chandel NS, Trzyna WC, McClintock DS, Schumacker PT. Role of oxidants in NF-kappa B activation and TNF-alpha gene transcription induced by hypoxia and endotoxin. J Immunol. 2000; 165: 10131021.
15.
Koong AC, Chen EY, Giaccia AJ. Hypoxia causes the activation of nuclear factor kappa B through the phosphorylation of I kappa B alpha on tyrosine residues. Cancer Res. 1994; 54: 14251430.
16. Chandel NS, Vander Heiden MG, Thompson CB, Schumacker PT. Redox regulation of p53 during hypoxia. Oncogene. 2000; 19: 38403848.[CrossRef][Medline] [Order article via Infotrieve]
17. Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins: identification by morphologic and immunologic criteria. J Clin Invest. 1973; 52: 27452756.[Medline] [Order article via Infotrieve]
18.
Hogan MC. Phosphorescence quenching method for measurement of intracellular PO2 in isolated skeletal muscle fibers. J Appl Physiol. 1999; 86: 720724.
19. Sawada GA, Raub TJ, Decker DE, Buxser SE. Analytical and numerical techniques for the evaluation of free radical damage in cultured cells using scanning laser microscopy. Cytometry. 1996; 25: 254262.[CrossRef][Medline] [Order article via Infotrieve]
20. Rothe G, Valet G. Flow cytometric analysis of respiratory burst activity in phagocytes with hydroethidine and 2',7'-dichlorofluorescein. J Leukoc Biol. 1990; 47: 440448.[Abstract]
21.
Bindokas VP, Jordan J, Lee CC, Miller RJ. Superoxide production in rat hippocampal neurons: selective imaging with hydroethidine. J Neurosci. 1996; 16: 13241336.
22.
Bours V, Burd PR, Brown K, Villalobos J, Park S, Ryseck RP, Bravo R, Kelly K, Siebenlist U. A novel mitogen-inducible gene product related to p50/p105-NF-kappa B participates in transactivation through a kappa B site. Mol Cell Biol. 1992; 12: 685695.
23. Franzoso G, Bours V, Park S, Tomita-Yamaguchi M, Kelly K, Siebenlist U. The candidate oncoprotein Bcl-3 is an antagonist of p50/NF-kappa B-mediated inhibition. Nature. 1992; 359: 339342.[CrossRef][Medline] [Order article via Infotrieve]
24.
Majander A, Finel M, Wikstrom M. Diphenyleneiodonium inhibits reduction of iron-sulfur clusters in the mitochondrial NADH-ubiquinone oxidoreductase (complex I). J Biol Chem. 1994; 269: 2103721042.
25.
Munoz C, Pascual-Salcedo D, Castellanos MC, Alfranca A, Aragones J, Vara A, Redondo MJ, de Landazuri MO. Pyrrolidine dithiocarbamate inhibits the production of interleukin-6, interleukin-8, and granulocyte-macrophage colony-stimulating factor by human endothelial cells in response to inflammatory mediators: modulation of NF-kappa B and AP-1 transcription factors activity. Blood. 1996; 88: 34823490.
26.
Graham CH, Fitzpatrick TE, McCrae KR. Hypoxia stimulates urokinase receptor expression through a heme protein-dependent pathway. Blood. 1998; 91: 33003307.
27. Collard CD, Bukusoglu C, Agah A, Colgan SP, Reenstra WR, Morgan BP, Stahl GL. Hypoxia-induced expression of complement receptor type 1 (CR1, CD35) in human vascular endothelial cells. Am J Physiol. 1999; 276: C450C458.[Medline] [Order article via Infotrieve]
28.
Oh H, Takagi H, Suzuma K, Otani A, Matsumura M, Honda Y. Hypoxia and vascular endothelial growth factor selectively up-regulate angiopoietin-2 in bovine microvascular endothelial cells. J Biol Chem. 1999; 274: 1573215739.
29. Karakurum M, Shreeniwas R, Chen J, Pinsky D, Yan SD, Anderson M, Sunouchi K, Major J, Hamilton T, Kuwabara K, et al. Hypoxic induction of interleukin-8 gene expression in human endothelial cells. J Clin Invest. 1994; 93: 15641570.[Medline] [Order article via Infotrieve]
30. Kourembanas S, Hannan RL, Faller DV. Oxygen tension regulates the expression of the platelet-derived growth factor-B chain gene in human endothelial cells. J Clin Invest. 1990; 86: 670674.[Medline] [Order article via Infotrieve]
31. Kourembanas S, Marsden PA, McQuillan LP, Faller DV. Hypoxia induces endothelin gene expression and secretion in cultured human endothelium. J Clin Invest. 1991; 88: 10541057.[Medline] [Order article via Infotrieve]
32. Shreeniwas R, Koga S, Karakurum M, Pinsky D, Kaiser E, Brett J, Wolitzky BA, Norton C, Plocinski J, Benjamin W, et al. Hypoxia-mediated induction of endothelial cell interleukin-1 alpha: an autocrine mechanism promoting expression of leukocyte adhesion molecules on the vessel surface. J Clin Invest. 1992; 90: 23332339.[Medline] [Order article via Infotrieve]
33. Zhang J, Patel JM, Block ER. Hypoxia-specific upregulation of calpain activity and gene expression in pulmonary artery endothelial cells. Am J Physiol. 1998; 275: L461L468.
