Vascular Biology |
From the Sir William Dunn School of Pathology (D.R.G., A.D.L., K.L., E.J., C.M.Q., S.G.) University of Oxford, Oxford UK; A.I. Virtanen Institute (T.H., S.Y.-H.), University of Kuopio, Kuopio, Finland; Nuffield Department of Surgery (J.S., F.R.G.), John Radcliffe Hospital, Oxford, UK; and the Division of Cardiovascular Medicine (K.T., J.B., C.S., P.L.W.), Addenbrookes Hospital, Cambridge, UK.
Correspondence to David R. Greaves, PhD, Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, UK. E-mail david.greaves{at}path.ox.ac.uk
| Abstract |
|---|
|
|
|---|
Key Words: chemokines atherosclerosis macrophages Th2-type T cells
| Introduction |
|---|
|
|
|---|
Chemoattractant cytokines (chemokines) are small
disulfide-linked polypeptides of typically 60 to 70 amino acids in
length that are potent chemoattractants for
leukocytes.7 The chemokine
supergene family, which was unrecognized 10 years ago, now has >40
different members classified into different subfamilies on the basis of
conserved structural
features.8 9 The
CXC (or
) chemokines have a single amino acid separating the first 2
cysteine residues of the protein, whereas CC (or ß) chemokines have
no amino acid separating the signature C1 and C2 cysteines. The CC
chemokine monocyte chemotactic protein-1 (MCP-1/CCL2), a potent
chemoattractant for monocytes, has been shown to be expressed in human
atherosclerotic
lesions.10 11
Mice homozygous for a targeted deletion of the MCP-1 gene or the gene
that encodes the MCP-1 receptor CCR2 exhibit a reduced incidence of
atherosclerotic lesions when they are fed a high-fat
diet.12 13 The
involvement of chemokines other than MCP-1 in the pathogenesis of
atherosclerosis is suggested by the observation
that lethally irradiated LDL receptorknockout mice
repopulated with bone marrow from CXCR2-deficient mice had smaller
aortic lesions with reduced numbers of recruited
monocytes.14
Fractalkine/CX3CL1 is a novel chemokine that differs from other chemokines in that it has 3 intervening amino acids between the 2 cysteine residues of the chemokine motif (CX3C) and exists as a membrane-bound molecule with the chemokine motif attached to a long mucin stalk.15 When cleaved from the cell surface, soluble forms of fractalkine mediate the chemotaxis of monocytes and T cells.15 Immobilized forms of fractalkine have been shown to mediate tight adhesion of cells carrying the CX3CR1 receptor, and this adhesion does not require integrins, calcium, or an opposing cell membrane.16 Furthermore, fractalkine-dependent firm adhesion of monocytes and T cells can occur under flow conditions.17
We have analyzed the expression of
macrophage-derived chemokine (MDC), fractalkine, and
thymus- and activation-regulated chemokine (TARC), which are linked
chromosome 16q13 chemokines, in primary human macrophages and
in atherosclerotic lesions of human arteries. Macrophage
expression of MDC and TARC is upregulated by the Th2 cytokines
interleukin (IL)-4 and IL-13 but not by IL-10 or the Th1
cytokine interferon-
(IFN-
). The chemokines MDC,
fractalkine, and TARC are expressed by a subset of macrophages
within human atherosclerotic plaques associated with intraplaque
microvessels in regions of
neovascularization.
| Methods |
|---|
|
|
|---|
Human Primary Cell Culture
Macrophages were prepared from
peripheral blood mononuclear cells (PBMCs) by
adhesion. Briefly, PBMCs prepared from buffy coats by Ficoll
centrifugation were incubated in a
225-cm2 tissue culture flask for 3 hours and
washed once with PBS to eliminate unattached cells. After 3 days in
culture, serum-free medium (X-Vivo-10, Bio-Whittaker) containing
IFN-
, IL-4, IL-10, or IL-13 (69 ng/mL, R&D Systems) was added, and
this was repeated on alternate days. Cells were harvested after 72
hours with the use of 1 mmol/L EDTA. Immature dendritic cells
(DCs) were prepared by using a similar protocol, except that PBMCs were
depleted of CD2+ cells by using Dynal beads
before adhesion to tissue culture plastic; IL-4 and
granulocyte-macrophage colonystimulating factor (66 ng/mL)
were added every other day for 7 days. Mature DCs were prepared by
transferring immature DCs to macrophage-conditioned medium
supplemented with IL-4 and granulocyte-macrophage
colonystimulating factor on day 7, and RNA was prepared on day
9.
Western Blotting
Supernatant medium was harvested from
macrophage cultures and fractionated by electrophoresis on 15%
polyacrylamide/SDS gels before transfer to Hybond-C nylon
membranes (Amersham). Blocked filters were incubated with a goat
anti-human TARC antiserum (R&D Systems) or a rabbit anti human MDC
antiserum (Peprotec). Filters were incubated with appropriate secondary
antibodies (Jackson Laboratories) and visualized by enhanced
chemiluminescence (ECL kit, Amersham).
RNA Preparation and RT-PCR
Arterial tissue samples were dispersed by
collagenase and elastase digestion, and cells were
lysed in 150 mmol/L NaCl, 10 mmol/L Tris-HCl (pH 7.4), 1
mmol/L MgCl2, and 0.5% Nonidet P-40. Nuclei
were pelleted by centrifugation, and the supernatant
was adjusted to 1.5% SDS, extracted twice with Tris-buffered phenol,
and ethanol-precipitated. Precipitated RNA was digested with RNase-free
DNase I (Promega). Total RNA (5 µg) was used as a template in a
60-minute reverse transcription (RT) reaction at 42°C by using oligo
dT12-18 primer and avian myeloblastosis virus
reverse transcriptase. The resultant cDNA preparations were used as
templates in 20 µL RTpolymerase chain reaction (PCR) reactions
containing 10 mmol/L Tris-HCl (pH 9.0), 50 mmol/L KCl,
1.5 mmol/L MgCl2, 0.1% Triton X-100,
0.2 mmol/L each dNTP, 250 ng each primer, and 2.5 U Taq Polymerase
(Promega). The following primers were used for RT-PCR reactions:
fractalkine, 5' ATGACATCAAAGATACCTGTAGC and 5' AGGCAATCGGAAAAGGTCC;
MDC, 5' ACAGACTGCACTCCTGGTTG and 5' GCTCAGCTTATTGAGAATCATC; TARC, 5'
GGACCTGCACACAGAGAG-AGAGACTC and 5' GGTACCACGTCTTCAGCTTTC; CD68, 5'
GAGGCCTGGGGCATCTCTGTA and 5' CGAGTTGCTGCAACTGAAGCT; and
ß2-microglobulin, 5' GATTCAGGTTTACTCACG and 5'
CCATGATGCTGCTTACATG. RT-PCR reactions were performed for 30
amplification cycles (94°C for 30 seconds, 55°C for 30 seconds, and
72°C for 90 seconds), except for
ß2-microglobulin and CD68 reactions, which
were amplified for 25 cycles. Half of each RT-PCR reaction was run on a
1% agarose gel and transferred to Hybond NX nylon membranes (Amersham)
by Southern blotting. Filters were hybridized with
[
-32P]dCTPlabeled probe fragments,
and the amount of amplified product in each sample was measured by
using electronic autoradiography (Instant Imager,
Packard). Serial dilutions of cDNA samples were analyzed to
show that the RT-PCR signal was directly proportional to the amount of
cDNA template.
Immunohistochemistry
The preparation of an antifractalkine-specific
antiserum with use of a synthetic peptide corresponding to amino acids
352 to 370 of the intracellular domain of the fractalkine has been
described previously.18 An
affinity-purified antiamino terminal fractalkine rabbit
antiserum15 was a gift of Dr
Thomas Schall (ChemoCentryx Inc, San Carlos, Calif.). Serial
paraffin-embedded sections (7 to 10 µm) and frozen sections (7 µm)
embedded in OCT (Miles Laboratories) were incubated with the
following antibodies: mouse monoclonal antibody (mAb) against human
CD68 (1:300 dilution, KP-1, Dako), mouse mAb against muscle
- and
-actin (1:50 dilution, HHF35, Enzo Diagnostics), and
mouse mAb against human von Willebrand factor (1:600 dilution,
F8/86, Dako). Human MDC expression was detected by using IgG purified
from the serum of a rabbit immunized with recombinant human MDC
(Peprotec), and human TARC was detected by using an affinity-purified
goat anti-human TARC antiserum (R&D Systems). Affinity-purified
polyclonal antisera raised against synthetic fractalkine peptides were
used at a concentration of 100 ng/mL. The TM-Plus
avidinbiotinhorseradish peroxidase detection system (Zymed
Laboratories) was used for detection of bound antibodies;
diaminobenzidine was used as a color substrate. Sections were
counterstained with hematoxylin. Irrelevant class- and species-matched
immunoglobulins were used as
controls.
| Results |
|---|
|
|
|---|
|
Expression of Chromosome 16q13 Chemokines in
Mononuclear Phagocytes
A cDNA clone encoding MDC was originally isolated from
a macrophage cDNA
library,20 and MDC
expression by macrophages has been reported to be upregulated
by bacterial endotoxin21 and
treatment with Th2-type
cytokines.22 By
contrast, TARC has been reported to be a DC-specific
marker.23 We prepared
macrophages and DCs from PBMCs and analyzed the
expression of the linked chromosome 16q13 chemokines by RT-PCR. MDC
mRNA expression in primary macrophages is markedly induced by
treatment with the Th2-type cytokine IL-4
(Figure 1B
). Similar results were obtained with
macrophages prepared from 4 different donors. Although the
level of MDC expression in untreated macrophages varied between
donors, all 4 donors showed a 5- to 10-fold increase in MDC mRNA
expression on addition of IL-4. TARC mRNA is readily detectable in
immature and mature DCs and is induced by IL-4 treatment of primary
human macrophages
(Figure 1B
). A similar pattern of expression is seen with the
use of fractalkine-specific PCR primers, but the level of expression of
fractalkine mRNA is lower than that for MDC or TARC. Supernatant medium
was collected from IL-4treated macrophages and
analyzed by Western blotting. The data of
Figure 1C
show that secretion of TARC into the medium is
completely dependent on the addition of IL-4; similar results were
obtained with macrophages from 3 independent
donors.
We analyzed MDC and TARC mRNA expression by human
primary macrophages treated with other cytokines
characteristic of Th2- and Th1-type immune responses.
Figure 2
shows that macrophage expression of MDC and
TARC mRNA is markedly upregulated by treatment with IL-4 and IL-13 but
not by treatment with IL-10 or the Th1 cytokine IFN-
.
Cytokine-treated macrophages show similar levels of
CD68 mRNA
(Figure 2
), and significant differences in gene expression in
IL-10 and IFN-
treated macrophages were detected in
differential display RT-PCR experiments (data not
shown).
|
Fractalkine, MDC, and TARC mRNA Expression in
Human Arteries
We undertook a semiquantitative RT-PCR analysis
of fractalkine, MDC, and TARC expression in RNA prepared from a panel
of 30 human aortic and carotid artery tissue samples, which had been
selected for evidence of calcified plaques (C. Shanahan, K.
Tyson, P.L. Wessberg, unpublished data, 2001). RNA samples 1 through 10
were prepared from aortic samples that contained fatty streak lesions,
samples 11 through 20 were prepared from aortic samples with calcified
type IV atherosclerotic plaques, and RNA samples 21 through 30 were
prepared from material removed at carotid
endarterectomy. Southern blots of RT-PCR reactions
were performed with equal amounts of cDNA, and chemokine expression
levels are shown in
Figure 3
. Approximately equal amounts of
ß2-microglobulin RT-PCR product were
obtained with each cDNA sample. The level of fractalkine mRNA relative
to a reference mRNA, ß2-microglobulin, varies
>70-fold between different tissue samples
(Figure 3
). The highest level of fractalkine expression is
seen in aortic and carotid tissue samples that contain advanced
atherosclerotic plaques (samples 18, 19, and 27). The level of MDC mRNA
expression relative to ß2-microglobulin varies
widely between arterial samples
(Figure 3
), but the highest levels of expression are seen in
aortic and carotid arterial samples with complex
atherosclerotic lesions. A similar pattern of expression is seen for
TARC. A correlation between the level of MDC and TARC expression can be
seen in some but not all of the carotid tissue samples (eg, samples 23,
27, 28, and 30). Interestingly, the carotid arterial sample
with the lowest level of MDC and TARC expression (sample 25) had the
highest level of MCP-1 expression (data not
shown).
|
Fractalkine, MDC, and TARC Expression in Human
Atherosclerotic Lesions
We have developed an anti-fractalkine antiserum that
recognizes the intracellular domain of the transmembrane fractalkine
molecule.18 Using an
antibody that specifically recognizes only the intracellular portion of
fractalkine allows us to detect cells that express fractalkine in vivo.
We used this antiserum and reagents that specifically detect human MDC
and TARC to examine chromosome 16q13 chemokine expression in human
atherosclerotic lesions.
Figure 4
shows immunohistochemical analysis of
serial sections of an atherosclerotic plaque in a carotid artery
removed at endarterectomy. Staining with an
anti-CD68 antibody shows the presence of large numbers of
macrophages within the carotid plaque
(Figure 4A
). An antismooth muscle actin antibody shows that
there are very few smooth muscle cells within the
macrophage-rich region of the plaque except for those
present in arterioles
(Figure 4B
). The specificity of antibody staining was
demonstrated by using an isotype-matched mouse monoclonal antibody
(Figure 4C
). An affinity-purified antiserum that specifically
detects MDC stains a subset of macrophages within the shoulder
region of the atherosclerotic plaque stain but does not stain the
endothelium of intraplaque microvessels
(Figure 4D
); no MDC staining was seen in a normal radial
arterial sample (data not shown). A very similar pattern of
expression is seen with the use of an antiserum that specifically
recognizes the intracellular domain of fractalkine
(Figure 4E
). An antiserum that has been reported to detect
the chemokine domain of
fractalkine24 stains
macrophages, smooth muscle cells, and
endothelium in an adjacent section of the same lesion
(Figure 4F
). This antibody stains smooth muscle cells and
endothelium in normal arterial samples
(data not shown). We have shown that this anti-fractalkine reagent
cross-reacts with recombinant human
CD84,18 and this most likely
accounts for the different staining pattern obtained with the different
anti-fractalkine reagents. A similar pattern of chemokine expression
was seen in 6 independent carotid endarterectomy
samples (see
Table
).
|
|
We extended our immunohistochemical analysis to
atherosclerotic lesions in femoral and popliteal arteries obtained
after surgical procedures (see
Table
).
Figure
I (which can be accessed online at http://atvb.ahajournals.org)
shows immunohistochemical analysis of chemokine expression in
an atheromatous lesion of the common femoral artery.
CD68 staining shows numerous macrophages in the shoulder region
of the plaque (Figure
IA and IC), and the presence of smooth muscle
cells in this area is revealed by staining with the anti-actin antibody
(Figure
ID). Staining with specific antibodies shows a very similar
expression pattern for TARC (Figure
IE), MDC (Figure
IF), and
fractalkine (Figure
IG) in a subset of macrophages within the
shoulder region of the plaque.
| Discussion |
|---|
|
|
|---|
.
Chromosome 16q13 Chemokine Expression as a
Surrogate Marker of Th2-Type Immune Responses?
We have shown that the genes encoding the CC chemokines
MDC and TARC are physically linked to the gene encoding the
CX3C chemokine fractalkine on chromosome 16q13.
The majority of the CC chemokine genes in the human genome have been
mapped to a locus on chromosome
17q11.2.25 The murine
homologues of MDC, fractalkine, and TARC, ABCD-1, ABCD-2, and ABCD-3,
respectively, are also physically linked in the murine
genome.26 It is striking
that the expression of all 3 chemokine mRNAs in human
macrophages is upregulated by treatment with the Th2-type
cytokine IL-4
(Figure 1B
and 1C
). The very similar pattern of MDC,
fractalkine, and TARC expression by macrophages within complex
atherosclerotic plaques
(Figure 4
and online Figure
I) suggests coordinate regulation
of these linked chemokines in vivo, potentially by Th2-type
cytokines. The measurement of chemokine mRNA levels in human
arterial tissue samples revealed a wide range of levels of
expression
(Figure 3
), especially for the chemokine MDC, and it is
possible that other cytokines and inflammatory stimuli might
regulate chromosome 16q13 chemokine expression within the
arterial wall.
Recent studies of the cytokine secretion profile of
T lymphocytes recovered from human atherosclerotic plaques have
suggested that the majority of CD4+ T cells
in unstable atherosclerotic plaques secrete IFN-
and, hence, are
more likely to be associated with a Th1-type immune
response.27 28
Mach et al29 have reported
that the CXC chemokines IP-10, Mig, and I-TAC are expressed in
human atherosclerotic lesions. All 3 CXC chemokines are induced by
IFN-
; hence, their expression might be considered a surrogate marker
of Th1 cytokine expression in human atherosclerotic lesions.
The same group recently reported expression of the CC chemokine eotaxin
and its receptor CCR3 in atherosclerotic
lesions.30 The eotaxin
receptor CCR3 is preferentially expressed by Th2 T cells, and an
increased number of CCR3-expressing T cells are seen in pathologies
characterized by Th2-type immune responses, such as atopic
dermatitis.31 It is possible
to envisage competing programs of Th1 and Th2 cytokine
expression within the microenvironment of the developing
atherosclerotic plaque. Th1-type cytokines would lead to
macrophages expressing a more inflammatory program of gene
expression, whereas a Th2-type immune response might give rise to a
macrophage gene expression program more associated with
neovascularization and
fibrosis.32 It is
interesting that hypercholesterolemia leads to
a switch from Th1-type to Th2-type immune responses in apoE-knockout
mice.33
Role of MDC, Fractalkine, and TARC in
Mononuclear Cell Recruitment and Retention Within Atherosclerotic
Lesions
Soluble fractalkine can recruit monocytes, T
lymphocytes, and NK cells via
chemotaxis,15 and
immobilized forms of fractalkine have been shown to mediate
tight adhesion independent of the expression of other
endothelial cell surface
receptors.15 16
The recent demonstration that immobilized recombinant
fractalkine can mediate the tight adhesion of monocytes and T cells
under flow conditions17
makes the observed expression pattern of fractalkine in diseased human
arteries especially interesting. Cells staining with the antiCOOH
terminal fractalkine antiserum could be secreting soluble fractalkine,
presenting secreted fractalkine immobilized on heparan
sulfate or expressing full-length membrane-associated fractalkine.
Soluble fractalkine shed within the atherosclerotic lesion might
mediate chemotaxis of CX3CR1-expressing
mononuclear cells. Macrophages expressing full-length
transmembrane forms of fractalkine within atherosclerotic lesions could
serve to promote adhesion and retention of recruited monocytes and T
cells within the developing lesion. Macrophage expression of
MDC and TARC within the atherosclerotic lesion might act to
preferentially recruit Th2-type T cells into larger atherosclerotic
plaques, possibly via the developing microcirculation. Expression of
MDC and TARC within lesions might lead to recruitment of Th2 T cells,
which are associated with the elaboration of humoral immune responses.
Th2-type immune responses within atherosclerotic lesions could give
rise to autoantibodies against modified forms of
LDL.34
The heterogeneity in chemokine mRNA expression patterns seen in human atherosclerotic lesions suggests that the exact mechanisms of chemokine-mediated mononuclear cell recruitment in atherosclerosis may differ between individuals and perhaps even between different lesions within the same individual. The range of MDC mRNA levels seen in human atherosclerotic lesions suggests that human atherosclerotic lesions might display heterogeneity in their molecular pathology that might not be fully appreciated in animal models of atherosclerosis.
| Acknowledgments |
|---|
Received November 24, 2000; accepted March 9, 2001.
| References |
|---|
|
|
|---|
2.
Ross R.
Atherosclerosis: an inflammatory disease.
N Engl J Med. 1999;340:115126.
3. Greaves DR, Gough PJ, Gordon S. Recent progress in defining the role of scavenger receptors in lipid transport, atherosclerosis and host defence. Curr Opin Lipidol. 1998;9:425432.[Medline] [Order article via Infotrieve]
4. Raines EW, Rosenfeld ME, Ross R. The role of macrophages. In: Fuster V, Ross R, Topol EJ, eds. Atherosclerosis and Coronary Artery Disease. Philadelphia, Pa: Lippincott-Raven; 1996:539555.
5. Raines EW, Ross R. Multiple growth factors are associated with lesions of atherosclerosis: specificity or redundancy? Bioessays. 1996;4:271282.
6. Hansson GK. Cell-mediated immunity in atherosclerosis. Curr Opin Lipidol. 1997;8:301311.[Medline] [Order article via Infotrieve]
7.
Luster AD.
Chemokines: chemotactic cytokines that mediate inflammation.
N Engl J Med. 1998;338:436445.
8. Zlotnik A, Yoshie O, Chemokines: a new classification system and their role in immunity. Immunity. 2000;12:121127.[Medline] [Order article via Infotrieve]
9. Greaves DR, Schall TJ. Chemokines and myeloid cell recruitment. Microbes Infect. 2000;2:331336.[Medline] [Order article via Infotrieve]
10. Nelken NA, Coughlin SR, Gordon D, Wilcox JN. Monocyte chemoattractant protein-1 in atheromatous plaques. J Clin Invest. 1991;88:11211127.
11.
Ylä-Hertualla
S, Lipton BA, Rosenfeld ME, Sarkioja T, Yoshimura T, Leonard EJ,
Witztum JL, Steinberg D. Expression of monocyte chemoattractant protein
1 in macrophage-rich areas of human and rabbit atherosclerotic
lesions. Proc Natl Acad Sci
U S A. 1991;88:52525256.
12. Gosling J, Slaymaker S, Gu L, Tseng S, Zlot CH, Young SG, Rollins BJ, Charo IF. MCP-1 deficiency reduces susceptibility to atherosclerosis in mice that overexpress human apolipoprotein B. J Clin Invest. 1999;103:773778.[Medline] [Order article via Infotrieve]
13. Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion formation in CCR2-/- mice reveals a role for chemokines in the initiation of atherosclerosis. Nature. 1998;394:894897.[Medline] [Order article via Infotrieve]
14. Boisvert WA, Santago R, Curtiss LK, Terkeltaub RA. A leukocyte homologue of the IL-8 receptor CXCR2 mediates the accumulation of macrophages in atherosclerotic lesions of LDL receptor-deficient mice. J Clin Invest. 1998;101:353363.[Medline] [Order article via Infotrieve]
15. Bazan JF, Bacon KB, Hardiman G, Wang W, Soo K, Rossi D, Greaves DR, Zlotnik A, Schall TJ. A new class of membrane-bound chemokine with a CX3C motif. Nature. 1997;385:640644.[Medline] [Order article via Infotrieve]
16. Imai T, Hieshima K, Haskell C, Baba M, Nagira M, Nishimura N, Kakizaki M, Takagi S, Nomiyama H, Schall TJ, et al. Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell. 1997;91:521530.[Medline] [Order article via Infotrieve]
17.
Fong AM, Robinson
LA, Steeber DA, Tedder TF, Yoshie O, Imai T, Patel DD. Fractalkine and
CX3CR1 mediate a novel mechanism of leukocyte capture, firm adhesion,
and activation under physiologic flow. J
Exp Med. 1998;188:14131419.
18.
Lucas AD,
Chadwick N, Warren BF, Jewell DP, Gordon S, Powrie F, Greaves DR. The
transmembrane form of the CX3CL1chemokine fractalkine is expressed
predominantly by epithelial cells in vivo.
Am J Pathol. 2001;158:855866.
19. Nomiyama H, Imai T, Kusuda J, Miura R, Callen DF, Yoshie O. Human chemokines fractalkine (SCYD1), MDC (SCYA22) and TARC (SCYA17) are clustered on chromosome 16q13. Cytogenet Cell Genet. 1998;81:1011.[Medline] [Order article via Infotrieve]
20.
Godiska R,
Chantry D, Raport CJ, Sozzani S, Allavena P, Leviten D, Mantovani A,
Gray PW. Human macrophage-derived chemokine (MDC), a novel
chemoattractant for monocytes, monocyte-derived dendritic cells, and
natural killer cells. J Exp
Med. 1997;185:15951604.
21. Rodenburg RJ, Brinkhuis RF, Peek R, Westphal JR, Van Den Hoogen FH, van Venrooij WJ, van der Putte LB. Expression of macrophage-derived chemokine (MDC) mRNA in macrophages is enhanced by interleukin-1beta, tumour necrosis factor alpha, and lipopolysaccharide. J Leukoc Biol. 1998;63:606611.[Abstract]
22.
Andrew DP, Chang
MS, McNinch J, Wathen ST, Rihanek M, Tseng J, Spellberg JP, Elias CG
III. STCP-1 (MDC) CC chemokine acts specifically on chronically
activated Th2 lymphocytes and is produced by monocytes on
stimulation with Th2 cytokines IL-4 and IL-13.
J Immunol. 1998;161:50275038.
23. Lieberam I, Forster I. The murine beta-chemokine TARC is expressed by subsets of dendritic cells and attracts primed CD4+ T cells. Eur J Immunol. 1999;29:26842694.[Medline] [Order article via Infotrieve]
24. Foussat A, Coulomb-LHermine A, Gosling J, Krzysiek R, Durand-Gasselin I, Schall T, Balian A, Richard Y, Galanaud P, Emilie D. Fractalkine receptor expression by T lymphocyte subpopulations and in vivo production of fractalkine in human. Eur J Immunol. 2000;30:8797.[Medline] [Order article via Infotrieve]
25. Maho A, Carter A, Bensimon A, Vassart G, Parmentier M. Physical mapping of the CC-chemokine gene cluster on the human 17q11.2 region. Genomics. 1999;59:213223.[Medline] [Order article via Infotrieve]
26. Schaniel C, Sallusto F, Ruedl C, Sideras P, Melchers F, Rolink AG. Three chemokines with potential functions in T lymphocyte-independent and -dependent B lymphocyte stimulation. Eur J Immunol. 1999;29:29342947.[Medline] [Order article via Infotrieve]
27. Frostegard J, Ulfgren AK, Nyberg P, Hedin U, Swedenborg J, Andersson U, Hansson GK. Cytokine expression in advanced human atherosclerotic plaques: dominance of pro-inflammatory (Th1) and macrophage-stimulating cytokines. Atherosclerosis. 1999;145:3343.[Medline] [Order article via Infotrieve]
28. de Boer OJ, van der Wal AC, Verhagen CE, Becker AE. Cytokine secretion profiles of cloned T cells from human aortic atherosclerotic plaques. J Pathol. 1999;188:174179.[Medline] [Order article via Infotrieve]
29. Mach F, Sauty A, Iarossi AS, Sukhova GK, Neote K, Libby P, Luster AD. Differential expression of three T lymphocyte-activating CXC chemokines by human atheroma-associated cells. J Clin Invest. 1999;104:10411050.[Medline] [Order article via Infotrieve]
30.
Haley KJ, Lilly
CM, Yang JH, Feng Y, Kennedy SP, Turi TG, Thompson JF, Sukhova GH,
Libby P, Lee RT. Overexpression of eotaxin and the CCR3 receptor in
human atherosclerosis: using genomic technology to
identify a potential novel pathway of vascular inflammation.
Circulation. 2000;102:21852189.
31. Gerber BO, Zanni MP, Uguccioni M, Loetscher M, Mackay CR, Pichler WJ, Yawalkar N, Baggiolini M, Moser B. Functional expression of the eotaxin receptor CCR3 in T lymphocytes co-localizing with eosinophils. Curr Biol. 1997;7:836843.[Medline] [Order article via Infotrieve]
32.
Shi Z, Wakil AE,
Rockey DC. Strain-specific differences in mouse hepatic wound healing
are mediated by divergent T helper cytokine responses.
Proc Natl Acad Sci
U S A. 1997;94:1066310668.
33. Zhou X, Paulsson G, Stemme S, Hansson GK. Hypercholesterolemia is associated with a T helper (Th) 1/Th2 switch of the autoimmune response in atherosclerotic apo E-knockout mice. J Clin Invest. 1998;101:17171725.[Medline] [Order article via Infotrieve]
34. Palinski W, Witztum JL. Immune responses to oxidative neoepitopes on LDL and phospholipids modulate the development of atherosclerosis. J Intern Med. 2000;247:371380.[Medline] [Order article via Infotrieve]
35. Stallings RL, Doggett NA, Callen D, Apostolou S, Chen LZ, Nancarrow JK, Whitmore SA, Harris P, Michison H, Breuning M, et al. Evaluation of a cosmid contig physical map of human chromosome 16. Genomics. 1992;13:10311039. [Medline] [Order article via Infotrieve]
This article has been cited by other articles:
![]() |
L. Landsman, L. Bar-On, A. Zernecke, K.-W. Kim, R. Krauthgamer, E. Shagdarsuren, S. A. Lira, I. L. Weissman, C. Weber, and S. Jung CX3CR1 is required for monocyte homeostasis and atherogenesis by promoting cell survival Blood, January 22, 2009; 113(4): 963 - 972. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Montecucco and F. Mach Common inflammatory mediators orchestrate pathophysiological processes in rheumatoid arthritis and atherosclerosis Rheumatology, January 1, 2009; 48(1): 11 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Marchesi, L. Piemonti, G. Fedele, A. Destro, M. Roncalli, L. Albarello, C. Doglioni, A. Anselmo, A. Doni, P. Bianchi, et al. The Chemokine Receptor CX3CR1 Is Involved in the Neural Tropism and Malignant Behavior of Pancreatic Ductal Adenocarcinoma Cancer Res., November 1, 2008; 68(21): 9060 - 9069. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Popovic, Y. Laumonnier, L. Burysek, T. Syrovets, and T. Simmet Thrombin-induced expression of endothelial CX3CL1 potentiates monocyte CCL2 production and transendothelial migration J. Leukoc. Biol., July 1, 2008; 84(1): 215 - 223. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ryu, C.-W. Lee, K.-H. Hong, J.-A. Shin, S.-H. Lim, C.-S. Park, J. Shim, K. B. Nam, K.-J. Choi, Y.-H. Kim, et al. Activation of fractalkine/CX3CR1 by vascular endothelial cells induces angiogenesis through VEGF-A/KDR and reverses hindlimb ischaemia Cardiovasc Res, May 1, 2008; 78(2): 333 - 340. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Loppnow, K. Werdan, and M. Buerke Invited review: Vascular cells contribute to atherosclerosis by cytokine- and innate-immunity-related inflammatory mechanisms Innate Immunity, April 1, 2008; 14(2): 63 - 87. [Abstract] [PDF] |
||||
![]() |
S. W. Waldo, Y. Li, C. Buono, B. Zhao, E. M. Billings, J. Chang, and H. S. Kruth Heterogeneity of Human Macrophages in Culture and in Atherosclerotic Plaques Am. J. Pathol., April 1, 2008; 172(4): 1112 - 1126. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schulz, A. Schafer, M. Stolla, S. Kerstan, M. Lorenz, M.-L. von Bruhl, M. Schiemann, J. Bauersachs, T. Gloe, D. H. Busch, et al. Chemokine Fractalkine Mediates Leukocyte Recruitment to Inflammatory Endothelial Cells in Flowing Whole Blood: A Critical Role for P-Selectin Expressed on Activated Platelets Circulation, August 14, 2007; 116(7): 764 - 773. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hundhausen, A. Schulte, B. Schulz, M. G. Andrzejewski, N. Schwarz, P. von Hundelshausen, U. Winter, K. Paliga, K. Reiss, P. Saftig, et al. Regulated Shedding of Transmembrane Chemokines by the Disintegrin and Metalloproteinase 10 Facilitates Detachment of Adherent Leukocytes J. Immunol., June 15, 2007; 178(12): 8064 - 8072. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. von Hundelshausen and C. Weber Platelets as Immune Cells: Bridging Inflammation and Cardiovascular Disease Circ. Res., January 5, 2007; 100(1): 27 - 40. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Schafer, C. Schulz, D. Fraccarollo, P. Tas, M. Leutke, M. Eigenthaler, S. Seidl, P. Heider, G. Ertl, S. Massberg, et al. The CX3C Chemokine Fractalkine Induces Vascular Dysfunction by Generation of Superoxide Anions Arterioscler Thromb Vasc Biol, January 1, 2007; 27(1): 55 - 62. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Green, K. H. Han, Y. Chen, F. Almazan, I. F. Charo, Y. I. Miller, and O. Quehenberger The CC Chemokine MCP-1 Stimulates Surface Expression of CX3CR1 and Enhances the Adhesion of Monocytes to Fractalkine/CX3CL1 via p38 MAPK. J. Immunol., June 15, 2006; 176(12): 7412 - 7420. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Norata, K. Garlaschelli, M. Ongari, S. Raselli, L. Grigore, and A. L. Catapano Effects of Fractalkine Receptor Variants on Common Carotid Artery Intima-Media Thickness Stroke, June 1, 2006; 37(6): 1558 - 1561. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Shimizu, R. N. Mitchell, and P. Libby Inflammation and Cellular Immune Responses in Abdominal Aortic Aneurysms Arterioscler Thromb Vasc Biol, May 1, 2006; 26(5): 987 - 994. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Damas, A. Boullier, T. Waehre, C. Smith, W. J. Sandberg, S. Green, P. Aukrust, and O. Quehenberger Expression of Fractalkine (CX3CL1) and its Receptor, CX3CR1, Is Elevated in Coronary Artery Disease and Is Reduced During Statin Therapy Arterioscler Thromb Vasc Biol, December 1, 2005; 25(12): 2567 - 2572. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Quehenberger Thematic Review Series: The Immune System and Atherogenesis. Molecular mechanisms regulating monocyte recruitment in atherosclerosis J. Lipid Res., August 1, 2005; 46(8): 1582 - 1590. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. VanderLaan and C. A. Reardon Thematic review series: The Immune System and Atherogenesis. The unusual suspects:an overview of the minor leukocyte populations in atherosclerosis J. Lipid Res., May 1, 2005; 46(5): 829 - 838. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ghadially, X.-L. Ross, C. Kerst, J. Dong, A. B. Reske-Kunz, and R. Ross Differential Regulation of CCL22 Gene Expression in Murine Dendritic Cells and B Cells J. Immunol., May 1, 2005; 174(9): 5620 - 5629. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lavergne, J. Labreuche, M. Daoudi, P. Debre, F. Cambien, P. Deterre, P. Amarenco, C. Combadiere, and on Behalf of the GENIC Investigators Adverse Associations Between CX3CR1 Polymorphisms and Risk of Cardiovascular or Cerebrovascular Disease Arterioscler Thromb Vasc Biol, April 1, 2005; 25(4): 847 - 853. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Sukkar, R. Issa, S. Xie, U. Oltmanns, R. Newton, and K. F. Chung Fractalkine/CX3CL1 production by human airway smooth muscle cells: induction by IFN-{gamma} and TNF-{alpha} and regulation by TGF-{beta} and corticosteroids Am J Physiol Lung Cell Mol Physiol, December 1, 2004; 287(6): L1230 - L1240. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Weber, A. Schober, and A. Zernecke Chemokines: Key Regulators of Mononuclear Cell Recruitment in Atherosclerotic Vascular Disease Arterioscler Thromb Vasc Biol, November 1, 2004; 24(11): 1997 - 2008. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. F. Charo and M. B. Taubman Chemokines in the Pathogenesis of Vascular Disease Circ. Res., October 29, 2004; 95(9): 858 - 866. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Bursill, R. P. Choudhury, Z. Ali, D. R. Greaves, and K. M. Channon Broad-Spectrum CC-Chemokine Blockade by Gene Transfer Inhibits Macrophage Recruitment and Atherosclerotic Plaque Formation in Apolipoprotein E-Knockout Mice Circulation, October 19, 2004; 110(16): 2460 - 2466. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Ghilardi, M. L. Biondi, O. Turri, E. Guagnellini, and R. Scorza Internal Carotid Artery Occlusive Disease and Polymorphisms of Fractalkine Receptor CX3CR1: A Genetic Risk Factor Stroke, June 1, 2004; 35(6): 1276 - 1279. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Terme, E. Tomasello, K. Maruyama, F. Crepineau, N. Chaput, C. Flament, J.-P. Marolleau, E. Angevin, E. F. Wagner, B. Salomon, et al. IL-4 Confers NK Stimulatory Capacity to Murine Dendritic Cells: A Signaling Pathway Involving KARAP/DAP12-Triggering Receptor Expressed on Myeloid Cell 2 Molecules J. Immunol., May 15, 2004; 172(10): 5957 - 5966. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Liu, N. N. Jarjour, W. W. Busse, and E. A. B. Kelly Enhanced Generation of Helper T Type 1 and 2 Chemokines in Allergen-induced Asthma Am. J. Respir. Crit. Care Med., May 15, 2004; 169(10): 1118 - 1124. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Latchney, M. A. Fallon, D. J. Culp, H. A. Gelbard, and S. Dewhurst Immunohistochemical Assessment of Fractalkine, Inflammatory Cells, and Human Herpesvirus 7 in Human Salivary Glands J. Histochem. Cytochem., May 1, 2004; 52(5): 671 - 682. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Katakura, M. Miyazaki, M. Kobayashi, D. N. Herndon, and F. Suzuki CCL17 and IL-10 as Effectors That Enable Alternatively Activated Macrophages to Inhibit the Generation of Classically Activated Macrophages J. Immunol., February 1, 2004; 172(3): 1407 - 1413. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Schafer, C. Schulz, M. Eigenthaler, D. Fraccarollo, A. Kobsar, M. Gawaz, G. Ertl, U. Walter, and J. Bauersachs Novel role of the membrane-bound chemokine fractalkine in platelet activation and adhesion Blood, January 15, 2004; 103(2): 407 - 412. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Umehara, E. T. Bloom, T. Okazaki, Y. Nagano, O. Yoshie, and T. Imai Fractalkine in Vascular Biology: From Basic Research to Clinical Disease Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 34 - 40. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Lucas, C. Bursill, T. J. Guzik, J. Sadowski, K. M. Channon, and D. R. Greaves Smooth Muscle Cells in Human Atherosclerotic Plaques Express the Fractalkine Receptor CX3CR1 and Undergo Chemotaxis to the CX3C Chemokine Fractalkine (CX3CL1) Circulation, November 18, 2003; 108(20): 2498 - 2504. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hundhausen, D. Misztela, T. A. Berkhout, N. Broadway, P. Saftig, K. Reiss, D. Hartmann, F. Fahrenholz, R. Postina, V. Matthews, et al. The disintegrin-like metalloproteinase ADAM10 is involved in constitutive cleavage of CX3CL1 (fractalkine) and regulates CX3CL1-mediated cell-cell adhesion Blood, August 15, 2003; 102(4): 1186 - 1195. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Combadiere, S. Potteaux, J.-L. Gao, B. Esposito, S. Casanova, E. J. Lee, P. Debre, A. Tedgui, P. M. Murphy, and Z. Mallat Decreased Atherosclerotic Lesion Formation in CX3CR1/Apolipoprotein E Double Knockout Mice Circulation, February 25, 2003; 107(7): 1009 - 1016. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Balabanian, A. Foussat, P. Dorfmuller, I. Durand-Gasselin, F. Capel, L. Bouchet-Delbos, A. Portier, A. Marfaing-Koka, R. Krzysiek, A.-C. Rimaniol, et al. CX3C Chemokine Fractalkine in Pulmonary Arterial Hypertension Am. J. Respir. Crit. Care Med., May 15, 2002; 165(10): 1419 - 1425. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Miyazaki, S.-i. Nureki, T. Fukami, T. Shigenaga, M. Ando, K. Ito, H. Ando, K. Sugisaki, T. Kumamoto, and T. Tsuda Elevated Levels of Thymus- and Activation-regulated Chemokine in Bronchoalveolar Lavage Fluid from Patients with Eosinophilic Pneumonia Am. J. Respir. Crit. Care Med., April 15, 2002; 165(8): 1125 - 1131. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ludwig, T. Berkhout, K. Moores, P. Groot, and G. Chapman Fractalkine Is Expressed by Smooth Muscle Cells in Response to IFN-{gamma} and TNF-{alpha} and Is Modulated by Metalloproteinase Activity J. Immunol., January 15, 2002; 168(2): 604 - 612. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Garton, P. J. Gough, C. P. Blobel, G. Murphy, D. R. Greaves, P. J. Dempsey, and E. W. Raines Tumor Necrosis Factor-alpha -converting Enzyme (ADAM17) Mediates the Cleavage and Shedding of Fractalkine (CX3CL1) J. Biol. Chem., October 5, 2001; 276(41): 37993 - 38001. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2001 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |