© 2001 American Heart Association, Inc.
Atherosclerosis and Lipoproteins |
Enzymatically Degraded LDL Preferentially Binds to CD14high CD16+ Monocytes and Induces Foam Cell Formation Mediated Only in Part by the Class B Scavenger-Receptor CD36
From the Institute of Clinical Chemistry and Laboratory Medicine, University of Regensburg, Regensburg, Germany.
Correspondence to Prof Dr Gerd Schmitz, Institute for Clinical Chemistry and Laboratory Medicine, University of Regensburg, Franz-Josef-Strauß-Allee 11, 93053 Regensburg, Germany. E-mail gerd.schmitz{at}klinik.uni-regensburg.de
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Heterogeneity of peripheral blood monocytes is characterized by specific patterns in the membrane expression of Fc
-receptor III
(FcRIII/CD16) and the lipopolysaccharide receptor (LPS
receptor CD14), allowing discrimination of distinct subpopulations. The
aim was to analyze the correlation of these phenotypic
differences to the early interaction of freshly isolated monocytes with
modified lipoproteins by the use of either enzymatically degraded low
density lipoprotein (E-LDL), acetylated low density lipoprotein
(ac-LDL), oxidized low density lipoprotein (ox-LDL), or native low
density lipoprotein. Highest E-LDL binding was observed on
CD14high CD16+
monocytes as determined by flow cytometry, suggesting a selective
interaction of E-LDL with distinct subpopulations of monocytes. E-LDL
induced rapid foam cell formation both in predifferentiated
monocyte-derived macrophages and, in contrast to ac-LDL or
ox-LDL, also in freshly isolated peripheral blood
monocytes. This was accompanied by upregulation of the 2 class B
scavenger receptors CLA-1/SR-BI (CD36 and LIMPII
Analogous-1/scavenger receptor type B class I) and CD36. Cellular
binding and uptake of E-LDL was neither competed by ac-LDL nor the
class A scavenger-receptor inhibitor polyinosinic acid but
was partially inhibited by an excess of ox-LDL. In predifferentiated
monocyte-derived macrophages, an anti-CD36 antibody inhibited
cellular binding and uptake of E-LDL by 
20%, suggesting that
recognition of these hydrolase-modified low density lipoprotein
particles is mediated only in part by the class B scavenger receptor
CD36.
Key Words: scavenger receptors • CD36 • enzymatically degraded LDL • atherogenesis
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Atherosclerotic lesions are characterized by the presence of macrophage foam cells derived from peripheral blood monocytes. Peripheral blood monocytes are phenotypically different with respect to membrane expression of Fc
-receptor III
(FcRIII/CD16) and the lipopolysaccharide receptor (LPS
receptor/CD14), allowing discrimination of distinct
subpopulations.1 The impact on
atherogenicity is as yet unknown. Within the vessel wall, the
transformation of monocytes to macrophage foam cells may derive
from the cellular uptake of different forms of chemically modified
lipids and lipoproteins. Partial hydrolysis of lipoproteins by the
hydrolytic host defense machinery, such as enzymatically degraded LDL
(E-LDL), transforms lipoproteins to an atherogenic
moiety.2 3 4
Other lipoprotein modifications considered as relevant in atherogenesis
include oxidized LDL
(ox-LDL),5 advanced glycation
end products,6 LDL
modified by phospholipase
A2,7
and aggregated LDL.8 Cellular
uptake of these lipids and lipoproteins is considered to be mediated by
charge and motif receptors directly recognizing nonopsonized
ligands. Despite increasing knowledge about the mechanisms involved in foam cell formation of predifferentiated monocyte-derived macrophages, little is known about the interaction of freshly isolated monocytes with modified lipoproteins. In the present study, we demonstrate the correlation of blood monocyte heterogeneity to the cellular interaction with E-LDL. Furthermore, the present study shows that E-LDL, compared with acetylated LDL (ac-LDL) and ox-LDL, is more potent in cholesterol loading of freshly isolated peripheral blood monocytes and predifferentiated monocyte-derived macrophages. Cellular uptake of E-LDL leads to upregulation of class B scavenger receptors, and CD36 is involved only in part in E-LDL uptake.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Preparation of LDL
Human native LDL (1.006 mg/mL<density<1.063 mg/mL) was isolated from the plasma of healthy blood donors by sequential preparative ultracentrifugation in KBr gradients according to Lindgren et al,9 followed by extensive dialysis and filter sterilization. Protein concentrations were determined by use of Lowry’s method.
Chemical and Enzymatic Modification of
LDL
Acetylation of LDL was performed
according to the standard
protocol.10 Extensive
oxidative modification of LDL was performed according to published
protocols11 by dialyzing
purified LDL fractions (1 mg of protein per milliliter) against 5
µmol/L CuSO4. Enzymatic degradation of LDL was
performed as described.3
Briefly, LDL was diluted to 2 mg/mL protein in HEPES buffer (20
mmol/L HEPES, 150 mmol/L NaCl, and 2 mmol/L
CaCl2, pH 7.0). Enzyme treatment was conducted
with trypsin (6.6 µg/mL, Sigma) and cholesterol esterase
(40 µg/mL, Roche Biochemica) for 6 to 8 hours at 37°C.
Subsequently, the pH of the solution was adjusted to 5.5 by addition of
MES buffer, pH 5.0. Finally, neuraminidase (79 mU/mL, Behring) and
magnesium ascorbate solution (30 mg/mL) were added for 14 hours at
37°C. The absence of oxidation products in E-LDL was verified by
the determination of thiobarbituric acid–reactive substances to
quantify lipid peroxidation
products.12 Modified
lipoproteins were stored at 4°C and used within a week. During LDL
preparation and subsequent modification, general precautions were taken
to avoid LPS contamination. The latter was excluded by
Limulus endotoxin assay
(Kinetic-QCL, BioWhittaker).
Monocyte Isolation and Cultivation
Human peripheral blood leukocytes from
healthy normolipidemic volunteers were isolated by leukapheresis in a
Spectra cell separator (Gambro BCT) and subsequent counterflow
centrifugation as described
elsewhere.13 To guarantee
viability of the cells with minimal activation, isolated monocytes were
cultured on Ultra Low Attachment Surfaces (Costar) in
macrophage serum-free medium (Life Technologies) supplemented
with monocyte colony–stimulating factor (M-CSF, 50 ng/mL, R&D Systems)
for up to 7 days as described
previously.14 Cells were
detached by rinsing the Costar Ultra Low Attachment Surfaces with PBS.
Each set of experiments was performed with cell batches from the same
donor.
Labeling of Lipoproteins with DiI
Five microliters of a 3 mg/mL solution of
1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine
perchlorate (DiI, Sigma) dissolved in dimethyl sulfoxide was mixed with
500 µL lipoprotein-deficient serum. Subsequent to lipoprotein
modification, 500 µL of lipoprotein solution (1 mg/mL) was
added.15 After 12 hours of
incubation at 37°C, DiI-labeled lipoprotein solutions were separated
from unbound chromophore by ultracentrifugation in KBr
gradients (density <1.063 mg/mL), followed by extensive
dialysis.
Binding and Uptake of DiI-Labeled
Lipoproteins
For binding experiments, monocytes were isolated from
heparinized blood samples of healthy volunteers (aged 20 to 35 years)
by using Histopaque 1077 (Sigma). Cells (106
per milliliter) were incubated with labeled lipoproteins (5 µg/mL)
for 60 minutes on ice in macrophage media containing 0.5% BSA,
washed twice with PBS, and immunophenotypically counterstained for
CD14, CD16, and CD45 as described below.
For uptake experiments, 4-day cultured monocytes
(106 cells per milliliter) were incubated
with labeled lipoproteins (5 µg/mL) and potential competitors (see
Results) for 2 hours at 37°C in 1 mL macrophage media
containing 0.5% BSA. For blocking experiments, monocytes were
preincubated for 15 minutes at room temperature with saturating
concentrations (0.5 µg/106 cells) of a
monoclonal mouse antibody to CD36 (IgM, 
; clone CB38
[NL07])16 or equal amounts
of an irrelevant control antibody (mouse monoclonal IgM, ; clone
DAK-GO8;
Table
)
before addition of the labeled lipoproteins. Cells were washed twice
with PBS and immunophenotypically counterstained for CD45. The
presented mean fluorescence intensity of DiI-labeled
cells was calculated by subtracting nonspecific fluorescence
intensity (with 50-fold excess of unlabeled analogue) from total
values.
|
Staining for Cell Surface
Immunofluorescence and Flow Cytometric
Analysis
Immunostaining and flow cytometry
were performed as described
previously.1 DiI
fluorescence was measured on channel 2. Dead cells were
identified by propidium iodide staining. The monoclonal antibodies used
are listed in the
Table
.
Analysis of Cellular Lipid Content
and Composition
Cells were washed twice with PBS and lysed in 0.2%
SDS, and lipids were extracted according to the method of Bligh
and Dyer (1959). Extracts were analyzed by
high-performance thin-layer chromatography as
described.17
Isolation of RNA and Northern Blot
Analysis
Total cellular RNA was isolated by the guanidine
isothiocyanate–cesium chloride technique. Total RNA (10 µg) was
separated through a 1.2% agarose gel containing 6% formaldehyde and
blotted onto nylon membranes. After cross-linking by UV irradiation
(Stratalinker model 1800, Stratagene), the membranes were hybridized
with a cDNA probe spanning nucleotides 758 to 1380 of the
CLA-1 (CD36 and LIMPII Analogous-1) cDNA or a CD36-specific probe
amplified by reverse transcription–polymerase chain reaction by using
the primers CD36 forward (5'GCTTAACACTAATTCACCTCCTGAACAAG) and
CD36 reverse (5'GAAGTTACATATTAGGCCATATATAT). The probes were
radiolabeled with [
-32P]dCTP by use of
an Oligolabeling kit (Pharmacia). Hybridization and washing of the
membrane were performed according to the manufacturer’s
recommendations. The blots were stripped and subsequently hybridized
with a human GAPDH probe (Clontech).
Western Blot Analysis
Cells were harvested, and total protein or cell
membranes were isolated and used for detection of CLA-1 expression.
Equal loading was ensured by applying the same number of cells for
protein isolation. The monoclonal antibody (see
Table)
was used at a 1:300 dilution in 5% nonfat dry milk in PBS and
incubated at room temperature for 2 hours. The secondary
peroxidase-conjugated anti-mouse antibody (Sigma) was diluted 1: 1000.
Detection of the immune complexes was carried out with the ECL Western
blot detection system (Amersham).
Statistical Analysis
Results are presented as mean±SD. The
significance of differences between fluorescence intensities or
lipid contents was determined by the Student
t test for paired samples. All
calculations were performed with the use of SPSS 9.0
software.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Lipid Composition of Modified Lipoproteins
To compare the lipid composition of the lipoproteins after the different chemical and enzymatic treatments, aliquots of LDL from the same donor were used for modifications and subsequently analyzed for cellular lipid content by high-performance thin-layer chromatography. LDL, ac-LDL, and ox-LDL showed similar unesterified cholesterol (UC)/esterified cholesterol (EC) ratios of 0.64±0.17, 0.66±0.16, and 0.74±0.23, respectively. However, E-LDL contained mostly UC with a UC/EC ratio >7 ±0.98 (n=4), reflecting the treatment with cholesterol ester hydrolase. Ratios of total cholesterol to protein were moderately reduced by enzymatic treatment (3015±864 nmol/mg of protein) and acetylation (2791±1080 nmol/mg of protein), with stronger reduction by oxidation (1959±480 nmol/mg of protein), compared with native LDL (3934±1388 nmol/mg of protein), suggesting an unspecific degradation and or transformation of lipids through enzymatic or chemical treatment. Compared with native LDL, all modified lipoproteins displayed a slight reduction in phosphatidylcholine (PC) content. Ac-LDL and ox-LDL contained small amounts, 14±17 and 16±13 µg lyso-PC/mg of protein, respectively. However, E-LDL contained 77±14 µg lyso-PC/mg protein (n=3).
E-LDL, but Not Ac-LDL or Ox-LDL, Induces Foam
Cell Formation in Freshly Isolated Peripheral Blood
Monocytes
Freshly isolated peripheral blood monocytes
showed marked differences in lipoprotein uptake for the various
modified lipoproteins. Incubation with ac-LDL or ox-LDL (100 µg
protein/mL) for 72 hours did not result in a significantly higher
accumulation of UC and EC compared with incubation with native LDL (100
µg/mL,
Figure 1A and 1B). The cellular content of
triglycerides (TGs) was not influenced by LDL, ac-LDL, or
ox-LDL compared with incubations without lipoproteins (not shown). In
contrast, incubation with E-LDL led to a linear dose- and
time-dependent nonsaturable increase of UC, EC
(Figure 1A and 1B), and TGs (not shown) even at this early
stage of monocyte differentiation.
|
To investigate whether lipid uptake and accumulation was
correlated to phagocytic differentiation, additional loading
experiments were performed with monocyte-derived macrophages
predifferentiated for 4 days in serum-free medium supplemented with
M-CSF. Single treatment of the cells with either ac-LDL or ox-LDL (100
µg protein/mL) resulted in modest cellular accumulation of UC and EC
after 24 to 48 hours of incubation
(Figure 1C and 1D). The cellular content of TGs was slightly
lower than for cells incubated in the presence of LDL (not shown).
However, treatment of the cells with E-LDL led to a striking dose- and
time-dependent saturable increase of UC, EC
(Figure 1C and 1D), and TGs (not shown). The enzyme cocktail
including trypsin, cholesterol ester hydrolase, and
neuraminidase did not influence cellular protein mass and lipid
content. Morphological evidence that monocytes treated with E-LDL
indeed developed to foam cells was provided by lipid staining with oil
red O. Less than 0.5% of cells treated for 72 hours with native LDL,
E-LDL, ac-LDL, or ox-LDL underwent apoptosis, as demonstrated
by annexin V fluorescein isothiocyanate staining (not
shown).
Preferential Binding of DiI-E-LDL to
CD14high CD16+
Monocytes (MNP 2) and Coexpression of Potentially Involved
Receptors
Different populations of peripheral
blood monocytes were discriminated by flow cytometry with respect to
their expression pattern of the LPS receptor/CD14 and FcRIII/CD16a,
with CD14high
CD16- MNPs (mononuclear phagocytes) as the
largest subpopulation (MNP 1,
Figure 2A). The highest DiI-E-LDL binding was observed on
CD14high CD16+
monocytes (MNP 2); this occurrence was the result of an increased
fraction of positive cells and higher DiI fluorescence per
cell. The lowest binding was observed on
CD14low CD16-
monocytes (MNP 4,
Figure 2B). In the presence of EDTA (2 mmol/L), binding
of DiI-E-LDL to monocytes was completely abolished, suggesting a
Ca2+- or
Mg2+-dependent interaction (not
shown).
|
In an attempt to identify potential receptor candidates that
might be involved in E-LDL binding on peripheral blood
monocyte subpopulations, we performed a quantitative analysis
of cellular expression densities of receptors related to lipoprotein
binding and uptake. This approach revealed a marked
heterogeneity with respect to the absolute number of
surface molecules per cell for the different receptors. In general, the
highest values were observed for CD36
(Figure 2E), whereas the expression of CLA-1/SR-B1 was near
the detection limit on all monocyte subpopulations (not shown).
Receptors with a significantly higher number of surface molecules per
cell on MNP 2 were Fc -receptor II (FcRII/CD32,
Figure 2D) and LRP (low-density lipoprotein
receptor-related protein)/CD91
(Figure 2F), whereas the expression patterns of CD36
(Figure 2E) and Fc -receptor I (FcRI/CD64
(Figure 2C) were only partially congruent with the DiI-E-LDL
binding pattern
(Figure 2B).
E-LDL, but Not Ac-LDL or Ox-LDL, Induces
Upregulation of Class B Scavenger Receptors CLA-1/SRB-1 and
CD36
The different potency of the various lipoprotein
modifications to induce foam cell formation was correlated with
differences in class B surface receptor expression during in vitro
differentiation
(Figure 3). As a first step, we assessed the effects of
phagocytic differentiation in the presence of M-CSF on surface receptor
expression. After an incubation period of 3 days, receptor expression
of CD36 and CLA-1/SR-BI (scavenger receptor type B class I) increased
(Figure 3A and 3D). Freshly isolated monocytes were then
analyzed after 24 and 72 hours of incubation with LDL (100
µg/mL), ac-LDL (100 µg/mL), ox-LDL (100 µg/mL), and
E-LDL.14 With consideration
of the stronger effects of E-LDL on foam cell formation
(Figure 1), a concentration of 40 µg/mL was selected for
analysis
(Figure 3B and 3E). Different effects of the various
lipoprotein modifications were observed in particular after 72 hours of
incubation. Surface expression of CD36, which is already highly
expressed on peripheral blood monocytes
(Figure 2E) and strongly upregulated during in vitro
differentiation in the presence of M-CSF
(Figure 3A), was further upregulated in E-LDL–treated and
LDL-treated freshly isolated monocytes but downregulated in
ac-LDL–treated and ox-LDL–treated cells
(Figure 3B). These data were corroborated by Northern blot
analysis showing upregulation of CD36 mRNA in E-LDL–treated
and LDL-treated freshly isolated monocytes after only 24 hours
(Figure 3C). The expression of CLA-1/SR-BI, which was hardly
detectable on peripheral blood monocytes (not shown), was
significantly upregulated in the presence of E-LDL but not LDL, ac-LDL,
or ox-LDL
(Figure 3E). These data were confirmed by Western blot
analysis demonstrating CLA-1/SR-BI upregulation in particular
within the membrane fraction
(Figure 3F). No differences could be observed at the mRNA
level (not shown).
|
Binding and Uptake of E-LDL Is Neither Competed
by Ac-LDL nor by the Scavenger-Receptor Inhibitor
Polyinosinic Acid but Is Partially Inhibited by an Excess of Ox-LDL and
a Monoclonal Antibody Against CD36
To investigate whether the uptake of E-LDL was also
mediated by scavenger receptors known to be involved in the uptake of
ac-LDL or ox-LDL, competition experiments were performed with
predifferentiated monocytes in the presence of DiI-labeled modified
lipoproteins and various concentrations of unlabeled modified
lipoproteins
(Figure 4). Whereas ac-LDL competed the binding and uptake of
DiI-ac-LDL with exponential saturation characteristics, the binding and
uptake of DiI-E-LDL was competed by its unlabeled analogue with linear
dose-response characteristics and was completely inhibited at 50-fold
excess of unlabeled E-LDL. Ox-LDL, but not ac-LDL, partially competed
with DiI-E-LDL
(Figure 4A). Native LDL does not compete for DiI-E-LDL (not
shown). Polyinosinic acid, a class A scavenger-receptor
inhibitor, completely inhibited the uptake of DiI-ac-LDL
but not of DiI-E-LDL
(Figure 4B). To discriminate between surface-bound and
internalized DiI-E-LDL, fluorescence of only
membrane-associated but not cytoplasmic DiI was quenched with trypan
blue. Mean DiI fluorescence was reduced by 60%, indicating
that 40% of the fluorescence was derived from intracellular
DiI-labeled lipoproteins (not shown).
|
When cells were preincubated with CB38 (NL07),
a monoclonal antibody directed against the ox-LDL binding site
of CD36,16 the binding/uptake
of DiI-E-LDL was reduced by 20%. Incubation with a control mouse
IgM did not result in a reduction of mean DiI fluorescence
(Figure 4C).
To investigate whether the uptake of E-LDL, ac-LDL, and ox-LDL is mediated by phagocytosis and/or patocytosis,18 lipid-loading experiments were performed in the presence of 4 µg/mL cytochalasin D. When predifferentiated monocyte-derived macrophages were incubated with 100 µg/mL ac-LDL or ox-LDL, UC and EC accumulation was reduced compared with accumulation in controls receiving solvent (dimethyl sulfoxide) without cytochalasin D. TG content remained unchanged. In the case of E-LDL, cytochalasin D inhibited the accumulation of EC but not UC (not shown).
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Previously, we were able to demonstrate at least 4 different subpopulations of peripheral blood monocytes (MNPs 1 to 4) that differ by cellular expression densities of antigens involved in extravasation, phagocytosis, scavenging, lipoprotein metabolism, differentiation, and the inflammatory response.1 In the present study, we demonstrate that monocytes with a high expression of LPS receptor/CD14 and Fc
RIII/CD16a (CD16+)
display enhanced binding of E-LDL. Furthermore, we demonstrate that
E-LDL induces foam cell formation (even in freshly isolated
peripheral blood monocytes) that exceeds the effects of
ac-LDL or ox-LDL. The possible physiological in
vivo significance becomes evident from the fact that E-LDL shows
extensive extracellular deposition even in the earliest stages of human
atherosclerotic lesions accompanying the onset of monocyte
infiltration.4 Scavenger receptors with charge and motif recognition are well known to be involved in the uptake of modified lipoproteins, in particular, ac-LDL and ox-LDL. Class A scavenger receptors show a broad binding of polyanions, including ac-LDL,19 whereas ligands for class B scavenger receptors are long-chain fatty acids20 and anionic phospholipids, such as phosphatidylserine or phosphatidylinositol.21 Our competition experiments (performed in the presence of labeled and unlabeled modified lipoproteins) and the dependence of binding on Ca2+ or Mg2+ suggest specific interaction of E-LDL with a limited number of binding sites. Furthermore, the experiments performed in the presence of polyinosinic acid suggest that among the scavenger receptors, class B rather than class A or the endothelial cell–specific scavenger receptor LOX-122 is involved in the cellular uptake of E-LDL. Finally, the blocking experiments revealed that the cellular uptake of E-LDL is mediated to a minor extent by the class B scavenger receptor CD36. CD36 was initially characterized as a hydrophobic membrane glycoprotein on the surface of platelets.23 Expression of human CD36 in CD36-deficient cells results in specific and high-affinity binding of ox-LDL, followed by internalization and degradation.24 Hydrolase-modified lipoproteins, such as E-LDLs, are obviously also ligands for CD36, as demonstrated further by the partial inhibition of E-LDL binding and uptake by an excess of ox-LDL. Very recently, we were able to demonstrate that LPS and ceramide induced coassociation of LPS receptor CD14, complement receptor 3 (CD11b/CD18), CD36, and a decay accelerating factor (CD55; A. Götz, E. Orsó, M. Kapinsky, M. Reil, P. Nagy, A. Bodnár, I. Spreitzer, G. Liebisch, W. Drobnik, K. Gempel, et al, unpublished data, 2001). Therefore, the clustering of signaling-competent receptors may provide an interesting mechanism by which different ligands induce distinct cellular processes in sepsis and cardiovascular disease.
In the present study, LDL and E-LDL potentiated the upregulation of CD36 expression, whereas ac-LDL and ox-LDL had the opposite effect. Given the lipid uptake data, this suggests that lipid uptake alone has little to do with this effect, inasmuch as lipid uptake from LDL is not significantly different from lipid uptake from ac-LDL and ox-LDL.
Like CD36, CLA-1/SR-BI was upregulated on E-LDL–loaded freshly isolated monocytes, suggesting an autoregulatory loop for enhanced lipid uptake and also a link between this modified lipoprotein and HDL metabolism. CLA-1/SR-BI has recently been identified to bind HDL and mediate the uptake of HDL.25 In line with our results obtained in vitro, immunohistochemical analysis showed that CLA-1/SR-BI is present in foam cells in human aortic atherosclerotic lesions.26
The mechanism of the different regulation of CD36 and CLA-1/SR-BI by native and modified lipoproteins remains unclear. It could be that acetylation or oxidation prevents the receptor interactions or that the expression of class B scavenger receptors is differentially regulated by cellular cholesterol content at the transcriptional level. Finally, part of the LDL (or LDL modified during cell culture) might elicit effects similar to those of E-LDL.
In monocyte-derived macrophages, interaction of modified lipids and lipoproteins with specific receptors is supposed to be the prerequisite for uptake into the surface-connected compartments, a process different from phagocytosis,18 resulting in the uptake and storage of material within compartments that remain open to the extracellular space. Sequestration into the surface-connected compartment allows the macrophage to store large amounts of aggregated LDLs before they are further processed.18 In our experiments, cytochalasin D selectively inhibited E-LDL–induced EC accumulation, whereas no inhibition of UC accumulation was observed, suggesting that cytochalasin D blocked the uptake of E-LDL by monocyte-derived macrophages but not their binding to the cell surface. Demonstration of the prevention of lipoprotein degradation by cytochalasin D would clearly be of importance in future studies.
Overall, the present study implicates a correlation of blood monocyte heterogeneity with early mechanisms of foam cell formation induced by E-LDL. The main receptor(s) involved in E-LDL binding to peripheral blood monocytes remains to be elucidated. However, the cellular uptake of E-LDL leads to the upregulation of class B scavenger receptors, and CD36 is also involved to a minor extent in the uptake of E-LDL.
|
Acknowledgments |
|---|
The authors thank Edeltraud Krepler for expert technical assistance.
Received December 22, 2000; accepted March 16, 2001.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Rothe G, Gabriel H, Kovacs E, Klucken J, Stohr J, Kindermann W, Schmitz G. Peripheral blood mononuclear phagocyte subpopulations as cellular markers in hypercholesterolemia. Arterioscler Thromb Vasc Biol. 1996;16:1437–1447.
2.
Seifert PS, Hugo F,
Tranum-Jensen J, Zahringer U, Muhly M, Bhakdi S. Isolation and
characterization of a complement-activating lipid extracted from human
atherosclerotic lesions. J Exp
Med. 1990;172:547–557.
3.
Bhakdi S, Dorweiler
B, Kirchmann R, Torzewski J, Weise E, Tranum-Jensen J, Walev I, Wieland
E. On the pathogenesis of atherosclerosis: enzymatic
transformation of human low density lipoprotein to an atherogenic
moiety. J Exp Med. 1995;182:1959–1971.
4.
Torzewski M, Klouche
M, Hock J, Messner M, Dorweiler B, Torzewski J, Gabbert HE, Bhakdi S.
Immunohistochemical demonstration of enzymatically modified human LDL
and its colocalization with the terminal complement complex in the
early atherosclerotic lesion. Arterioscler
Thromb Vasc Biol. 1998;18:369–378.
5.
Steinberg D, Lewis
A. Conner Memorial Lecture: oxidative modification of LDL and
atherogenesis. Circulation. 1997;95:1062–1071.
6. Makita Z, Yanagisawa K, Kuwajima S, Bucala R, Vlassara H, Koike T. The role of advanced glycosylation end-products in the pathogenesis of atherosclerosis. Nephrol Dial Transplant. 1996;11(suppl 5):31–33.
7. Hurt-Camejo E, Camejo G. Potential involvement of type II phospholipase A2 in atherosclerosis. Atherosclerosis. 1997;132:1–8.[Medline] [Order article via Infotrieve]
8.
Khoo JC, Miller E,
McLoughlin P, Steinberg D. Enhanced macrophage uptake of low
density lipoprotein after self-aggregation.
Arteriosclerosis. 1988;8:348–358.
9. Lindgren FT, Adamson GL, Jenson LC, Wood PD. Lipid and lipoprotein measurements in a normal adult American population. Lipids. 1975;10:750–756.[Medline] [Order article via Infotrieve]
10.
Goldstein JL, Ho
YK, Basu SK, Brown MS. Binding site on macrophages that
mediates uptake and degradation of acetylated low density
lipoprotein, producing massive cholesterol deposition.
Proc Natl Acad Sci
U S A. 1979;76:333–337.
11.
Wieland E,
Parthasarathy S, Steinberg D. Peroxidase-dependent metal-independent
oxidation of low density lipoprotein in vitro: a model for in vivo
oxidation? Proc Natl Acad Sci
U S A. 1993;90:5929–5933.
12.
Steinbrecher UP,
Parthasarathy S, Leake DS, Witztum JL, Steinberg D. Modification of low
density lipoprotein by endothelial cells involves lipid
peroxidation and degradation of low density lipoprotein phospholipids.
Proc Natl Acad Sci
U S A. 1984;81:3883–3887.
13.
Muller G, Kerkhoff
C, Hankowitz J, Pataki M, Kovacs E, Lackner KJ, Schmitz G. Effects of
purinergic agents on human mononuclear phagocytes are differentiation
dependent: implications for atherogenesis.
Arterioscler Thromb. 1993;13:1317–1326.
14.
Stohr J, Schindler
G, Rothe G, Schmitz G. Enhanced upregulation of the Fc gamma receptor
IIIa (CD16a) during in vitro differentiation of ApoE4/4 monocytes.
Arterioscler Thromb Vasc Biol. 1998;18:1424–1432.
15.
Pitas RE,
Innerarity TL, Weinstein JN, Mahley RW. Acetoacetylated
lipoproteins used to distinguish fibroblasts from macrophages
in vitro by fluorescence microscopy.
Arteriosclerosis. 1981;1:177–185.
16. Yamaguchi A, Yamamoto N, Akamatsu N, Saido TC, Kaneda M, Umeda M, Tanoue K. PS-liposome and ox-LDL bind to different sites of the immunodominant domain (#155-183) of CD36: a study with GS95, a new anti-CD36 monoclonal antibody. Thromb Res. 2000;97:317–326.[Medline] [Order article via Infotrieve]
17. Schmitz G, Assmann G, Bowyer DE. A quantitative densitometric method for the rapid separation and quantitation of the major tissue and lipoprotein lipids by high-performance thin-layer chromatography, I: sample preparation, chromatography, and densitometry. J Chromatogr. 1984;307:65–79.[Medline] [Order article via Infotrieve]
18.
Kruth HS, Zhang
WY, Skarlatos SI, Chao FF. Apolipoprotein B stimulates formation of
monocyte-macrophage surface-connected compartments and mediates
uptake of low density lipoprotein-derived liposomes into these
compartments. J Biol Chem. 1999;274:7495–7500.
19. Yamada Y, Doi T, Hamakubo T, Kodama T. Scavenger receptor family proteins: roles for atherosclerosis, host defence and disorders of the central nervous system. Cell Mol Life Sci. 1998;54:628–640.[Medline] [Order article via Infotrieve]
20.
Abumrad NA,
el-Maghrabi MR, Amri EZ, Lopez E, Grimaldi PA. Cloning of a rat
adipocyte membrane protein implicated in binding or transport of
long-chain fatty acids that is induced during preadipocyte
differentiation: homology with human CD36.
J Biol Chem. 1993;268:17665–17668.
21.
Rigotti A, Acton
SL, Krieger M. The class B scavenger receptors SR-BI and CD36 are
receptors for anionic phospholipids.
J Biol Chem. 1995;270:16221–16224.
22.
Moriwaki H, Kume
N, Sawamura T, Aoyama T, Hoshikawa H, Ochi H, Nishi E, Masaki T, Kita
T. Ligand specificity of LOX-1, a novel endothelial
receptor for oxidized low density lipoprotein.
Arterioscler Thromb Vasc Biol. 1998;18:1541–1547.
23.
Okumura T,
Jamieson GA. Platelet glycocalicin, I: orientation of
glycoproteins of the human platelet surface.
J Biol Chem. 1976;251:5944–5949.
24.
Puente NM, Daviet
L, Ninio E, McGregor JL. Identification on human CD36 of a domain
(155-183) implicated in binding oxidized low-density lipoproteins
(Ox-LDL). Arterioscler Thromb Vasc
Biol. 1996;16:1033–1039.
25.
Calvo D,
Gomez-Coronado D, Lasuncion MA, Vega MA. CLA-1 is an 85-kD plasma
membrane glycoprotein that acts as a high-affinity receptor
for both native (HDL, LDL, and VLDL) and modified (OxLDL and AcLDL)
lipoproteins. Arterioscler Thromb Vasc
Biol. 1997;17:2341–2349.
26.
Hirano K,
Yamashita S, Nakagawa Y, Ohya T, Matsuura F, Tsukamoto K, Okamoto Y,
Matsuyama A, Matsumoto K, Miyagawa J, et al. Expression of human
scavenger receptor class B type I in cultured human monocyte-derived
macrophages and atherosclerotic lesions.
Circ Res. 1999;85:108–116.
This article has been cited by other articles:
 |
|
 |
|
  F. K. Swirski, R. Weissleder, and M. J. Pittet Heterogeneous In Vivo Behavior of Monocyte Subsets in Atherosclerosis Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1424 - 1432. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. A. Gleissner, J. M. Sanders, J. Nadler, and K. Ley Upregulation of Aldose Reductase During Foam Cell Formation as Possible Link Among Diabetes, Hyperlipidemia, and Atherosclerosis Arterioscler Thromb Vasc Biol, June 1, 2008; 28(6): 1137 - 1143. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Stec, K. Weglarczyk, J. Baran, E. Zuba, B. Mytar, J. Pryjma, and M. Zembala Expansion and differentiation of CD14+CD16 and CD14++CD16+ human monocyte subsets from cord blood CD34+ hematopoietic progenitors J. Leukoc. Biol., September 1, 2007; 82(3): 594 - 602. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Binder, G. Liebisch, T. Langmann, and G. Schmitz Metabolic Profiling of Glycerophospholipid Synthesis in Fibroblasts Loaded with Free Cholesterol and Modified Low Density Lipoproteins J. Biol. Chem., August 4, 2006; 281(31): 21869 - 21877. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. S. Rosenson-Schloss, E. Chnari, T. A. Brieva, A. Dang, and P. V. Moghe Glutathione Preconditioning Attenuates Ac-LDL-Induced Macrophage Apoptosis via Protein Kinase C-Dependent Ac-LDL Trafficking Experimental Biology and Medicine, January 1, 2005; 230(1): 40 - 48. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Torzewski, P. Suriyaphol, K. Paprotka, L. Spath, V. Ochsenhirt, A. Schmitt, S.-R. Han, M. Husmann, V. B. Gerl, S. Bhakdi, et al. Enzymatic Modification of Low-Density Lipoprotein in the Arterial Wall: A New Role for Plasmin and Matrix Metalloproteinases in Atherogenesis Arterioscler Thromb Vasc Biol, November 1, 2004; 24(11): 2130 - 2136. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||