34. Kennedy FG, Jones DP. Oxygen dependence of mitochondrial function in isolated rat cardiac myocytes. Am J Physiol. 1986; 250: C374C383.[Medline] [Order article via Infotrieve]
35. Schumacker PT, Cain SM. The concept of a critical oxygen delivery. Intensive Care Med. 1987; 13: 223229.[CrossRef][Medline] [Order article via Infotrieve]
36. Tretyakov AV, Farber HW. Endothelial cell tolerance to hypoxia: potential role of purine nucleotide phosphates. J Clin Invest. 1995; 95: 738744.[Medline] [Order article via Infotrieve]
37. Opal SM, Fisher CJ Jr, Dhainaut JF, Vincent JL, Brase R, Lowry SF, Sadoff JC, Slotman GJ, Levy H, Balk RA, et al. Confirmatory interleukin-1 receptor antagonist trial in severe sepsis: a phase III, randomized, double-blind, placebo-controlled, multicenter trial: the Interleukin-1 Receptor Antagonist Sepsis Investigator Group. Crit Care Med. 1997; 25: 11151124.[CrossRef][Medline] [Order article via Infotrieve]
38.
Cohen J, Carlet J. INTERSEPT: an international, multicenter, placebo-controlled trial of monoclonal antibody to human tumor necrosis factor-
in patients with sepsis: International Sepsis Trial Study Group. Crit Care Med. 1996; 24: 14311440.[CrossRef][Medline]
[Order article via Infotrieve]
This article has been cited by other articles:
![]() |
A. S. Godbole, X. Lu, X. Guo, and G. S. Kassab NADPH oxidase has a directional response to shear stress Am J Physiol Heart Circ Physiol, January 1, 2009; 296(1): H152 - H158. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Ruder, T. J. Hartman, J. Blumberg, and M. B. Goldman Oxidative stress and antioxidants: exposure and impact on female fertility Hum. Reprod. Update, June 4, 2008; (2008) dmn011v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Baudry, E. Laemmel, and E. Vicaut In vivo reactive oxygen species production induced by ischemia in muscle arterioles of mice: involvement of xanthine oxidase and mitochondria Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H821 - H828. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Ostergaard, E. Stankevicius, M. R. Andersen, Y. Eskildsen-Helmond, T. Ledet, M. J. Mulvany, and U. Simonsen Diminished NO release in chronic hypoxic human endothelial cells Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H2894 - H2903. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. X. Zhang and D. D. Gutterman Mitochondrial reactive oxygen species-mediated signaling in endothelial cells Am J Physiol Heart Circ Physiol, May 1, 2007; 292(5): H2023 - H2031. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Davidson and M. R. Duchen Endothelial Mitochondria: Contributing to Vascular Function and Disease Circ. Res., April 27, 2007; 100(8): 1128 - 1141. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Han, Y.-R. Chen, C. I. Jones III, G. Meenakshisundaram, J. L. Zweier, and B. R. Alevriadou Shear-induced reactive nitrogen species inhibit mitochondrial respiratory complex activities in cultured vascular endothelial cells Am J Physiol Cell Physiol, March 1, 2007; 292(3): C1103 - C1112. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Thomson, G. B. Drummond, W. S. Waring, D. J. Webb, and S. R. J. Maxwell Effects of short-term isocapnic hyperoxia and hypoxia on cardiovascular function J Appl Physiol, September 1, 2006; 101(3): 809 - 816. [Abstract] [Full Text] [PDF] |
||||
![]() |
A A R Thompson, J K Baillie, M Toshner, S R J Maxwell, D J Webb, and J B Irving Pericardial effusions in healthy lowlanders after acute ascent to high altitude. Heart, April 1, 2006; 92(4): 539 - 540. [Full Text] [PDF] |
||||
![]() |
M Fluck Hypoxaemia enhanced peripheral muscle oxidative stress in COPD Thorax, October 1, 2005; 60(10): 797 - 798. [Full Text] [PDF] |
||||
![]() |
H. Sato, M. Sato, H. Kanai, T. Uchiyama, T. Iso, Y. Ohyama, H. Sakamoto, J. Tamura, R. Nagai, and M. Kurabayashi Mitochondrial reactive oxygen species and c-Src play a critical role in hypoxic response in vascular smooth muscle cells Cardiovasc Res, September 1, 2005; 67(4): 714 - 722. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. K. Aley, K. E. Porter, J. P. Boyle, P. J. Kemp, and C. Peers Hypoxic Modulation of Ca2+ Signaling in Human Venous Endothelial Cells: MULTIPLE ROLES FOR REACTIVE OXYGEN SPECIES J. Biol. Chem., April 8, 2005; 280(14): 13349 - 13354. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Wojciak-Stothard, L. Y. F. Tsang, and S. G. Haworth Rac and Rho play opposing roles in the regulation of hypoxia/reoxygenation-induced permeability changes in pulmonary artery endothelial cells Am J Physiol Lung Cell Mol Physiol, April 1, 2005; 288(4): L749 - L760. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. McClelland, A. C. Dalziel, N. M. Fragoso, and C. D. Moyes Muscle remodeling in relation to blood supply: implications for seasonal changes in mitochondrial enzymes J. Exp. Biol., February 1, 2005; 208(3): 515 - 522. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Li and A. M Shah Endothelial cell superoxide generation: regulation and relevance for cardiovascular pathophysiology Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2004; 287(5): R1014 - R1030. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. D. Mansfield, M. C. Simon, and B. Keith Hypoxic reduction in cellular glutathione levels requires mitochondrial reactive oxygen species J Appl Physiol, October 1, 2004; 97(4): 1358 - 1366. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Chen, S. R. Thomas, A. Albano, M. P. Murphy, and J. F. Keaney Jr. Mitochondrial Function Is Required for Hydrogen Peroxide-induced Growth Factor Receptor Transactivation and Downstream Signaling J. Biol. Chem., August 13, 2004; 279(33): 35079 - 35086. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Palacios-Callender, M. Quintero, V. S. Hollis, R. J. Springett, and S. Moncada Endogenous NO regulates superoxide production at low oxygen concentrations by modifying the redox state of cytochrome c oxidase PNAS, May 18, 2004; 101(20): 7630 - 7635. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hirayama, A. Kobiyama, S. Kinoshita, and S. Watabe The occurrence of two types of hemopexin-like protein in medaka and differences in their affinity to heme J. Exp. Biol., March 15, 2004; 207(8): 1387 - 1398. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Walford, R.-L. Moussignac, A. W. Scribner, J. Loscalzo, and J. A. Leopold Hypoxia Potentiates Nitric Oxide-mediated Apoptosis in Endothelial Cells via Peroxynitrite-induced Activation of Mitochondria-dependent and -independent Pathways J. Biol. Chem., February 6, 2004; 279(6): 4425 - 4432. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Dix, T. Orth, J. Allen, J. G. Wood, and N. C. Gonzalez Activation of mast cells by systemic hypoxia, but not by local hypoxia, mediates increased leukocyte-endothelial adherence in cremaster venules J Appl Physiol, December 1, 2003; 95(6): 2495 - 2502. [Abstract] [Full Text] |
||||
![]() |
S. C. Leary, C. N. Lyons, A. G. Rosenberger, J. S. Ballantyne, J. Stillman, and C. D. Moyes Fiber-type differences in muscle mitochondrial profiles Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2003; 285(4): R817 - R826. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lopes, D. Gregg, S. Vasudevan, H. Hassanain, P. Goldschmidt-Clermont, and H. Kovacic Thrombospondin 2 Regulates Cell Proliferation Induced by Rac1 Redox-Dependent Signaling Mol. Cell. Biol., August 1, 2003; 23(15): 5401 - 5408. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. O. McCarthy Rethinking Nutritional Support for Persons with Cancer Cachexia Biol Res Nurs, July 1, 2003; 5(1): 3 - 17. [Abstract] [PDF] |
||||
![]() |
S. Turcotte, R. R. Desrosiers, and R. Beliveau HIF-1{alpha} mRNA and protein upregulation involves Rho GTPase expression during hypoxia in renal cell carcinoma J. Cell Sci., June 1, 2003; 116(11): 2247 - 2260. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schafer, C. Schafer, N. Ewald, H.M. Piper, and Th. Noll Role of Redox Signaling in the Autonomous Proliferative Response of Endothelial Cells to Hypoxia Circ. Res., May 16, 2003; 92(9): 1010 - 1015. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Warnholtz, M. Wendt, and T. Munzel When Sleeping Beauty Turns Ugly: Mitochondria in Hypoxia Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 525 - 527. [Full Text] [PDF] |
||||
![]() |
A. Warnholtz, M. Wendt, and T. Munzel When Sleeping Beauty Turns Ugly: Mitochondria in Hypoxia Arterioscler. Thromb. Vasc. Biol., April 1, 2002; 22(4): 525 - 527. [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2002 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |