Published online before print August 29, 2002, doi: 10.1161/01.ATV.0000035700.82829.2A
© 2002 American Heart Association, Inc.
Atherosclerosis and Lipoproteins |
ATP-Binding Cassette Transporter 1 Participates in LDL Oxidation by Artery Wall Cells
From the Atherosclerosis Research Unit (S.T.R., S.H., C.N., V.G., M.N., A.M.F.), Division of Cardiology, Department of Medicine, and the Department of Molecular and Medical Pharmacology (S.T.R., C.N.), University of California, Los Angeles.
Correspondence to Srinivasa T. Reddy, PhD, Department of Medicine and Department of Molecular and Medical Pharmacology, University of California, Los Angeles, 650 Charles E. Young Dr South, A8-131, CHS, Los Angeles, CA 90095. E-mail sreddy{at}mednet.ucla.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Objective— We have previously reported that products of the lipoxygenase pathway, hydroperoxyoctadecadienoic acid and hydroperoxyeicosatetraenoic acid, as well as cholesterol linoleate hydroperoxides, collectively termed seeding molecules, are removed by apolipoprotein A-I (apoA-I) from the artery wall cells and render low density lipoprotein (LDL) resistant to oxidation by human artery wall cells. The mechanisms by which oxidized lipids are transported and/or transferred to lipoproteins and the pathways by which apoA-I facilitates their removal remain unclear. ATP-binding cassette transporter 1 (ABCA1) is known to facilitate the release of cellular phospholipids and cholesterol from the plasma membrane to apoA-I and high density lipoprotein. Therefore, we evaluated whether ABCA1 participates in LDL oxidation.
Methods and Results— In this report, we show that (1) chemical inhibitors of ABCA1 function, glyburide and DIDS, block artery wall cell–mediated oxidative modification of LDL, (2) inhibition of ABCA1 with the use of antisense (but not sense) oligonucleotides prevents LDL-induced lipid hydroperoxide formation and LDL-induced monocyte chemotactic activity by the artery wall cells, and (3) oxysterols that induce ABCA1 expression, such as 22(R)hydroxycholesterol, enhance cell-mediated LDL oxidation. Furthermore, we also show that 22(R)hydroxycholesterol induces the production of reactive oxygen species in the artery wall cells, which can be removed by incubating the artery wall cells with apoA-I.
Conclusions— Our data suggest that ABCA1 plays an important role in artery wall cell–mediated modification/oxidation of LDL by modulating the release of reactive oxygen species from artery wall cells that are necessary for LDL oxidation.
Key Words: ATP-binding cassette transporter 1 • LDL oxidation • atherosclerosis • artery wall cells • oxysterols
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Low density lipoprotein is the major source of extracellular cholesterol and phospholipid, and some of these phospholipids can yield oxidized phospholipids that induce an inflammatory response.1 An important step in the oxidation of LDL by artery wall cells involves the seeding of LDL with products of the lipoxygenase pathway: hydroperoxyoctadecadienoic acid (HPODE) and hydroperoxyeicosatetraenoic acid (HPETE), as well as cholesterol linoleate hydroperoxides, collectively termed seeding molecules.1 ApoA-I, a major protein component of HDL particles,2,3 is known to remove cholesterol and phospholipids from artery wall cells.4 It is widely accepted that the atheroprotective actions of apoA-I or HDL arise from their participation in a normal physiological process known as reverse cholesterol transport.5,6 Recently, our laboratory has shown that apoA-I and an apoA-I mimetic peptide remove "seeding molecules" from LDL and render LDL resistant to oxidation by human artery wall cells.7,8 These findings project a new function for apoA-I in removing oxidized lipids from lipoproteins and cells and further solidify its role as an antiatherogenic apolipoprotein. However, the mechanisms by which seeding molecules are transported and/or transferred to lipoproteins and the pathways by which apoA-I facilitates the removal of seeding molecules remain unclear.
ATP-binding cassette transporter A1 (ABCA1) mediates cholesterol secretion from cells and functions as a rate-controlling protein in the apoA-I–dependent active transport of cholesterol and phospholipids.9,10 ApoA-I–mediated lipid transport requires a functional ABCA1 protein and specific binding and/or docking interactions of apoA-I with the plasma membrane.11,12 Mutations in the ABCA1 gene result in the loss of apoA-I–mediated removal of cellular lipids13,14 and cause Tangier disease15–17 and familial HDL deficiency.18,19 Disruption of the ABCA1 gene in mice results in HDL deficiency and impaired cholesterol and lipid transport,20–22 and overexpression of ABCA1 leads to increased cholesterol and phospholipid efflux to apoA-I in transgenic mice.23,24 Moreover, fibroblasts from patients with Tangier disease are defective in transferring phospholipids onto apoA-I.13 Although ABCA1 was shown to generate a regulated anion flux when expressed in Xenopus laevis oocytes,25 to date, ABCA1 has not been implicated in the transport of anionic biomolecules, such as oxidized lipids or reactive oxygen species (ROS). Because apoA-I and ABCA1 are functionally linked in cholesterol and phospholipid efflux from cells and because apoA-I also facilitates the removal of seeding molecules from cells,7,8 we hypothesized that ABCA1 may play a role in cell-mediated oxidation of LDL by regulating the transfer or transport of seeding molecules.
In the present study, we investigated whether ABCA1 participates in the oxidative modification of LDL by human artery wall cells. We have used chemical inhibitors of ABCA1 function, inducers of ABCA1 expression (oxysterols), and specific inhibition of ABCA1 protein expression (antisense oligonucleotides), and we have shown that ABCA1 plays a key role in cell-mediated oxidative modification of LDL by human artery wall cells.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Materials
All cell culture media and reagents were supplied by GIBCO-BRL. Human apoA-I, glyburide, DIDS, and 22(R)-hydroxycholesterol (22-R-OHC) were obtained from Sigma Chemical Co. Oligonucleotides were purchased from Operon Technologies. LDL (density 1.019 to 1.063 g/mL) and HDL (density 1.063 to 1.21 g/mL) were isolated on the basis of the protocol described by Havel et al.26
Cell Cultures
Human aortic endothelial cells (HAECs) and human aortic smooth muscle cells (HASMCs) were isolated and cultured as described previously.7,8 Monocytes were prepared by a modification of the method reported by Colotta et al27 from the blood of normal volunteers after obtaining written consent under a protocol approved by the Human Research Subject Protection Committee of the University of California, Los Angeles. Cocultures were set up in 6-well culture dishes treated with 0.1% gelatin at 37°C overnight. HASMCs were added at a density of 1x105 cells/cm2. Cells were cultured for 2 days, and HAECs were subsequently added at 2x105 cells/cm2 and were allowed to grow, forming a complete monolayer of confluent HAECs in 2 days. In all experiments, HAECs and autologous HASMCs (from the same donor) were used at passages 4 to 6.
Northern and Western Analyses
Northern analyses were performed as described previously.28 Human ABCA1 cDNA was provided by Dr Peter Edwards (University of California, Los Angeles). Western analyses were performed as described previously.8 Briefly, protein extracts from human artery wall cocultures (60 µg) were subjected to SDS-PAGE on 5% Tris-HCl gels. Proteins were electroblotted onto Hybond ECL Nitrocellulose membranes (Amersham) and incubated for 3 hours with rabbit anti-human ABCA1 antiserum (Novus Biologicals) at 1:100 dilution. Proteins were detected by using an ECL Western blotting kit (Amersham) according to the manufacturer’s suggested protocol.
Antisense Oligonucleotide Experiments
Antisense oligonucleotide experiments were performed as described previously.29 Briefly, HAEC/HASMC cocultures were set up in 6-well plates. Phosphorothioate oligonucleotides (Operon Technologies) were used at a final concentration of 100 nmol/L for all antisense transfection experiments. Appropriate amounts of the oligonucleotides were diluted in 200 µL serum-free medium 199 in 0.5-mL Eppendorf tubes. Three microliters of SuperFect reagent (Qiagen, Inc) was added to each tube and incubated at room temperature for 15 minutes to allow SuperFect reagent–DNA complex formation. During the incubation, the HAECs were washed with PBS and supplemented with 0.8 mL complete medium 199. The transfection complexes were added to the wells and incubated for 2 hours. The cultures were washed in PBS and supplemented with complete medium 199. Eighteen hours later, the transfection protocol was repeated, and cultures received 250 µg/mL of LDL. Six hours later, supernatants were collected and tested for monocyte adhesion activity and monocyte chemotactic activity. Additionally, total cellular protein was isolated from each experimental condition and analyzed for ABCA1 by Western analysis, as described above. The oligonucleotides used were antisense (5' CATGTTGTTCATAGGGTGGGTAGCTC 3') and sense (5' GAGCTACCCACCCTATGAACAACATG 3').
Other Methods
Monocyte chemotactic activity assays were performed as described previously.7,8 Protein concentrations were determined by using the Bradford reagent (Bio-Rad). Lipid hydroperoxides were determined by the method reported by Auerbach et al.30 Statistical significance was determined by ANOVA. The analyses were first carried out with the Excel application program (Microsoft), followed by a paired Student t test to identify significantly different means. Significance is defined as P<0.05.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Inhibitors of ABCA1 Function Impair Artery Wall Coculture–Mediated Modification of LDL
To determine whether ABCA1 plays a role in cell-mediated oxidation of LDL, we first examined the effect of inhibitors of ABCA1 function, glyburide and DIDS, on artery wall coculture–mediated oxidation of LDL. As expected, on the basis of our previous studies,7,8 when cocultures were incubated with LDL (250 µg/mL, 18 hours), LDL-induced lipid hydroperoxides and LDL-induced monocyte chemotactic activity were elevated in the coculture supernatants (Figure 1). However, pretreatment of the cocultures with either glyburide (100 µmol/L) or DIDS (100 µmol/L) significantly impaired cell-mediated oxidative modification of LDL, as indicated by the decrease in LDL-induced lipid hydroperoxides (Figure 1, left), and decreased LDL-induced monocyte chemotactic activity (Figure 1, right) in the coculture supernatants. Furthermore, the results were dose dependent in experiments in which glyburide and DIDS were both tested at different concentrations between 10 and 200 µmol/L. Glyburide and DIDS at the concentrations used in coculture experiments showed no cytotoxicity and completely blocked HDL-mediated cholesterol efflux (data not shown) in human monocyte macrophages. These results suggest that cell-mediated LDL oxidation and cholesterol efflux share a common mechanism(s).
