© 2001 American Heart Association, Inc.
Vascular Biology |
Function of GATA Transcription Factors in Induction of Endothelial Vascular Cell Adhesion Molecule-1 by Tumor Necrosis Factor-
From the Department of Molecular Biology and Medicine (M.U., C.M., T.H., T.K.), Research Center for Advanced Science and Technology, University of Tokyo, Tokyo, Japan, and the Center for Tsukuba Advanced Research Alliance (N.M., M.Y.), University of Tsukuba, Tsukuba, Japan.
Correspondence to Michihisa Umetani, Department of Molecular Biology and Medicine, #35, RCAST, University of Tokyo, 4-6-1 Komaba, Meguro, Tokyo 153-0084, Japan. E-mail umetani-tky{at}umin.ac.jp
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Endothelial vascular cell adhesion molecule-1 (VCAM-1) is expressed in response to cytokine stimulation and plays a critical role in inflammatory reactions. Previously, we developed a novel VCAM-1 inhibitor that acts through a mechanism independent of nuclear factor-
B activity. It suppresses the binding activity of
GATA proteins in cytokine-stimulated
endothelial cells, which may be related to the
anti–VCAM-1 induction effect of this drug. In this study, we
investigated the role of GATA proteins in the induction of VCAM-1 by
tumor necrosis factor-
(TNF-) in human
endothelial cells. The mRNA expression of GATA-6 was
increased, whereas GATA-3 mRNA was decreased by TNF- stimulation.
Electrophoretic mobility shift assay showed that TNF- stimulation
increased the DNA binding of GATA-6 but decreased that of GATA-3.
Experiments using protein overexpression or antisense
oligonucleotides revealed that GATA-6 potently acts as
a positive regulator of VCAM-1 gene transcription. In contrast,
overexpression of GATA-3 was able to suppress TNF-–induced VCAM-1
expression. Our results provide evidence of the importance of GATA
proteins in the induction of VCAM-1 by TNF- in vascular
endothelial cells. The switch from GATA-3 to GATA-6 is
taken to be an important transcriptional control event in TNF-
induction of
VCAM-1.
Key Words: endothelial cells • vascular cell adhesion molecule-1 • GATA transcription factor • tumor necrosis factor- • human umbilical vein endothelial cells
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Adherence to the blood vessel wall via cell adhesion molecules is an important step in leukocyte migration.1 Vascular cell adhesion molecule-1 (VCAM-1) is a cell surface glycoprotein that belongs to the immunoglobulin superfamily, and its expression is dependent on cytokine stimulation. In the vascular system, VCAM-1 is expressed on activated endothelial cells, smooth muscle cells, and fibroblasts in a variety of pathological conditions, including atherosclerosis.2 3 4
In the VCAM-1 gene regulatory region, functional
transcription factor binding motifs have been reported, including
nuclear factor (NF)-B, stimulatory protein-1, interferon regulatory
factor, activator protein-1, and
GATA.5 6 7 8
GATA proteins are members of a zinc finger protein family of
transcription factors that recognize the consensus (A/T) GATA(A/G) and
related sequences.9 They are
essential for the differentiation and function of hematopoietic cells
and endothelial cells as well as fetal differentiation
of the cardiovascular
system.10 11 12
Although several lines of evidence have provided support for the
importance of the GATA element in the upstream promoter region of the
VCAM-1
gene,5 8 13 14
the specific regulatory effects exerted by the GATA factors on
endothelial gene expression have yet to be elucidated.
Recently, we developed a novel VCAM-1 inhibitor, K-7174,
which acts through a mechanism independent of NF-B
activity.15 K-7174 suppressed
the binding activity of GATA proteins in cytokine-stimulated
human umbilical vein endothelial cells (HUVECs), which
may be related to the anti–VCAM-1 induction effect of this drug. To
elucidate the roles of the GATA proteins on the regulation of
cytokine-mediated VCAM-1 induction in human
endothelial cells, we further undertook sequential
studies and found that multiple GATA proteins exhibit differing
responses to tumor necrosis factor- (TNF-) stimulation and play
important roles in the regulation of VCAM-1
induction.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cell Culture, RNA Preparation, and Northern Blot Analysis
HUVECs were purchased from Clonetics and cultured by EGM-2 medium containing 2% FCS (Clonetics). Three or 4 time-passaged cells were used for the experiments. HUVECs were stimulated with TNF-
(10 U/mL, Genzyme) for 4 hours. Total RNA was then isolated by
TRIZOL reagent (Life Technologies) according to the manufacturer’s
protocol and was used for poly(A)+ mRNA
isolation (Takara). The concentration of mRNA was determined by the
optical density at 260 nm. Two micrograms of mRNA was dissolved in 2.2
mol/L formaldehyde, denatured at 65°C for 15 minutes, and
electrophoresed in a 1% agarose gel containing 2.2 mol/L formaldehyde.
After transfer to nitrocellulose membranes (Hybond XL, Amersham
Pharmacia Biotech), the filters were hybridized with
2x106 cpm of
[-32P]dCTP-labeled probes per
milliliter. The GATA-2, GATA-3, and GATA-6 cDNA fragments used for the
probes were amplified from the HUVEC total RNA by reverse transcription
and polymerase chain reaction (PCR) performed with a GeneAmp RNA PCR
kit (PE Biosystems). The GATA-4 and GATA-5 cDNA fragments were
amplified from Multiple Choice cDNA (OriGene Technologies) by PCR. The
amplified fragments were as follows (nucleotide 1 is the A
of the ATG codon that encodes the initiator methionine in each cDNA):
GATA-2, bp 1 to 463 (463 nt), GATA-3, bp 226 to 639 (414 nt); GATA-4,
bp 956 to 1329 (374 nt); GATA-6, bp 1 to 682 (682 nt); and GAPDH, bp
903 to 1185 (283 nt). PCR amplification for the GATA-5 cDNA fragment
was performed as described
elsewhere.16 The hybridized
filters were washed and exposed to imaging screens
(Bio-Rad).
Electrophoretic Mobility Shift Assay
HUVECs were grown to confluence and were
stimulated by TNF- (10 U/mL) for 2 hours. Nuclear extract
preparation from HUVECs and electrophoretic mobility shift assay (EMSA)
were performed as described
previously.15 Binding
reactions were left on ice for 30 minutes, and the complexes were
resolved by electrophoresis on 3.5% nondenaturing
acrylamide gels in 0.25x Tris-borate-EDTA buffer. Gels
were dried and exposed to imaging screens (Bio-Rad). To ascertain the
binding to the GATA motif, the binding reaction was performed in the
presence of 100-fold unlabeled specific or nonspecific competitor DNA
fragments. Mutant unlabeled oligonucleotides with a
respective GATA sequence changed to TCGA were also used (Figure
I,
which can be accessed online at http://atvb.ahajournals.org). For
supershift assays, antibodies (1 µg) were added to reaction tubes
with the 32P-labeled probe, and the reaction
tubes were incubated on ice for 2 hours. Anti–GATA-2 was raised
against polypeptides in the N-terminal region of human GATA-2 via
subcutaneous injection into rabbits. Mouse anti–GATA-3 and goat
anti–GATA-6 antibodies were purchased from Santa Cruz
Biotechnology.
|
Plasmid Expression Vectors
The expression vectors for human GATA-2, human
GATA-3, and mouse GATA-6 have previously been
described.17 18 19
The expression vectors (2 µg/mL) were transfected to HUVECs by use of
TransIT-LT1 (Mirus). Twenty-four hours after transfection, cells were
stimulated with TNF- for 6 hours, and the cell surface expression of
VCAM-1 was analyzed by flow cytometry.
Flow Cytometric Analysis
Flow cytometric analysis was performed as
described previously.15
Briefly, HUVECs were harvested with the use of a cell scraper. After
incubation for 1 hour at 4°C with anti–VCAM-1 antibody (Genzyme),
anti–intercellular adhesion molecule-1 (anti–ICAM-1) antibody (R&D),
or mouse isotype control IgG (Pharmingen), cells were counterstained
with FITC-labeled anti-mouse IgG F(ab')2 (DAKO)
and were analyzed on an EPICS XL (Beckman Coulter) or a FACS
Calibur (Becton Dickinson).
Antisense
Oligonucleotides
Antisense phosphorothioate
oligodeoxynucleotides were designed against the
translational start region of
GATA-318 and
GATA-6.20 Design of the
GATA-2 antisense oligonucleotide has been previously
reported.21 As a control,
scrambled oligonucleotides randomizing the antisense
sequence were designed as well. The respective sequence of the
antisense oligonucleotides to GATA factors was as
follows: GATA-2, CAGCACGGCCGGGTGCGC; GATA-3, CGCCGTCACCTCCATGGCCTC; and
GATA-6, GGTCTGGTACATCTCCTCCG. Antisense or randomly scrambled
oligonucleotide was transfected to HUVECs with
TransIT-LT1. Twenty-four hours after transfection, cells were
stimulated with TNF- for 6 hours, and the cell surface expression of
VCAM-1 and ICAM-1 was analyzed by flow cytometry. To certify
the incorporation of the oligonucleotides by the cells,
oligonucleotides were labeled with FITC and transfected
to HUVECs as described above. Twenty-nine hours after the transfection,
cells were observed by fluorescence
microscopy.
Statistical Analysis
Results of the experimental studies are reported as
mean±SEM. Differences were analyzed by 1-way ANOVA followed by
the Fisher protected least significant difference
test.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Different mRNA Expression of GATA Factors in Response to TNF-
StimulationWe examined the expression of GATA factors in HUVECs and their responses to TNF-
stimulation by Northern blot
analysis. A previous study reported the existence of GATA-2 and
GATA-3 and the absence of GATA-1 in
HUVECs.22 As shown in
Figure 1
, GATA-6 mRNA was detected in addition to mRNA of
GATA-2 and GATA-3. GATA-4 mRNA could not be detected in HUVECs, in
spite of the fact that it was detected in the mouse heart (data not
shown). We also failed to detect GATA-5 mRNA in HUVECs. On TNF-
stimulation, GATA-6 mRNA was increased. In contrast, the mRNA
expression of GATA-3 declined. The mRNA expression of GATA-2 showed
only a slight increase. These results indicate that GATA-2, GATA-3, and
GATA-6 are present in human endothelial cells and
that each GATA factor exhibits a different response to TNF-
stimulation at the mRNA expression level.
Binding of GATA Proteins to the VCAM-1 Gene
Upstream Promoter Region
We examined the binding of nuclear proteins, prepared
from unstimulated or TNF-–stimulated HUVECs, to the 2 adjacent
putative GATA binding sequences located in the VCAM-1 gene upstream
promoter region (online Figure I) by EMSA. The binding specificity to
the GATA sequence was determined by using GATA sequence-mutated
oligonucleotides as a
32P-labeled probe. Specific binding to the
single GATA site was exhibited only by the 5'-GATA sequence in
unstimulated and TNF-–stimulated HUVECs
(Figure 2A). In a competition assay using
32P-labeled probes from the original
sequence (org in
Figure 2B and 2C) with unlabeled GATA mutant
oligonucleotides, the sequences containing the 5'-GATA
sequence (5G and org in
Figure 2B and 2C) diminished DNA binding, which confirmed
the importance of the 5'-GATA sequence for this activity. However,
3G, which contains the original 3'-GATA sequence and the mutated
5'-GATA sequence, did show an inhibitory effect on the
binding to the original sequence (org), indicating that the 3'-GATA
sequence is also used for the binding of nuclear proteins in the
presence of the binding to the 5'-GATA sequence. Mutant
oligonucleotides both of the 5'- and 3'-GATA sequences
(DM in
Figure 2B and 2C) did not compete for the DNA binding of
HUVEC nuclear proteins, indicating that there are no other sequences to
which nuclear proteins bind in the probe sequence. No change was
observed between the unstimulated and the TNF-–stimulated HUVECs in
the competitive binding patterns either by the 5'- or 3'-GATA mutant
oligonucleotides. These results indicate that the
5'-GATA sequence is the main sequence used for DNA binding, and the
binding to the 3'-GATA sequence is shown only when the 5'-GATA sequence
is also in use.
|
GATA Proteins Involved in the Binding to the
VCAM-1 Gene Upstream Promoter Region
To identify the GATA proteins involved in the binding
to the VCAM-1 gene upstream promoter region, we used specific
antibodies against GATA-2, GATA-3, and GATA-6. EMSA indicated that the
antibodies against GATA-2, GATA-3, and GATA-6 produced supershifted
bands of the GATA oligonucleotide
(Figure 3, arrowheads). The total amount of the binding
proteins, when the lanes were applied with the same amount of nuclear
extract from HUVECs, was slightly increased in response to TNF-
stimulation, and different patterns of the shifted bands were observed
between the unstimulated cells and the TNF-–stimulated cells. In
unstimulated cells, mainly GATA-2 and GATA-3 participated in the
binding to the GATA motif in the upstream promoter region of
VCAM-1 gene. In contrast, GATA-2 and GATA-6 participated in the DNA
binding in TNF-–stimulated HUVECs. These results show that the
DNA-binding profiles of GATA members change in response to TNF-
stimulation.
|
Role of GATA Proteins in the VCAM-1 Expression
Induced by TNF-
To test whether the increase of GATA-6 and the decrease
of GATA-3 mRNA expression on TNF- stimulation are related to the
VCAM-1 induction brought about by TNF-, the GATA-2, GATA-3, or
GATA-6 protein was overexpressed in HUVECs, and the expression of the
VCAM-1 protein was studied by flow cytometry. As shown in
Figure 4, a steady-state expression of VCAM-1 was not
observed, but in response to TNF- stimulation, expression was
markedly increased. Enhanced expression of GATA-2 and GATA-6
significantly (P<0.05 for
GATA-2 and P<0.01 for GATA-6)
increased the VCAM-1 induction by TNF-. In contrast, overexpression
of GATA-3 resulted in a significant suppression
(P<0.05) of VCAM-1 induction.
Because overexpression of neither GATA-2, GATA-3, nor GATA-6 protein
altered the induction of another cell adhesion molecule, ICAM-1, which
has no GATA motif in its gene-regulatory region (Figure II, which can
be accessed online at http://atvb.ahajournals.org), these effects of
GATA proteins can be seen to be VCAM-1 specific.
|
Suppression of VCAM-1 Expression by Antisense
Oligonucleotides to GATA Factors
To confirm the importance of GATA proteins for VCAM-1
gene induction, antisense oligonucleotides to GATA-2,
GATA-3, and GATA-6 were examined. Almost all cells incorporated
oligonucleotides at a concentration of 3 µg/mL by
antisense oligonucleotide transfection (Figure III,
which can be accessed online at http://atvb.ahajournals.org). Under
these conditions, the GATA-6 antisense
oligonucleotide exhibited the strongest dose-dependent
inhibitory effect on the VCAM-1 expression induced by
TNF-
(Table).
Antisense oligonucleotide to GATA-2 also inhibited the
VCAM-1 induction by TNF- significantly in the 3 µg/mL–treated
group (P<0.01), but the
suppression by antisense oligonucleotide to GATA-3 was
weak, and no dose dependence was observed. Again, none of these
oligonucleotides changed the ICAM-1 induction by
TNF-
(Table).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
In the present study, we have shown the involvement of multiple GATA proteins in the regulation of cytokine-mediated VCAM-1 induction in human endothelial cells. GATA proteins have been divided into 2 subgroups on the basis of their tissue distribution, ie, GATA-1, -2, and -3, which are found in hematopoietic cells, and GATA-4, -5, and -6, which are expressed in the heart and gut.10 11 GATA proteins are thought to be crucial for many endothelial genes expressed in endothelial cell–specific function, including VCAM-1, P-selectin, platelet and endothelial cell adhesion molecule-1, endothelial NO synthase, and von Willebrand factor.13 23 24 25 26 Although human GATA-2 was cloned as a binding protein to the preproendothelin-1 gene promoter GATA sequence in HUVECs,22 27 little has been demonstrated about the precise role of GATA family proteins in endothelial cells. Northern blot analysis has revealed that 3 GATA family proteins (GATA-2, GATA-3, and GATA-6) are active in HUVECs (Figure 1
) and has indicated GATA factor coexpression
patterns among the subgroups in endothelial cells. In
addition, TNF- stimulation resulted in an increase of the GATA-6 and
a decrease of the GATA-3 mRNA expression level. Certain
cytokines, such as insulin-like growth factor-1,
erythropoietin, or interleukin-2, have been reported to be capable of
inducing the expression of GATA
proteins,21 28 29
and the present study reveals that TNF- also regulates the mRNA
expression of the GATA factors.
The GATA sequences located in the upstream promoter region
of VCAM-1 gene are arranged as a palindromic GATA motif, to which GATA
factors can stably bind with their 2-finger
domains.30 In the case of the
GATA-binding motif in the upstream promoter region of VCAM-1 gene, the
5'-GATA sequence was primarily used for the DNA binding
(Figure 2). Competition assay showed that the 3'-GATA
sequence is a possible binding site in the event that the 5'-GATA
sequence is occupied by other factors. Specific antibodies against GATA
proteins in supershift assay indicated that GATA-2, GATA-3, and GATA-6
participate in the binding to the VCAM-1 gene GATA motif
(Figure 3). Furthermore, on TNF- stimulation, binding
profiles distinct from those in unstimulated cells emerged. The
increased amount of anti-GATA antibodies diminished the original band
and the supershifted band as well (data not shown). Because we used
polyclonal antibodies for the supershift assay, it is possible that a
part of the antibodies used for the assay inhibits the DNA binding of
GATA proteins. The usage of neither the 5'-GATA nor the 3'-GATA
sequence was altered by TNF- stimulation
(Figure 2). Thus, the change in the members of GATA proteins
in their binding motif as shown by supershift assay is thought to
result from the displacement of GATA proteins.
Enhanced expression of GATA-2 or GATA-6 resulted in the
augmentation of VCAM-1 induction, whereas that of GATA-3 resulted in a
suppression of TNF-–induced VCAM-1
(Figure 4). Experiments using antisense
oligonucleotides confirmed the importance of GATA-2 and
GATA-6 for the VCAM-1 induction in endothelial cells.