|
Inducers of ABCA1 Expression Enhance Coculture-Mediated Modification of LDL
Because inhibitors of ABCA1 function impaired the ability of artery wall cells to modify/oxidize LDL, we next examined the effect of inducers of ABCA1 expression on coculture-mediated modification of LDL. 22-R-OHC is a potent inducer of ABCA1 transcription in macrophages.31 ABCA1 mRNA (Figure 2A) and protein (Figure 2B) were induced after 22-R-OHC treatment in artery wall cocultures. 22-R-OHC that was incubated directly with LDL did not affect either the lipid hydroperoxide content of LDL or LDL-induced monocyte chemotactic activity. However, cocultures pretreated with 22-R-OHC oxidized LDL significantly more than did the untreated cocultures (Figure 2C, left), and cocultures pretreated with 22-R-OHC (25 µmol/L) had significantly higher monocyte chemotactic activity (Figure 2C, right). The results were significant and consistent in dose-response experiments in which 22-R-OHC concentrations between 5 and 50 µmol/L were tested.
|
Antisense Oligonucleotides to ABCA1 Disrupt Coculture-Mediated Oxidation of LDL
We next examined the effect of selective inhibition of ABCA1 on coculture-mediated oxidation of LDL. Antisense oligonucleotides targeted to human ABCA1 mRNA have been previously used to successfully block the expression of ABCA1 protein and ABCA1 function in macrophages.9,32 Transfection with oligonucleotides alone, either sense or antisense, did not affect the accumulation of lipid hydroperoxides or monocyte chemotactic activity in untreated artery wall coculture supernatants (Figure 3). Pretreatment of cocultures with antisense oligonucleotides significantly impaired cell-mediated oxidative modification of LDL, as was evident from the decrease in LDL-induced lipid hydroperoxides (Figure 3, left) and LDL-induced monocyte chemotactic activity (Figure 3, right) in the coculture supernatants. These data suggest that ABCA1 modulates the cell-mediated oxidative modification of LDL by artery wall cells. Furthermore, antisense oligonucleotides to ABCA1 inhibited the accumulation of ABCA1 protein in artery wall cocultures pretreated with 22-R-OHC (Figure 4A), and they also prevented LDL-induced monocyte chemotactic activity in the supernatants of cocultures that had been pretreated with 22-R-OHC (Figure 4B).
|
|
22-R-OHC Induces the Accumulation of Intracellular ROS
Incubating cocultures with 22-R-OHC not only induced ABCA1 expression (Figure 2A) but also enhanced coculture-mediated modification of LDL (Figure 2B). Moreover, antisense oligonucleotides to ABCA1 attenuated 22-R-OHC–mediated LDL oxidation (Figure 4B). The increase in LDL oxidation, after exposure to 22-R-OHC, could be due to either an increase in the transport of ROS alone (via increases in ABCA1 expression) or an increase in the synthesis of ROS. To test the later possibility, we examined the accumulation of intracellular ROS in 22-R-OHC–treated cocultures. We have recently reported the use of 2',7'-dichlorofluorescin diacetate (DCFH-DA) to measure intracellular oxidative stress.33 This assay quantifies the fluorescence emitted when the nonfluorescent DCFH-DA is oxidized to the highly fluorescent dichlorofluorescein (DCF) by intracellular ROS. Artery wall cocultures were incubated with 100 µmol/L DCFH-DA for 1 hour and subsequently treated with varying concentrations (0 to 50 µmol/L) of 22-R-OHC. No significant difference in emitted fluorescence was observed between cells treated with vehicle alone or untreated cells (data not shown). Emitted fluorescence was significantly higher (at all time points tested) in cocultures treated with 22-R-OHC (50 µmol/L) than in control cells (Figure 5A). 22-R-OHC incubated alone (in the absence of cells) with DCFH-DA did not cause any changes in emitted fluorescence (data not shown), suggesting that 22-R-OHC, by itself, does not oxidize DCFH-DA to the fluorescent DCF. These experiments demonstrate that oxy- sterols, such as 22-R-OHC, induce the synthesis and/or accumulation of ROS in artery wall cocultures.
|
ApoA-I Renders 22-R-OHC–Incubated Cocultures Unable to Oxidize LDL
ApoA-I removes ROS, including HPETE and HPODE, and renders artery wall cells unable to oxidize LDL.7,8 We next examined whether apoA-I is able to remove 22-R-OHC–induced ROS from the artery wall cocultures and thus prevent 22-R-OHC–induced LDL oxidation by cocultures. Cocultures pretreated with 22-R-OHC oxidized LDL significantly more than did untreated cocultures (Figure 5B, left), and cocultures pretreated with 22-R-OHC (25 µmol/L) had significantly higher monocyte chemotactic activity (Figure 5B, right). However, apoA-I (100 µg/mL) added to the cells for 6 hours after 22-R-OHC treatment and removal before the addition of LDL significantly inhibited the ability of cocultures to modify LDL (Figure 5B).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In presenting possible explanations for the decrease in atherosclerosis in 12/15-lipoxygenase–knockout mice, Cyrus et al34 concluded that several mechanisms could explain their findings, but they favored one in which ". . .lipoxygenase-derived hydroperoxides or secondary reactive lipid species may be transferred across the cell membrane to ‘seed’ the extracellular LDL, which would then be more susceptible to a variety of mechanisms that could promote lipid peroxidation." Because ABCA-1 mediates the transport of cholesterol and phospholipids from cells by apoA-I,35 we hypothesized that ABCA1 might also participate in the transfer of the seeding molecules from artery wall cells to LDL. In the present study, we demonstrated that ABCA1 modulates artery wall cell–mediated oxidation of LDL. Recent evidence suggests that ABCA1 may have a more indirect role in cholesterol transport and thus functions as a cholesterol efflux regulatory protein.36,37 Several reports also indicate that ABCA1 is not confined to regulating the transport of cholesterol and phospholipids alone. ABCA1 modulates the secretion of apoE from human monocyte–derived macrophages,32 interluekin-1ß secretion,38 and
-tocopherol.39 Our data suggest that ABCA1 may also modulate the secretion of ROS from artery wall cells that are necessary for LDL oxidation. We found that 22-R-OHC not only induced accumulation of intracellular ROS (Figure 5) in artery wall cocultures but also significantly increased artery wall cell–mediated LDL oxidation (Figure 2). We previously demonstrated that human artery wall cells contain 12-lipoxygenase protein and mRNA and that chemical inhibitors and antisense oligonucleotides of 12-lipoxygenase inhibited the ability of the cells to oxidize LDL.8 On the basis of our previous results,8 we hypothesized that oxysterols may activate 12-lipoxygenase, resulting in increased synthesis of HPETE and HPODE and thus causing an increase in LDL oxidation. However, inhibiting 12-lipoxygenase did not affect the 22-R-OHC–mediated increase in LDL-induced monocyte chemotactic activity (data not shown). Furthermore, we did not find any changes in 15-lipoxygenase and 5-lipoxygenase (message or protein) after treatment of the artery wall cocultures with 22-R-OHC (data not shown). It is possible that oxygenated sterols may regulate LDL oxidation by artery wall cells either via posttranslational modifications of lipoxygenases or via a novel previously unidentified pathway(s), such as increasing phospholipase activity in the artery wall cells, resulting in increased synthesis of arachidonic acid and linoleic acid, the substrates for lipoxygenases. We are currently evaluating these possibilities.
Interestingly, Liao et al40 recently reported that native LDL induces ABCA1 mRNA and protein in vascular endothelial cells. ABCA1 protein induction by native LDL at 24 hours was significant, but it was only moderate in HAECs compared with HUVECs, which were the predominant cells used in their studies.40 In our experiments, LDL alone did not significantly induce ABCA1 message or protein in HAECs or cocultures after 6 hours of LDL treatment (data not shown). Liao et al also suggest that overexpression of ABCA1 by LDL prevents overloading of cholesterol by increasing the efflux of cholesterol. The data and conclusions from their studies are consistent with our hypotheses that reverse cholesterol transport and LDL oxidation/metabolism may be linked in the artery wall.
In light of our findings, one might expect that the balance between the transport out of the cell of the seeding molecules by ABCA1 to extracellular LDL (favoring LDL oxidation) and the generation of higher levels of HDL (which could prevent LDL oxidation) might be a complex process, and it might be difficult to predict whether ABCA1 would promote or retard atherogenesis. In fact, some of the unexpected results from studies on ABCA1 transgenic and knockout mice20–24,41–45 do not support a simple reverse cholesterol transport model.46 Joyce et al42 recently reported that transgenic expression of ABCA1 reduced atherosclerosis in C57BL/6J mice fed an atherogenic diet containing cholic acid but actually increased atherosclerosis in apoE-null mice that were also transgenic for human ABCA1. In contrast, Singaraja et al44 reported that human ABCA1–overexpressing transgenic mice had reduced atherosclerosis. Aiello et al41 reported that the complete absence of ABCA1 did not affect the development, progression, or composition of atherosclerotic lesions in either LDL receptor–null or apoE-null mice fed either a chow or atherogenic diet. However, Aiello et al41 and Van Eck et al,45 using bone marrow transplantation, found that the absence of ABCA1 from macrophages resulted in increased atherosclerosis in apoE-null41 and LDL receptor–null45 mice. Thus, the role of ABCA1 in atherosclerosis is clearly complex.
Our data suggest that reverse cholesterol transport and LDL oxidation may share common mechanisms (Figure 6) in at least 2 ways: (1) ABCA1 participates in reverse cholesterol transport and LDL oxidation. (2) Cellular cholesterol levels may determine the cellular levels of 22-R-OHC, which, in part, regulates cell-mediated LDL oxidation. The diagram in Figure 6 also implies that the relative balance between LDL concentrations and HDL formation will determine intracellular cholesterol levels and the extracellular pathway for oxidized lipids and/or ROS. This scheme would predict that at high levels of LDL relative to HDL formation, LDL oxidation would be favored, whereas at low levels of LDL relative to HDL formation, LDL oxidation would not be favored. Thus, the rate of formation and clearance of mature HDL relative to LDL levels would determine in part the rate of LDL oxidation and atherogenesis.
|
|
Acknowledgments |
|---|
This work was supported by US Public Health Service grant HL-30568 and by the Laubisch, Castera, and M.K. Gray Fund at the University of California, Los Angeles. We thank Linda Jin, Rachel Mottahadeh, and Greg Hough for their technical support.
Received August 8, 2002; accepted August 12, 2002.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Navab M, Berliner JA, Subbanagounder G, Hama S, Lusis AJ, Castellani LW, Reddy S, Shih D, Shi W, Watson AD, Van Lenten BJ, Vora D, Fogelman AM. HDL and the inflammatory response induced by LDL-derived oxidized phospholipids. Arterioscler Thromb Vasc Biol. 2001; 21: 481–488.
2. Andersson LO. Pharmacology of apolipoprotein A-I. Curr Opin Lipidol. 1997; 8: 225–228.[Medline] [Order article via Infotrieve]
3. Brouillette CG, Anantharamaiah GM. Structural models of human apolipoprotein A-I. Biochim Biophys Acta. 1995; 1256: 103–129.[Medline] [Order article via Infotrieve]
4. Oram JF, Yokoyama S. Apolipoprotein-mediated removal of cellular cholesterol and phospholipids. J Lipid Res. 1996; 37: 2473–2491.[Abstract]
5. Barter PJ, Rye KA. Molecular mechanisms of reverse cholesterol transport. Curr Opin Lipidol. 1996; 7: 82–87.[Medline] [Order article via Infotrieve]
6. Luoma PV. Gene activation, apolipoprotein A-I/high density lipoprotein, atherosclerosis prevention and longevity. Pharmacol Toxicol. 1997; 81: 57–64.[Medline] [Order article via Infotrieve]
7. Navab M, Hama SY, Cooke CJ, Anantharamaiah GM, Chaddha M, Jin L, Subbanagounder G, Faull KF, Reddy ST, Miller NE, Fogelman AM. Normal high density lipoprotein inhibits three steps in the formation of mildly oxidized low density lipoprotein: step 1. J Lipid Res. 2000; 41: 1481–1494.
8. Navab M, Hama SY, Anantharamaiah GM, Hassan K, Hough GP, Watson AD, Reddy ST, Sevanian A, Fonarow GC, Fogelman AM. Normal high density lipoprotein inhibits three steps in the formation of mildly oxidized low density lipoprotein: steps 2 and 3. J Lipid Res. 2000; 41: 1495–1508.
9. Lawn RM, Wade DP, Garvin MR, Wang X, Schwartz K, Porter JG, Seilhamer JJ, Vaughan AM, Oram JF. The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway. J Clin Invest. 1999; 104: R25–R31.[Medline] [Order article via Infotrieve]
10. Oram JF, Lawn RM, Garvin MR, Wade DP. ABCA1 is the cAMP-inducible apolipoprotein receptor that mediates cholesterol secretion from macrophages. J Biol Chem. 2000; 275: 34508–34511.
11. Wang N, Silver DL, Costet P, Tall AR. Specific binding of apoA-I, enhanced cholesterol efflux, and altered plasma membrane morphology in cells expressing ABC1. J Biol Chem. 2000; 275: 33053–33058.
12. Chambenoit O, Hamon Y, Marguet D, Rigneault H, Rosseneu M, Chimini G. Specific docking of apolipoprotein A-I at the cell surface requires a functional ABCA1 transporter. J Biol Chem. 2001; 276: 9955–9960.
13. Francis GA, Knopp RH, Oram JF. Defective removal of cellular cholesterol and phospholipids by apolipoprotein A-I in Tangier Disease. J Clin Invest. 1995; 96: 78–87.[Medline] [Order article via Infotrieve]
14. Marcil M, Yu L, Krimbou L, Boucher B, Oram JF, Cohn JS, Genest J Jr. Cellular cholesterol transport and efflux in fibroblasts are abnormal in subjects with familial HDL deficiency. Arterioscler Thromb Vasc Biol. 1999; 19: 159–169.
15. Bodzioch M, Orso E, Klucken J, Langmann T, Bottcher A, Diederich W, Drobnik W, Barlage S, Buchler C, Porsch-Ozcurumez M, Kaminski WE, Hahmann HW, Oette K, Rothe G, Aslanidis C, Lackner KJ, Schmitz G. The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease. Nat Genet. 1999; 22: 347–351.[CrossRef][Medline] [Order article via Infotrieve]
16. Rust S, Rosier M, Funke H, Real J, Amoura Z, Piette JC, Deleuze JF, Brewer HB, Duverger N, Denefle P, Assmann G. Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1. Nat Genet. 1999; 22: 352–355.[CrossRef][Medline] [Order article via Infotrieve]
17. Remaley AT, Rust S, Rosier M, Knapper C, Naudin L, Broccardo C, Peterson KM, Koch C, Arnould I, Prades C, Duverger N, Funke H, Assman G, Dinger M, Dean M, Chimini G, Santamarina-Fojo S, Fredrickson DS, Denefle P, Brewer HB Jr. Human ATP-binding cassette transporter 1 (ABC1). genomic organization and identification of the genetic defect in the original Tangier disease kindred. Proc Natl Acad Sci U S A. 1999; 96: 12685–12690.
18. Brooks-Wilson A, Marcil M, Clee SM, Zhang LH, Roomp K, van Dam M, Yu L, Brewer C, Collins JA, Molhuizen HO, Loubser O, Ouelette BF, Fichter K, Ashbourne-Excoffon KJ, Sensen CW, Scherer S, Mott S, Denis M, Martindale D, Frohlich J, Morgan K, Koop B, Pimstone S, Kastelein JJ, Hayden MR. Mutations in ABC1 in Tangier disease and familial high-density lipoprotein deficiency. Nat Genet. 1999; 22: 336–345.[CrossRef][Medline] [Order article via Infotrieve]
19. Marcil M, Brooks-Wilson A, Clee SM, Roomp K, Zhang LH, Yu L, Collins JA, van Dam M, Molhuizen HO, Loubster O, Ouellette BF, Sensen CW, Fichter K, Mott S, Denis M, Boucher B, Pimstone S, Genest J Jr, Kastelein JJ, Hayden MR. Mutations in the ABC1 gene in familial HDL deficiency with defective cholesterol efflux. Lancet. 1999; 354: 1341–1346.[CrossRef][Medline] [Order article via Infotrieve]
20. Orso E, Broccardo C, Kaminski WE, Bottcher A, Liebisch G, Drobnik W, Gotz A, Chambenoit O, Diederich W, Langmann T, Spruss T, Luciani MF, Rothe G, Lackner KJ, Chimini G, Schmitz G. Transport of lipids from Golgi to plasma membrane is defective in Tangier disease patients and Abc1-deficient mice. Nat Genet. 2000; 24: 192–196.[CrossRef][Medline] [Order article via Infotrieve]
21. McNeish J, Aiello RJ, Guyot D, Turi T, Gabel C, Aldinger C, Hoppe KL, Roach ML, Royer LJ, deWet J, Broccardo C, Chimini G, Francone OL. High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1. Proc Natl Acad Sci U S A. 2000; 97: 4245–4250.
22. Christiansen-Weber TA, Voland JR, Wu Y, Ngo K, Roland BL, Nguyen S, Peterson PA, Fung-Leung WP. Functional loss of ABCA1 in mice causes severe placental malformation, aberrant lipid distribution, and kidney glomerulonephritis as well as high-density lipoprotein cholesterol deficiency. Am J Pathol. 2000; 157: 1017–1029.
23. Vaisman BL, Lambert G, Amar M, Joyce C, Ito T, Shamburek RD, Cain WJ, Fruchart-Najib J, Neufeld ED, Remaley AT, Brewer HB Jr, Santamarina-Fojo S. ABCA1 overexpression leads to hyperalphalipoproteinemia and increased biliary cholesterol excretion in transgenic mice. J Clin Invest. 2001; 108: 303–309.[CrossRef][Medline] [Order article via Infotrieve]
24. Singaraja RR, Bocher V, James ER, Clee SM, Zhang LH, Leavitt BR, Tan B, Brooks-Wilson A, Kwok A, Bissada N, Yang YZ, Liu G, Tafuri SR, Fievet C, Wellington CL, Staels B, Hayden MR. Human ABCA1 BAC transgenic mice show increased high density lipoprotein cholesterol and apoAI-dependent efflux stimulated by an internal promoter containing liver X receptor response elements in intron 1. J Biol Chem. 2001; 276: 33969–33979.
25. Becq F, Hamon Y, Bajetto A, Gola M, Verrier B, Chimini G. ABC1, an ATP binding cassette transporter required for phagocytosis of apoptotic cells, generates a regulated anion flux after expression in Xenopus laevis oocytes. J Biol Chem. 1997; 272: 2695–2699.
26. Havel RJ, Eder HA, Bragdon JH. The distribution and chemical composition of ultracentrifugally separated lipoproteins of human serum. J Clin Invest. 1955; 43: 1345–1353.
27. Colotta F, Peri G, Villa A, Mantovani A. Rapid killing of actinomycin D-treated tumor cells by human mononuclear cells, I: effectors belong to the monocyte-macrophage lineage. J Immunol. 1984; 132: 936–944.[Abstract]
28. Reddy ST, Winstead M, Tischfield JA, Herschman HR. Analysis of the secretory phospholipase A2 that mediates prostaglandin production in mast cells. J Biol Chem. 1997; 271: 13591–13596.
29. Reddy S, Hama S, Grijalva V, Hassan K, Mottahedeh R, Hough G, Wadleigh DJ, Navab M, Fogelman AM. Mitogen-activated protein kinase phosphatase 1 activity is necessary for oxidized phospholipids to induce monocyte chemotactic activity in human aortic endothelial cells. J Biol Chem. 2001; 276: 17030–17035.
30. Auerbach BJ, Kiely JS, Cornicelli JA. A spectrophotometric microtiter-based assay for the detection of hydroperoxy derivatives of linoleic acid. Anal Biochem. 1992; 201: 375–380.[CrossRef][Medline] [Order article via Infotrieve]
31. Venkateswaran A, Laffitte BA, Joseph SB, Mak PA, Wilpitz DC, Edwards PA, Tontonoz P. Control of cellular cholesterol efflux by the nuclear oxysterol receptor LXR alpha. Proc Natl Acad Sci U S A. 2000; 97: 12097–12102.
32. Von Eckardstein A, Langer C, Engel T, Schaukal I, Cignarella A, Reinhardt J, Lorkowski S, Li Z, Zhou X, Cullen P, Assmann G. ATP binding cassette transporter ABCA1 modulates the secretion of apolipoprotein E from human monocyte-derived macrophages. FASEB J. 2001; 15: 1555–1561.
33. Ng CJ, Wadleigh DJ, Gangopadhyay A, Hama S, Grijalva VR, Navab M, Fogelman AM, Reddy ST. Paraoxonase-2 is a ubiquitously expressed protein with antioxidant properties and is capable of preventing cell-mediated oxidative modification of low density lipoprotein. J Biol Chem. 2001; 276: 44444–44449.
34. Cyrus T, Witztum JL, Rader DJ, Tangirala R, Fazio S, Linton MF, Funk CD. Disruption of the 12/15-lipoxygenase gene diminishes atherosclerosis in apo E-deficient mice. J Clin Invest. 1999; 103: 1597–1604.[Medline] [Order article via Infotrieve]
35. Attie AD, Kastelein JP, Hayden MR. Pivotal role of ABCA1 in reverse cholesterol transport influencing HDL levels and susceptibility to atherosclerosis. J Lipid Res. 2001; 42: 1717–1726.
36. Wang N, Silver DL, Thiele C, Tall AR. ATP-binding cassette transporter A1 (ABCA1) functions as a cholesterol efflux regulatory protein. J Biol Chem. 2001; 276: 23742–23747.
37. Fielding PE, Nagao K, Hakamata H, Chimini G, Fielding CJ. A two-step mechanism for free cholesterol and phospholipid efflux from human vascular cells to apolipoprotein A-1. Biochemistry. 2000; 39: 14113–14120.[CrossRef][Medline] [Order article via Infotrieve]
38. Hamon Y, Luciani MF, Becq F, Verrier B, Rubartelli A, Chimini G. Interleukin-1beta secretion is impaired by inhibitors of the ATP binding cassette transporter, ABC1. Blood. 1997; 90: 2911–2915.
39. Oram JF, Vaughan AM, Stocker R. ATP-binding cassette transporter A1 mediates cellular secretion of alpha-tocopherol. J Biol Chem. 2001; 276: 39898–39902.
40. Liao H, Langmann T, Schmitz G, Zhu Y. Native LDL upregulation of ATP-binding cassette transporter-1 in human vascular endothelial cells. Arterioscler Thromb Vasc Biol. 2002; 22: 127–132.
41. Aiello RJ, Brees D, Bourassa PA, Royer L, Lindsey S, Coskran T, Haghpassand M, Francone OL. Increased atherosclerosis in hyperlipidemic mice with inactivation of ABCA1 in macrophages. Arterioscler Thromb Vasc Biol. 2002; 22: 630–637.
42. Joyce CW, Amar MJA, Lambert G, Vaisman BL, Paigen B, Najib-Fruchart J, Hoyt RF Jr, Neufeld ED, Remaley AT, Fredrickson DS, Brewer HB Jr, Santamarina-Fojo S. The ATP binding cassette transporter A1 (ABCA1) modulates the development of aortic atherosclerosis in C57BL/6 and apoE-knockout mice. Proc Natl Acad Sci U S A. 2002; 99: 407–412.
43. Groen AK, Bloks VW, Bandsma RH, Ottenhoff R, Chimini G, Kuipers F. Hepatobiliary cholesterol transport is not impaired in ABCA1-null mice lacking HDL. J Clin Invest. 2001; 108: 843–850.[CrossRef][Medline] [Order article via Infotrieve]
44. Singaraja RR, Fievet C, Castro G, James ER, Hennuyer N, Clee SM, Bissada N, Choy JC, Fruchart J-C, McManus BM, Staels B, Hayden MR. Increased ABCA1 activity protects against atherosclerosis. J Clin Invest. 2002; 110: 35–42.[CrossRef][Medline] [Order article via Infotrieve]
45. Van Eck M, Bos IS, Kaminski WE, Orso E, Rothe G, Twisk J, Bottcher A, Van Amesfoort ES, Christiansen-Weber TA, Fung-Leung W-P, Van Berkel TJC, Schmitz G. Leukocyte ABCA1 controls susceptibility to atherosclerosis and macrophage recruitment into tissues. Proc Natl Acad Sci U S A. 2002; 99: 6298–6303.
46. Tall AR, Wang N, Mucksavage P. Is it time to modify the reverse cholesterol transport model? J Clin Invest. 2001; 108: 1273–1275.[CrossRef][Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  G. D. Wool, C. A. Reardon, and G. S. Getz Apolipoprotein A-I mimetic peptide helix number and helix linker influence potentially anti-atherogenic properties J. Lipid Res., June 1, 2008; 49(6): 1268 - 1283. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Cuchel and D. J. Rader Macrophage Reverse Cholesterol Transport: Key to the Regression of Atherosclerosis? Circulation, May 30, 2006; 113(21): 2548 - 2555. [Full Text] [PDF]
|
|
|
|
 |
|
 M.-C. Gerbod-Giannone, Y. Li, A. Holleboom, S. Han, L.-C. Hsu, I. Tabas, and A. R. Tall TNF{alpha} induces ABCA1 through NF-{kappa}B in macrophages and in phagocytes ingesting apoptotic cells PNAS, February 28, 2006; 103(9): 3112 - 3117. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Koldamova, M. Staufenbiel, and I. Lefterov Lack of ABCA1 Considerably Decreases Brain ApoE Level and Increases Amyloid Deposition in APP23 Mice J. Biol. Chem., December 30, 2005; 280(52): 43224 - 43235. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Ou, J. Wang, H. Xu, Z. Ou, M. G. Sorci-Thomas, D. W. Jones, P. Signorino, J. C. Densmore, S. Kaul, K. T. Oldham, et al. Effects of D-4F on Vasodilation and Vessel Wall Thickness in Hypercholesterolemic LDL Receptor-Null and LDL Receptor/Apolipoprotein A-I Double-Knockout Mice on Western Diet Circ. Res., November 25, 2005; 97(11): 1190 - 1197. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S Soumian, C Albrecht, A. Davies, and R. Gibbs ABCA1 and atherosclerosis Vascular Medicine, May 1, 2005; 10(2): 109 - 119. [Abstract] [PDF]
|
|
|
|
 |
|
 C. Albrecht, S. Soumian, J.S. Amey, A. Sardini, C.F. Higgins, A.H. Davies, and R.G.J. Gibbs ABCA1 Expression in Carotid Atherosclerotic Plaques Stroke, December 1, 2004; 35(12): 2801 - 2806. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Navab, G.M. Anantharamaiah, S. T. Reddy, S. Hama, G. Hough, V. R. Grijalva, A. C. Wagner, J. S. Frank, G. Datta, D. Garber, et al. Oral D-4F Causes Formation of Pre-{beta} High-Density Lipoprotein and Improves High-Density Lipoprotein-Mediated Cholesterol Efflux and Reverse Cholesterol Transport From Macrophages in Apolipoprotein E-Null Mice Circulation, June 29, 2004; 109(25): 3215 - 3220. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Datta, R. F. Epand, R. M. Epand, M. Chaddha, M. A. Kirksey, D. W. Garber, S. Lund-Katz, M. C. Phillips, S. Hama, M. Navab, et al. Aromatic Residue Position on the Nonpolar Face of Class A Amphipathic Helical Peptides Determines Biological Activity J. Biol. Chem., June 18, 2004; 279(25): 26509 - 26517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Navab, G. M. Ananthramaiah, S. T. Reddy, B. J. Van Lenten, B. J. Ansell, G. C. Fonarow, K. Vahabzadeh, S. Hama, G. Hough, N. Kamranpour, et al. Thematic review series: The Pathogenesis of Atherosclerosis The oxidation hypothesis of atherogenesis: the role of oxidized phospholipids and HDL J. Lipid Res., June 1, 2004; 45(6): 993 - 1007. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||