Antisense oligonucleotides either to GATA-2 or GATA-6
inhibited the VCAM-1 induction by TNF-
(Table).
Antisense oligonucleotides to GATA-3 also exhibited a
weak inhibition, but the inhibitory effect was not dose
dependent. Thus, the effect obtained by GATA-3 antisense
oligonucleotides is considered to be
nonspecific.
It has been shown that GATA-1 and GATA-2 have a positive and
negative regulatory role, respectively, in eosinophil granule major
basic protein gene transcription and that GATA-1 and GATA-2 can bind to
the same promoter GATA sequence
competitively.17 It is also
known that there are differences in the binding affinity for the
recognition sequences among the GATA proteins, which suggests the
possibility of different roles for different GATA proteins in the
transcription of target
genes.9 31 The
present study suggests that GATA-2 and GATA-6 positively regulate
VCAM-1 gene transactivation and also shows that the member switching
from GATA-2/GATA-3 to GATA-2/GATA-6 is related to the functional
regulation of VCAM-1 induction by TNF-. This interpretation fits
with our result that there was no apparent increase observed in the
total amount of binding to the GATA motif between the unstimulated and
the TNF-–stimulated cells compared with the marked augmentation of
VCAM-1 expression by TNF-.
The role of GATA-2 in the regulation of VCAM-1 induction
still remains unclear. There are 2 possibilities for the role of GATA-2
in the VCAM-1 induction. One possibility is that GATA-2 forms a
homodimer or a heterodimer complex with other GATA factors. The
formation of a homodimer or a heterodimer among GATA factors has been
reported.32 33 In
cardiac tissue, cooperative interaction between GATA-4 and GATA-6
regulates myocardial gene
expression.33 GATA-2 may form
a heterodimer with either GATA-3 or GATA-6, which leads to the
regulation of VCAM-1 transactivation. The other possibility is that
GATA-2 shares binding sites with GATA-3 or GATA-6. The EMSA results
suggest 2 possible GATA binding sites in the VCAM-1 gene upstream
promoter region. It is possible that GATA-2 and GATA-3 in unstimulated
cells or GATA-2 and GATA-6 in TNF-–stimulated cells use separate
GATA sites for DNA binding.
The formation of transcription factor complexes in addition to phosphorylation and acetylation has been reported to be involved in the activating mechanisms of GATA family proteins.29 34 35 36 37 38 39 40 The complex formation among transcription factors may be related to the functional changes of GATA proteins in cytokine-stimulated endothelial cells. Furthermore, it is possible that there are differences between GATA-3 and GATA-6 in their ability to interact with other transcription factors, which is related to the VCAM-1 gene induction.
It is well accepted that the activation of NF-B is
important in the induction of VCAM-1. However, it is difficult to
explain the cell-specific induction of certain molecules, such as
VCAM-1, only by NF-B activation, and it has been reported that full
TNF-–induced accumulation of the VCAM-1 transcript requires protein
synthesis.6 Our results (ie,
in unstimulated cells, overexpression of GATA-2 or GATA-6 did not
induce the VCAM-1 expression;
Figure 4) indicate the requirement of other factors in
addition to GATA-2 and/or GATA-6 for the VCAM-1 expression induced by
TNF-. Thus, it is likely that each transcriptional activity of the
factors, including GATA-3, GATA-6, and NF-B, is independently
controlled by various cytokines and that a combination of
transcription factors involving these factors regulates the induction
of the VCAM-1 gene. On the target genes of the GATA proteins, GATA may
act as a requisite factor for the specific expression of certain
endothelial functions, such as VCAM-1 induction.
Further study into the interaction of the GATA proteins in
cytokine-induced activation of VCAM-1 not only will provide
important insights into the mechanisms of the induction of adhesion
molecules but also will help to clarify the fundamental principles of
highly specified transcriptional
regulation.
|
Acknowledgments |
|---|
This work was supported by a grant from R&D Projects in Cooperation with Academic Institutions. We thank Kevin Boru for reviewing the manuscript. We also thank Chizuru Nagao and Chisa Shimizu for expert technical assistance.
Received December 7, 2000; accepted February 13, 2001.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
- Springer TA. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell. 1994;76:301–314.[Medline] [Order article via Infotrieve]
-
Nakashima Y, Raines
EW, Plump AS, Breslow JL, Ross R. Upregulation of VCAM-1 and ICAM-1 at
atherosclerosis-prone sites on the
endothelium in the apoE-deficient mouse.
Arterioscler Thromb Vasc Biol. 1998;18:842–851.
[Abstract/Free Full Text] - O’Brien KD, Allen MD, McDonald TO, Chait A, Harlan JM, Fishbein D, McCarty J, Ferguson M, Hudkins K, Benjamin CD. Vascular cell adhesion molecule-1 is expressed in human coronary atherosclerotic plaques. J Clin Invest. 1993;92:945–951.
- Morales-Ducret J, Wayner E, Elices MJ, Alvaro-Gracia JM, Zvaifler NJ, Firestein GS. Alpha 4/beta 1 integrin (VLA-4) ligands in arthritis: vascular cell adhesion molecule-1 expression in synovium and on fibroblast-like synoviocytes. J Immunol. 1992;149:1424–1431.[Abstract]
-
Iademarco MF,
McQuillan JJ, Rosen GD, Dean DC. Characterization of the promoter for
vascular cell adhesion molecule-1 (VCAM-1).
J Biol Chem. 1992;267:16323–16329.
[Abstract/Free Full Text] - Neish AS, Read MA, Thanos D, Pine R, Maniatis T, Collins T. Endothelial interferon regulatory factor 1 cooperates with NF-kappa B as a transcriptional activator of vascular cell adhesion molecule 1. Mol Cell Biol. 1995;15:2558–2569.[Abstract]
-
Neish AS, Khachigian
LM, Park A, Baichwal VR, Collins T. Sp1 is a component of the
cytokine-inducible enhancer in the promoter of vascular cell
adhesion molecule-1. J Biol
Chem. 1995;270:28903–28909.
[Abstract/Free Full Text] -
Neish AS, Williams
AJ, Palmer HJ, Whitley MZ, Collins T. Functional analysis of
the human vascular cell adhesion molecule 1 promoter.
J Exp Med. 1992;176:1583–1593.
[Abstract/Free Full Text] -
Ko LJ, Engel JD.
DNA-binding specificities of the GATA transcription factor family.
Mol Cell Biol. 1993;13:4011–4022.
[Abstract/Free Full Text] -
Shivdasani RA,
Orkin SH. The transcriptional control of hematopoiesis.
Blood. 1996;87:4025–4039.
[Free Full Text] -
Laverriere AC,
MacNeill C, Mueller C, Poelmann RE, Burch JB, Evans T. GATA-4/5/6, a
subfamily of three transcription factors transcribed in developing
heart and gut. J Biol
Chem. 1994;269:23177–23184.
[Abstract/Free Full Text] - Molkentin JD, Lu JR, Antos CL, Markham B, Richardson J, Robbins J, Grant SR, Olson EN. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell. 1998;93:215–228.[Medline] [Order article via Infotrieve]
- Lin JH, Zhu Y, Liao HL, Kobari Y, Groszek L, Stemerman MB. Induction of vascular cell adhesion molecule-1 by low-density lipoprotein. Atherosclerosis. 1996;127:185–194.[Medline] [Order article via Infotrieve]
-
Papi A, Johnston
SL. Respiratory epithelial cell expression of vascular cell adhesion
molecule-1 and its up-regulation by rhinovirus infection via NF-kappaB
and GATA transcription factors. J
Biol Chem. 1999;274:30041–30051.
[Abstract/Free Full Text] - Umetani M, Nakao H, Doi T, Iwasaki A, Ohtaka M, Nagoya T, Mataki C, Hamakubo T, Kodama T. A novel cell adhesion inhibitor, K-7174, reduces the endothelial VCAM-1 induction by inflammatory cytokines, acting through the regulation of GATA. Biochem Biophys Res Commun. 2000;272:370–374.[Medline] [Order article via Infotrieve]
-
Gao X, Sedgwick T,
Shi YB, Evans T. Distinct functions are implicated for the GATA-4, -5,
and -6 transcription factors in the regulation of intestine epithelial
cell differentiation. Mol Cell
Biol. 1998;18:2901–2911.
[Abstract/Free Full Text] -
Yamaguchi Y,
Ackerman SJ, Minegishi N, Takiguchi M, Yamamoto M, Suda T. Mechanisms
of transcription in eosinophils: GATA-1, but not GATA-2,
transactivates the promoter of the eosinophil granule major
basic protein gene. Blood. 1998;91:3447–3458.
[Abstract/Free Full Text] -
Ko LJ, Yamamoto M,
Leonard MW, George KM, Ting P, Engel JD. Murine and human T-lymphocyte
GATA-3 factors mediate transcription through a cis-regulatory element
within the human T-cell receptor delta gene enhancer.
Mol Cell Biol. 1991;11:2778–2784.
[Abstract/Free Full Text] - Katsuoka F, Motohashi H, Onodera K, Suwabe N, Engel JD, Yamamoto M. One enhancer mediates mafK transcriptional activation in both hematopoietic and cardiac muscle cells. EMBO J. 2000;19:2980–2991.[Medline] [Order article via Infotrieve]
- Suzuki E, Evans T, Lowry J, Truong L, Bell DW, Testa JR, Walsh K. The human GATA-6 gene: structure, chromosomal location, and regulation of expression by tissue-specific and mitogen-responsive signals. Genomics. 1996;38:283–290.[Medline] [Order article via Infotrieve]
- Labbaye C, Valtieri M, Barberi T, Meccia E, Masella B, Pelosi E, Condorelli GL, Testa U, Peschle C. Differential expression and functional role of GATA-2, NF-E2, and GATA-1 in normal adult hematopoiesis. J Clin Invest. 1995;95:2346–2358.
-
Dorfman DM, Wilson
DB, Bruns GA, Orkin SH. Human transcription factor GATA-2.
J Biol Chem. 1992;267:1279–1285.
[Abstract/Free Full Text] -
Pan J, McEver RP.
Characterization of the promoter for the human P-selectin gene.
J Biol Chem. 1993;268:22600–22608.
[Abstract/Free Full Text] -
Gumina RJ,
Kirschbaum NE, Piotrowski K, Newman PJ. Characterization of the
human platelet/endothelial cell adhesion molecule-1
promoter: identification of a GATA-2 binding element required for
optimal transcriptional activity.
Blood. 1997;89:1260–1269.
[Abstract/Free Full Text] -
Zhang R, Min
W, Sessa WC. Functional analysis of the human
endothelial nitric oxide synthase promoter.
J Biol Chem. 1995;270:15320–15326.
[Abstract/Free Full Text] -
Jahroudi N, Lynch
DC. Endothelial-cell-specific regulation of von
Willebrand factor gene expression.
Mol Cell Biol. 1994;14:999–1008.
[Abstract/Free Full Text] -
Lee ME, Temizer
DH, Clifford JA, Quertermous T. Cloning of the GATA-binding protein
that regulates endothelin-1 gene expression in
endothelial cells. J
Biol Chem. 1991;266:16188–16192.
[Abstract/Free Full Text] - Musaro A, McCullagh KJ, Naya FJ, Olson EN, Rosenthal N. IGF-1 induces skeletal myocyte hypertrophy through calcineurin in association with GATA-2 and NF-ATc1. Nature. 1999;400:581–585.[Medline] [Order article via Infotrieve]
-
Towatari M, May
GE, Marais R, Perkins GR, Marshall CJ, Cowley S, Enver T. Regulation of
GATA-2 phosphorylation by mitogen-activated
protein kinase and interleukin-3. J
Biol Chem. 1995;270:4101–4107.
[Abstract/Free Full Text] - Trainor CD, Omichinski JG, Vandergon TL, Gronenborn AM, Clore GM, Felsenfeld G. A palindromic regulatory site within vertebrate GATA-1 promoters requires both zinc fingers of the GATA-1 DNA-binding domain for high- affinity interaction. Mol Cell Biol. 1996;16:2238–2247.[Abstract]
- Yamagata T, Nishida J, Sakai R, Tanaka T, Honda H, Hirano N, Mano H, Yazaki Y, Hirai H. Of the GATA-binding proteins, only GATA-4 selectively regulates the human interleukin-5 gene promoter in interleukin-5-producing cells which express multiple GATA-binding proteins. Mol Cell Biol. 1995;15:3830–3839.[Abstract]
- Crossley M, Merika M, Orkin SH. Self-association of the erythroid transcription factor GATA-1 mediated by its zinc finger domains. Mol Cell Biol. 1995;15:2448–2456.[Abstract]
-
Charron F, Paradis
P, Bronchain O, Nemer G, Nemer M. Cooperative interaction between
GATA-4 and GATA-6 regulates myocardial gene expression.
Mol Cell Biol. 1999;19:4355–4365.
[Abstract/Free Full Text] -
Crossley M, Orkin
SH. Phosphorylation of the erythroid transcription
factor GATA-1. J Biol
Chem. 1994;269:16589–16596.
[Abstract/Free Full Text] - Boyes J, Byfield P, Nakatani Y, Ogryzko V. Regulation of activity of the transcription factor GATA-1 by acetylation. Nature. 1998;396:594–598.[Medline] [Order article via Infotrieve]
-
Blobel GA,
Nakajima T, Eckner R, Montminy M, Orkin SH. CREB-binding protein
cooperates with transcription factor GATA-1 and is required for
erythroid differentiation. Proc Natl Acad
Sci
U S A. 1998;95:2061–2066.
[Abstract/Free Full Text] - Durocher D, Charron F, Warren R, Schwartz RJ, Nemer M. The cardiac transcription factors Nkx2–5 and GATA-4 are mutual cofactors. EMBO J. 1997;16:5687–5696.[Medline] [Order article via Infotrieve]
- Tsang AP, Visvader JE, Turner CA, Fujiwara Y, Yu C, Weiss MJ, Crossley M, Orkin SH. FOG, a multitype zinc finger protein, acts as a cofactor for transcription factor GATA-1 in erythroid and megakaryocytic differentiation. Cell. 1997;90:109–119.[Medline] [Order article via Infotrieve]
-
Svensson EC, Tufts
RL, Polk CE, Leiden JM. Molecular cloning of FOG-2: a modulator of
transcription factor GATA-4 in cardiomyocytes.
Proc Natl Acad Sci
U S A. 1999;96:956–961.
[Abstract/Free Full Text] - Miaw SC, Choi A, Yu E, Kishikawa H, Ho IC. ROG, repressor of GATA, regulates the expression of cytokine genes. Immunity. 2000;12:323–333. [Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  H.-J. Sung, A. Yee, S. G. Eskin, and L. V. McIntire Cyclic strain and motion control produce opposite oxidative responses in two human endothelial cell types Am J Physiol Cell Physiol, July 1, 2007; 293(1): C87 - C94. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Wozniak, M. E. Boyer, J. A. Grass, Y. Lee, and E. H. Bresnick Context-dependent GATA Factor Function: COMBINATORIAL REQUIREMENTS FOR TRANSCRIPTIONAL CONTROL IN HEMATOPOIETIC AND ENDOTHELIAL CELLS J. Biol. Chem., May 11, 2007; 282(19): 14665 - 14674. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Khandekar, W. Brandt, Y. Zhou, S. Dagenais, T. W. Glover, N. Suzuki, R. Shimizu, M. Yamamoto, K.-C. Lim, and J. D. Engel A Gata2 intronic enhancer confers its pan-endothelia-specific regulation Development, May 1, 2007; 134(9): 1703 - 1712. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Inoue, M. Kobayashi, K. Yano, M. Miura, A. Izumi, C. Mataki, T. Doi, T. Hamakubo, P. C. Reid, D. A. Hume, et al. Histone Deacetylase Inhibitor Reduces Monocyte Adhesion to Endothelium Through the Suppression of Vascular Cell Adhesion Molecule-1 Expression Arterioscler. Thromb. Vasc. Biol., December 1, 2006; 26(12): 2652 - 2659. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-H. Woo, J.-H. Lim, and J.-H. Kim VCAM-1 upregulation via PKC{delta}-p38 kinase-linked cascade mediates the TNF-{alpha}-induced leukocyte adhesion and emigration in the lung airway epithelium Am J Physiol Lung Cell Mol Physiol, February 1, 2005; 288(2): L307 - L316. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. M. Dagia, N. Harii, A. E. Meli, X. Sun, C. J. Lewis, L. D. Kohn, and D. J. Goetz Phenyl Methimazole Inhibits TNF-{alpha}-Induced VCAM-1 Expression in an IFN Regulatory Factor-1-Dependent Manner and Reduces Monocytic Cell Adhesion to Endothelial Cells J. Immunol., August 1, 2004; 173(3): 2041 - 2049. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Minami, T. Murakami, K. Horiuchi, M. Miura, T. Noguchi, J.-i. Miyazaki, T. Hamakubo, W. C. Aird, and T. Kodama Interaction between Hex and GATA Transcription Factors in Vascular Endothelial Cells Inhibits flk-1/KDR-mediated Vascular Endothelial Growth Factor Signaling J. Biol. Chem., May 14, 2004; 279(20): 20626 - 20635. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Han, P. J. Boyd, S. Colgan, J. A. Madri, and T. L. Haas Transcriptional Up-regulation of Endothelial Cell Matrix Metalloproteinase-2 in Response to Extracellular Cues Involves GATA-2 J. Biol. Chem., November 28, 2003; 278(48): 47785 - 47791. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. C. Aird The role of the endothelium in severe sepsis and multiple organ dysfunction syndrome Blood, May 15, 2003; 101(10): 3765 - 3777. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Peng and N. Jahroudi The NFY Transcription Factor Inhibits von Willebrand Factor Promoter Activation in Non-endothelial Cells through Recruitment of Histone Deacetylases J. Biol. Chem., February 28, 2003; 278(10): 8385 - 8394. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Minami and W. C. Aird Thrombin Stimulation of the Vascular Cell Adhesion Molecule-1 Promoter in Endothelial Cells Is Mediated by Tandem Nuclear Factor-kappa B and GATA Motifs J. Biol. Chem., December 7, 2001; 276(50): 47632 - 47641. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||