Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2001;21:542-547

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Reddy, S. T.
Right arrow Articles by Fogelman, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Reddy, S. T.
Right arrow Articles by Fogelman, A. M.
Related Collections
Right arrow Biochemistry and metabolism
Right arrow Lipid and lipoprotein metabolism
Right arrow Oxidant stress
Right arrow Other Vascular biology
Right arrow Gene expression
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2001;21:542.)
© 2001 American Heart Association, Inc.


Atherosclerosis and Lipoproteins

Human Paraoxonase-3 Is an HDL-Associated Enzyme With Biological Activity Similar to Paraoxonase-1 Protein but Is Not Regulated by Oxidized Lipids

Srinivasa T. Reddy; David J. Wadleigh; Victor Grijalva; Carey Ng; Susan Hama; Aditya Gangopadhyay; Diana M. Shih; Aldons J. Lusis; Mohamad Navab; Alan M. Fogelman

From the Atherosclerosis Research Unit, Division of Cardiology, Department of Medicine (S.T.R., D.J.W., V.G., C.N., S.M., D.M.S., A.J.L., M.N., A.M.F.), the Department of Molecular and Medical Pharmacology (S.T.R.), and the Department of Microbiology, Immunology and Molecular Genetics (A.J.L.), University of California, Los Angeles, and the School of Medicine (A.G.), Vanderbilt University, Nashville, Tenn.

Correspondence to Srinivasa T. Reddy, PhD, Department of Medicine, and Department of Molecular and Medical Pharmacology, University of California, Los Angeles, 650 Charles E. Young Drive South, A8-131 CHS, Los Angeles, CA 90095. E-mail sreddy{at}mednet.ucla.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Paraoxonase-1 (PON1) is a secreted protein associated primarily with high density lipoprotein (HDL) and participates in the prevention of low density lipoprotein (LDL) oxidation. Two other paraoxonase (PON) family members, namely, PON2 and PON3, have been identified. In this study, we report the cloning and characterization of the human PON3 gene from HepG2 cells. Tissue Northern analysis identifies an {approx}1.3-kb transcript for PON3 primarily in the liver. PON3-specific peptide antibodies detect an {approx}40-kDa protein associated with HDL and absent from LDL. Pretreatment of cultured human aortic endothelial cells with supernatants from HeLa Tet On cell lines overexpressing PON3 prevents the formation of mildly oxidized LDL and inactivates preformed mildly oxidized LDL. In contrast to PON1, PON3 is not active against the synthetic substrates paraoxon and phenylacetate. Furthermore, PON3 expression is not regulated in HepG2 cells by oxidized phospholipids and is not regulated in the livers of mice fed a high-fat atherogenic diet.


Key Words: paraoxonase • MM-LDL • PON3 • atherosclerosis • oxidized lipids


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
High density lipoprotein inhibits LDL modification1 2 and abolishes the induction of monocyte chemotactic protein-1 (MCP-1) in arterial wall cells, thus preventing monocyte transmigration.3 HDL-associated enzymes possess antiatherogenic properties that may be due, in part, to their interaction with oxidized LDL. Paraoxonase-1 (PON1, EC 3.1.8.1) is 1 of several enzymes associated with HDL. PON1 is a calcium-dependent ester hydrolase that is tightly associated with apoA-I in HDL.4 Purified PON1 prevents LDL oxidation in vitro,5 and treatment of mildly oxidized LDL (MM-LDL) with purified PON1 significantly reduces the ability of MM-LDL to induce monocyte-endothelial interactions.6 Human epidemiological studies have shown that polymorphisms of the human PON1 gene are correlated with coronary artery disease, indicating a genetic association between PON1 and coronary artery disease.7 8 Mackness et al9 showed that alloenzymes of PON1 determine the effectiveness of HDL in protecting LDL from lipid peroxidation. Mice lacking serum PON1 exhibit increased LDL oxidation in vivo and are more susceptible to atherosclerosis than are wild-type mice.10 11

Two other members of the paraoxonase (PON) gene family, termed PON2 and PON3, have been identified.12 It is not known whether PON2 and PON3 play a role similar to PON1 in the regulation of atherosclerosis. All 3 PON genes are located adjacent to each other on chromosome 7 in humans and on chromosome 6 in mice and seem to be a result of gene duplication. The 3 PON genes share {approx}65% similarity at the amino acid level. Although the physiological roles of the corresponding gene products are still unknown, the ability to hydrolyze paraoxon (PON activity) and phenylacetate (arylesterase activity) is routinely used for measuring PON1 activity in vitro and in serum samples. To date, only PON1 has been purified and characterized from human sources, and PON and/or arylesterase activities have not been reported for human PON2 and human PON3. PON1 is expressed primarily in the liver. PON2, on the other hand, is expressed widely in a number of tissues, including, brain, liver, kidney, and testis, and may have multiple mRNA forms.13 PON3 expression in human tissues has not been reported. Missense variations of PON2 have also been reported, and significant associations were observed between PON2 polymorphisms, variation in plasma lipoprotein levels, and risk for heart disease.14 15 16 17 To date, there are no reports on polymorphisms in the PON3 gene.

In the present study, we report the cloning and characterization of human PON3 from HepG2 cells. PON3 is an {approx}40-kDa protein primarily synthesized in the liver and is associated with HDL fractions of human plasma. PON3 not only prevents the formation of MM-LDL but also inhibits MM-LDL–induced monocyte chemotactic activity. Our data suggest that PON3 is similar to PON1 in its association with HDL and the prevention of MM-LDL formation or the inactivation of MM-LDL. However, unlike PON1, PON3 expression is not affected in HepG2 cells by oxidized phospholipids or in the livers of mice by a high-fat diet.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Materials
Cell culture reagents and oligonucleotides were purchased from GIBCO-BRL. Human tissue blots containing 2 µg of poly A+ RNA in each lane were from Origene Technologies Inc. L-{alpha}-1-Palmitoyl-2-arachidonoyl-sn-glycero-3-phosphotidylcholine (PAPC) was obtained from Avanti Polar Lipids. Oxidized PAPC (ox-PAPC) was prepared as described previously.18 Purified PON1 was a generous gift from B.N. La Du (University of Michigan, Ann Arbor). LDL (density 1.019 to 1.063 g/mL) and HDL (density 1.063 to 1.21 g/mL) were isolated according to the protocol described by Havel et al19 from the plasma of normal volunteers after obtaining informed consent according to the Human Research Subject Protection Committee at the University of California, Los Angeles (UCLA). LDL and HDL had endotoxin levels <20 pg/mL.

Cell Culture
HepG2 cells were cultured on 0.1% gelatin–coated plates in EMEM medium containing 10% FBS, 1% nonessential amino acids, and 1 mmol/L sodium pyruvate. HeLa Tet On cells (Clontech) were grown in DMEM high glucose containing 10% tetracycline-free FBS. Human aortic endothelial cells (HAECs) were isolated and cultured as described previously.3 Cells (2x105 cells/cm2) were allowed to grow, forming a complete monolayer of confluent HAECS in 2 days. HAECS were used at passage levels 4 to 6. Monocytes were isolated by a modification of the Recalde method, as previously described by Fogelman et al,20 from the blood of normal volunteers after obtaining written consent under a protocol approved by the Human Research Subject Protection Committee at UCLA. The 293 cells were cultured in DMEM high glucose containing 10% FBS.

Cloning of Human PON1 and PON3 From HepG2 Cells
On the basis of the available sequence information in the NCBI databases, specific primers were designed to amplify the complete coding sequences of PON1 and PON3. The PON1- and PON3-specific primers along with HepG2 cell total RNA (1 µg) were subjected to reverse transcriptase (RT)–polymerase chain reaction (PCR) by use of the Access RT-PCR system kit from Promega. The upper and lower primers for human PON1 were 5' ATTAGTCGACGACCATGGCGAAGCTGATT 3' and 5' ATAGTTTAGCGGCCGCTTAGAGCTCACAGTAAAGA 3', respectively, and the upper and lower primers for human PON3 were 5' GATTAGTCGACCATGGGGAAGCTCGTGGCGCT 3' and 5' ATAGTTTAGCGGCCGCTTAGAGCTCACAGTAC 3', respectively. In each set of primers, the upper primers contained a SalI restriction site on the 5'end, and the lower primer had a NotI restriction site on the 3'end. After RT-PCR, the products were identified on agarose gel and cloned into the pCR II vector with a TOPO TA cloning kit (Invitrogen). Multiple clones containing the PON1 and PON3 cDNA were sequenced at the UCLA sequencing core facility. The sequences were aligned with PON1 and PON3 sequences available in the National Center for Biotechnology Information databases by using MacVector and Assemblyalign programs. SalI-NotI fragments containing PON1 and PON3 were excised from the TA vectors and cloned into pGex-6p2 (Amersham Pharmacia Biotech). BL21 bacteria were transformed with the resulting glutathione S-transferase (GST) plasmids, and GST fusion proteins were prepared according to the manufacturer’s protocol. These GST-PON1 and GST-PON3 fusion proteins were verified by size on polyacrylamide gel. We also cloned the SalI-NotI PON1 and PON3 cDNAs into a plasmid containing tetracycline response element (TRE) to generate pTRE-PON1 and pTRE-PON3, respectively. RT-PCR amplification of mouse PON3 was performed by using mouse PON3 upper primer 5' ATCTTGGACCCTCACTGGACTT 3' and mouse PON3 lower primer 5' ACAGCTTCATGGGGTTAGGGTG 3'.

Antibody Generation and Specificity
Peptides CRNHQSSYQTRLNALREVQ (PON1) and CRVNASQEVEPVEPEN (PON3) were synthesized at the UCLA peptide synthesis core facility. Peptides were chosen on the basis of their hydrophilicity as well as their specificity to the corresponding PON protein. The cysteine residues in the N-terminus of each peptide are not part of the original PON1 and PON3 sequences. They were added to PON1 and PON3 peptides to facilitate conjugation to carrier protein. Two milligrams of each peptide was conjugated to 2 mg of keyhole limpet hemocyanin (KLH) by using the Imject Maleimide–Activated KLH kit (Pierce), and the KLH-conjugated peptides were purified according to manufacturer’s protocol. Rabbit polyclonal antibodies against PON1- and PON3-conjugated peptides were developed at Cocalico Biologicals. Total lysates (5 µg each) from GST-PON1– and GST-PON3–expressing bacteria were used to determine the specificity of PON1 and PON3 antibodies. PON1 antibody recognizes the GST-PON1 protein and not the GST-PON3 protein. Similarly, the PON3 antibody detects the GST-PON3 protein but not the GST-PON1 protein. In immune-depletion experiments, PON1 and PON3 antibodies preincubated with 1 µg of PON1- and PON3-specific peptides, respectively, did not detect their corresponding GST fusion protein. Immune-depletion experiments in which the PON1 and PON3 antibodies were preincubated with either the corresponding peptide antigen or GST fusion protein enabled the identification of mammalian and of expressed PON1 and PON3 proteins on Western blots.

Western Analysis
Appropriate protein samples were reduced in ß-mercaptoethanol, boiled, electrophoresed on 10% SDS-PAGE gels, and electroblotted onto Hybond ECL nitrocellulose membranes by using a semidry transfer apparatus from Bio-Rad. Membranes were blocked with Tris-buffered saline/5% nonfat dry milk for 60 minutes, washed, and incubated with primary and secondary antibodies for 2 hours and 1 hour, respectively. The secondary antibody used was horseradish peroxidase–conjugated anti-rabbit IgG (Amersham). Primary and secondary antibodies were used at 1:1000 and 1:4000 dilutions, respectively. The membranes were washed extensively with Tris-buffered saline/0.1% Tween after secondary antibody incubation and detected by using the ECL Western blotting kit (Amersham) according to the manufacturer’s suggested protocol. To determine the presence of PON1 and PON3 in human lipoproteins, equal amounts of HDL and LDL fractions (based on cholesterol content, 1.4 µg), isolated by fast-performance liquid chromatography, were resolved on SDS-PAGE. Approximately 0.25 µg of purified PON1 and 80 µg of concentrated 293 cell culture supernatants were used as positive controls for PON1 and PON3, respectively.

Establishment of HeLa-Tet-PON1 and HeLa-Tet-PON3 Cell Lines
HeLa Tet On cells (Clontech) were cotransfected with either pTRE-PON1 or pTRE-PON3 and pBabe-Puro (puromycin-resistant plasmid) by using Superfect reagent (Qiagen Inc). The day after transfection, the cultures were given medium containing 0.1 µg/mL of puromycin. After 10 days, puromycin-resistant clones were isolated, expanded, and tested for doxycycline inducibility. Several isolates of HeLa-Tet-PON1 or HeLa-Tet-PON3 with high doxycycline-inducible expression were pooled and used for the present study. The cells were treated for 2 days with 2 µg/mL of doxycycline for induction of PON message and protein. After induction with doxycycline, supernatants from HeLa-Tet-PON1 and HeLa-Tet-PON3 cells were collected and concentrated by using Centricon-10 filters (Millipore). For Western analysis, cells were lysed in a buffer containing 50 mmol/L Tris (pH 7.5), 100 mmol/L NaCl, 5 mmol/L EDTA, 5 mmol/L sodium orthovanadate, 1% Triton X-100, and protease inhibitors.

Northern Analysis
Total RNA from cell cultures was purified by using the RNeasy kit (Qiagen Inc). Ten micrograms of total RNA from HepG2 cells or 2.5 µg of total RNA from HeLa Tet On cell lines was subjected to electrophoresis on 1% agarose gel, transferred to Hybond-N membranes (Amersham Pharmacia Biotech), and hybridized with cDNA probes for human PON1, PON3, and GAPDH. Electrophoresis and hybridization protocols have been described previously.21

Monocyte Chemotaxis Assay and Lipid Hydroperoxide Measurement
HAECs were plated at 2x105 cells/cm2 and allowed to grow, forming a monolayer of confluent HAECs in 2 days. To study the formation of MM-LDL by HAECs, confluent cultures were preincubated for 2 hours with concentrated supernatants from HeLa-Tet-PON1 and HeLa-Tet-PON3 cells. The cells were washed and further incubated with native LDL (200 µg of LDL protein/mL) in medium 199 containing 10% lipoprotein-deficient serum. Fourteen hours later, supernatants were collected and stored until further analysis. For monocyte chemotaxis assay, supernatants were diluted 40-fold and assayed as described previously.22 The number of migrated monocytes was determined microscopically and expressed as the mean±SD of 12 standardized high-power fields counted in quadruplicate wells. For lipid hydroperoxide content, lipids in supernatants from HAECs were extracted with chloroform-methanol, and hydroperoxides were determined by the method reported by Auerbach et al.23 For MM-LDL inactivation studies, concentrated supernatants from HeLa-Tet-PON1 and HeLa-Tet-PON3 cell cultures were incubated with MM-LDL for 2 hours, filtered through 300 000–molecular weight cutoff filters, and added to cultured confluent HAECs. Four hours later, the resulting supernatants were analyzed for monocyte chemotactic activity and lipid hydroperoxide content.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Cloning and Expression of the Human PON3 Gene
As detailed in Methods, we RT-PCR–amplified and cloned a full-length cDNA encoding human PON3 from HepG2 cells (sequence submitted to GenBank, accession No. AF320003). A human tissue blot probed with PON3 cDNA identifies a band {approx}1.3 kb in size (Figure 1Down). PON3 is expressed primarily in the liver, although low levels of PON3 message are also detected in the kidney (Figure 1Down). The PON3 antiserum identifies an {approx}40-kDa protein in HepG2 cells (data not shown). Because low levels of PON3 message are also detected in the kidney (Figure 1Down), we examined whether the 293 human embryonic kidney cell line expresses PON3 protein. The PON3 antiserum recognizes an {approx}40-kDa protein in 293 cell culture supernatants (Figure 2Down), which can be competed away with PON3-specific peptides but not PON1-specific peptides (data not shown). Moreover, in these experiments, we do not detect any PON1 protein in 293 cell culture supernatants (Figure 2Down). To determine whether PON3 is associated with human plasma fractions, Western analysis of HDL and LDL fractions was performed by using anti-PON1 and anti-PON3 antibodies. As expected, PON1 protein is detected in the HDL fractions of human plasma but not in the LDL fractions (Figure 2Down). PON3 protein is also detected only in the HDL fractions of human plasma (Figure 2Down). Our results suggest that (similar to PON1) PON3 protein is also a secreted protein associated with the HDL fractions of human plasma but absent in the LDL fractions.



View larger version (56K):
[in this window]
[in a new window]
 
Figure 1. Tissue distribution of human PON3. Human tissue blot (Origene Technologies) containing 2 µg of poly A+ in each lane was hybridized to labeled PON3 cDNA. The tissue sources are labeled. Sm indicates small.



View larger version (48K):
[in this window]
[in a new window]
 
Figure 2. Expression and localization of PON3 protein. Concentrated 293 cell culture supernatants (80 µg) and HDL and LDL (based on cholesterol content, 1.4 µg) isolated by fast-performance liquid chromatography were subjected to SDS-PAGE. Western blot analysis was performed by using PON1 antiserum (left), PON3 antiserum (middle), and preimmune serum (right). Purified PON1 ({approx}0.25 µg) was used as control for PON1. M indicates markers.

PON3 Prevents the Formation of MM-LDL and Inactivates Preformed MM-LDL
We generated stable HeLa Tet On cell lines carrying doxycycline-inducible PON1 and PON3 cDNA. The resulting cell lines were designated HeLa-Tet-PON1 and HeLa-Tet-PON3, respectively. Parental HeLa Tet On cells do not express any detectable PON1 and PON3 mRNA or protein. PON1 and PON3 messages are induced by doxycycline in HeLa-Tet-PON1 and HeLa-Tet-PON3 cell lines, respectively (Figure 3ADown). Moreover, on induction with doxycycline, HeLa-Tet-PON1 and HeLa-Tet-PON3 cell lines synthesize PON1 and PON3 proteins, respectively (Figure 3BDown).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Induction of PON1 and PON3 expression in HeLa Tet On cells. A, Doxycycline induces PON1 and PON3 mRNA expression in HeLa-Tet-PON1 and HeLa-Tet-PON3 cells, respectively. Total RNA (2.5 µg each) from doxycycline-induced HeLa-Tet-PON1 and HeLa-Tet-PON3 cells was subjected to Northern analysis by use of PON1 and PON3 cDNA. B, Doxycycline induces PON1 and PON3 protein expression in HeLa-Tet-PON1 and HeLa-Tet-PON3 cells, respectively. Total protein (50 µg each) from doxycycline-induced HeLa-Tet-PON1 and HeLa-Tet-PON3 cells was subjected to Western analysis by use of PON1 and PON3 antibodies.

After incubation with HAECs, LDL is modified to become MM-LDL. The resulting MM-LDL is elevated in lipid hydroperoxide content and induces monocyte chemotactic activity in target HAECs.3 22 HDL and purified PON1 inhibit the modification of LDL by HAECs.22 HAECs pretreated with concentrated ({approx}10-fold) supernatants containing PON3 protein are less effective in modifying LDL (as measured by the induction of monocyte chemotactic activity) than are HAECs pretreated with concentrated supernatants from uninduced HeLa-Tet-PON3 cells (Figure 4ADown). This suggests that (similar to PON1) PON3 also prevents the modification of LDL by HAECs. Moreover, preformed MM-LDL incubated with supernatants containing PON3 protein has significantly lower amounts of lipid hydroperoxides (Figure 4BDown, top) and is less effective in inducing monocyte chemotaxis (Figure 4BDown, bottom).



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. PON3 protein prevents the formation of MM-LDL and also inactivates preformed MM-LDL. A, PON3 prevents MM-LDL formation. HAECs were left untreated (no addition) or incubated with LDL alone (LDL) or LDL together with either HDL (+HDL), DMEM (+media), purified PON1 (+purified PON1), concentrated supernatants from HeLa-Tet-PON1 cells [+PON1 (-Tet)], concentrated supernatants from doxycycline-induced HeLa-Tet-PON1 cells [+PON1 (+Tet)], concentrated supernatants from HeLa-Tet-PON3 cells [+PON3 (-Tet)], or concentrated supernatants from doxycycline-induced HeLa-Tet-PON3 cells [+PON3 (+Tet)]. Fourteen hours later, the resulting supernatants were collected and analyzed for MM-LDL formation (as measured by the ability to induce monocyte chemotactic activity as described in Methods). HPF indicates high-power field. B, PON3 inactivates preformed MM-LDL. HAECs were incubated with medium 199 alone (no addition), MM-LDL, or MM-LDL together with either purified PON1 (+purified PON1), concentrated supernatants from doxycycline-induced HeLa-Tet-PON1 cells [+PON1 (+Tet)], or concentrated supernatants from doxycycline-induced HeLa-Tet-PON3 cells [+PON3 (+Tet)]. Two hours later, the resulting MM-LDL was reisolated by filtering through 300 000–molecular weight cutoff filters and added to confluent HAEC cultures. Fourteen hours later, the resulting supernatants were tested for lipid hydroperoxide (LOOH) content by Auerbach assay (top of panel B) and the ability to induce monocyte chemotactic activity (bottom of panel B).

PON3 Is Not Regulated by Oxidized Lipids
PON1 mRNA expression is repressed by ox-PAPC in HepG2 cells24 and in the livers of mice fed an atherogenic diet.25 We examined whether oxidized lipids can also regulate PON3 mRNA expression. PON3 message is constitutively expressed and, in contrast to PON1, is not affected by ox-PAPC in HepG2 cells (Figure 5ADown). Moreover, unlike PON1, PON3 mRNA is not altered in the livers of C57BL/6 mice fed an atherogenic diet (Figure 5BDown and 5CDown).



View larger version (16K):
[in this window]
[in a new window]
 
Figure 5. PON3 message is not regulated by oxidized lipids in HepG2 cells or by a high-fat diet in mouse livers. A, Oxidized phospholipids do not regulate PON3 mRNA. HepG2 cells were either untreated (CON) or treated with PAPC or ox-PAPC for 24 hours. Total RNA was isolated and subjected to Northern analysis by use of human PON3 cDNA. B, PON1 message is repressed by a high-fat diet in the mouse liver. Livers from C57BL/6 mice on a chow diet or a high-fat diet for 15 weeks were harvested. Total RNA (20 µg) was subjected to Northern analysis by use of mouse PON1 and GAPDH cDNA probes. Quantification was performed by phosphoimaging analysis, and ratios of PON1 to GAPDH were obtained. C, PON3 message is not regulated by a high-fat diet in the mouse liver. Total RNA (100 ng) from C57BL/6 mice on a chow diet or high-fat diet was subjected to RT-PCR analysis (20 cycles) by use of mouse PON3 and mouse GAPDH primers. The agarose gels were incubated in SYBR Green (Molecular Probes) for 30 minutes, washed, scanned with an FMBIOII scanner (Hitachi), and quantified.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
Biochemical Properties and Biological Activities of PON1 and PON3 Proteins
Most of our understanding of PON proteins is derived primarily from studies involving PON1 protein. PON and arylesterase assays are routinely used to determine PON activity in human and animal serum samples. Although a physiological role for PON1 has not been proven, the ability of PON1 to prevent or destroy modifications in LDL is thought to be its prime biological activity in vivo. Interestingly, the arylesterase and PON activities of PON1 appear to be distinct from the ability of PON1 to protect against LDL oxidation, inasmuch as site-directed mutagenesis of the free sulfhydryl–modified Cys283 residue, although leaving its PON and arylesterase activities intact, eliminates its ability to protect LDL from oxidation.26 However, this free-sulfhydryl group may still be important for the structure of the PON1 protein, inasmuch as chemical removal of this group abrogates its PON and arylesterase activities as well as its ability to protect against LDL oxidation.26 Human PON3 protein shares the 3 conserved cysteine residues identified in PON1, suggesting that the free-sulfhydryl residue at Cys283 and the intramolecular disulfide bond linking the other 2 cysteines in PON1 may also be important features of the structure and in vivo activities PON3.

Recent studies attribute a new enzyme activity to PON1 and PON3 proteins. Kobayashi et al27 have reported the cloning of a lactone hydrolase (lactonase) from Fusarium oxysporum AKU 3702 and discovered similarities between the lactonase and PON1 gene. While we were preparing the present article, Draganov et al28 reported the purification and characterization of PON3 protein from rabbit serum. Interestingly, lactonase activity, as well as the lack of significant PON and arylesterase activities for rabbit PON3, facilitated the purification and characterization of rabbit serum PON3.28 We did not test the supernatants from our PON3-overexpressing cell lines for lactonase activity. However, in agreement with Draganov et al, we did not find significant activity against the substrates paraoxon and phenyl acetate associated with PON3-containing supernatants (data not shown). However, because the PON and arylesterase activities of PON1 appear to be distinct from its in vivo ability to protect against LDL oxidation,26 it is not surprising that the lack of apparent PON or arylesterase activity in PON3 does not preclude it from possessing the ability to protect LDL from oxidation. Indeed, like PON1, we find that PON3 is capable of preventing the formation of MM-LDL as well as inactivating preformed MM-LDL (Figure 4Up) but that it apparently lacks detectable arylesterase and PON activity. Draganov et al have shown that rabbit PON3 is also associated with the HDL fraction of rabbit serum and that rabbit PON3 is more effective than is rabbit PON1 in protecting LDL from copper-induced oxidation.28 This suggests that in vivo, PON3 may play a significant atheroprotective role. It will be interesting to determine the exact spectrum of enzymatic products resulting from PON3 action on MM-LDL and whether PON1 and PON3 proteins possibly yield different enzymatic end products. We are currently preparing purified fractions of human PON3 to further characterize its enzymatic activities.

PON1 and PON3 proteins share numerous conserved phosphorylation and N-glycosylation consensus sites. However, it is not known whether the PON proteins are modified at these sites or whether modification at any of these sites is required for activity in vivo. Based on the sequence analysis, the predicted sizes for human PON1 and PON3 proteins are 38.6 and 39.6, respectively. However, HDL-associated PON1 runs as an {approx}48-kDa protein, whereas PON3 runs as an {approx}40-kDa protein. This suggests that PON1 may be significantly posttranslationally modified, especially relative to PON3.

Localization and Expression of PON3 Protein
We have found that PON3 (similar to PON1) is primarily localized to the HDL fractions of plasma and that the primary site of synthesis of the PON1 and PON3 proteins appears to be the liver. It is likely that PON1 and PON3 synthesis in the liver provides a location for the insertion of these proteins into nascent HDL particles. It will be interesting to determine whether the PON1 and PON3 proteins coexist on the same or different HDL particles. Interestingly, we detected significant amounts of PON3 mRNA in the kidney and also identified PON3 protein in the supernatants of 293 cell cultures; however, PON1 message is not detectable in the kidney (data not shown), and PON1 protein is not expressed in 293 cells (Figure 2Up). This suggests that PON3 protein may play a role, distinct from PON1, in the lipoprotein metabolism of the kidney.

Regulation of PON3 mRNA
PON1 mRNA expression is significantly repressed during an acute-phase response in rabbits,29 in apoA-II transgenic mice,30 in C57BL/6J(B6) mice fed an atherogenic diet,25 29 and in cultured HepG2 cells treated with the cytokines tumor necrosis factor and interleukin-131 or MM-LDL.24 Because, unlike PON1, PON3 mRNA expression is not altered by either ox-PAPC in HepG2 cells (Figure 5AUp) or a high-fat diet in the livers of C57BL/6 mice (Figure 5BUp and 5CUp), PON1 and PON3 may play distinct roles in the prevention of atherosclerosis. PON3 may provide a basal constitutive atheroprotective function, whereas the protective effect of PON1 is more variable, inasmuch as PON1 expression is repressed by proatherogenic stimuli. Future studies, such as the generation of PON3 knockout and transgenic mouse models, may determine whether PON3 activity is required in vivo for the prevention of atherosclerotic lesion development.

In summary, PON3 is a secreted protein associated with HDL in the plasma and can participate in the prevention of LDL oxidation. These characteristics link PON3 with a group of enzymes, such as PON1, platelet-activating factor–acetyl hydrolase, and lecithin-cholesterol acyltransferase, which together may contribute to the antiatherogenic properties of HDL.


*    Acknowledgments
 
This work was supported by US Public Health Service grant HL-30568, a Tobacco Related Disease Research Project grant from the State of California, and the Laubisch, Castera, and M.K. Gray Fund at UCLA. We thank Reza Khorsan for technical assistance in the characterization of PON1 and PON3 antibodies.

Received December 1, 2000; accepted February 14, 2001.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 

  1. Parthasarathy S, Barnett J, Fong LG. High density lipoprotein inhibits the oxidative modification of low density lipoprotein. Biochem Biophys Acta.. 1990;1044:275–283.[Medline] [Order article via Infotrieve]
  2. Maier JA, Barenghi L, Pagani F, Bradamante S, Comi P, Ragnotti G. The protective role of high-density lipoprotein on oxidized-low-density-lipoprotein-induced U937/endothelial cell interactions. Eur J Biochem.. 1994;221:35–41.[Medline] [Order article via Infotrieve]
  3. Navab M, Imes SS, Hama SY, Hough GP, Ross LA, Bork RW, Valente AJ, Berliner JA, Drinkwater DC, Laks H, et al. Monocyte transmigration induced by modification of low density lipoprotein in cocultures of human aortic wall cells is due to induction of monocyte chemotactic protein 1 synthesis and is abolished by high density lipoprotein. J Clin Invest.. 1991;88:2039–2046.
  4. La Du BN; Kulow W, ed. Pharmacogenetics of Drug Metabolism. New York, NY: Pergamon Press Inc; 1992:51–91.
  5. Mackness MI, Arrol S, Durrington PN. Paraoxonase prevents accumulation of lipoperoxides in low-density lipoprotein. FEBS Lett.. 1991;286:152–154.[Medline] [Order article via Infotrieve]
  6. Watson AD, Berliner JA, Hama SY, La Du BN, Faull K, Fogelman AM, Navab M. Protective effect of high density lipoprotein associated paraoxonase: inhibition of the biological activity of minimally oxidized low density lipoprotein. J Clin Invest.. 1995;96:2882–2891.
  7. Odawara M, Tachi Y, Yamashita K. Paraoxonase polymorphism (Gln192-Arg) is associated with coronary heart disease in Japanese noninsulin-dependent diabetes mellitus. J Clin Endocrinol Metab.. 1997;82:2257–2260.[Abstract/Free Full Text]
  8. Suehiro T, Nakauchi Y, Yamamoto M, Arii K, Itoh H, Hamashige N, Hashimoto K. Paraoxonase gene polymorphism in Japanese subjects with coronary heart disease. Int J Cardiol.. 1996;57:69–73.[Medline] [Order article via Infotrieve]
  9. Mackness MI, Arrol S, Mackness B, Durrington PN. Alloenzymes of paraoxonase and effectiveness of high-density lipoproteins in protecting low-density lipoprotein against lipid peroxidation. Lancet.. 1997;349:851–852.[Medline] [Order article via Infotrieve]
  10. Shih DM, Gu L, Xia YR, Navab M, Li WF, Hama S, Castellani LW, Furlong CE, Costa LG, Fogelman AM, et al. Mice lacking serum paraoxonase are susceptible to organophosphate toxicity and atherosclerosis. Nature.. 1998;394:284–287.[Medline] [Order article via Infotrieve]
  11. Shih DM, Xia Y-R, Wang X-P, Miller E, Castellani LW, Subbanagounder G, Cheroutre H, Faull KF, Berliner JA, Witztum JL, et al. Combined serum paraoxonase knockout/apolipoprotein E knockout mice exhibit increased lipoprotein oxidation and atherosclerosis. J Biol Chem.. 2000;275:17527–17535.[Abstract/Free Full Text]
  12. Primo-Parmo SL, Sorenson RC, Teiber J, La Du BN. The human serum paraoxonase/arylesterase gene (PON1) is one member of a multigene family. Genomics.. 1996;33:498–507.[Medline] [Order article via Infotrieve]
  13. Mochizuki H, Scherer SW, Xi T, Nickle DC, Majer M, Huizenga JJ, Tsui LC, Prochazka M. Human PON2 gene at 7q21.3: cloning, multiple mRNA forms, and missense polymorphisms in the coding sequence. Gene.. 1998;213:149–157.[Medline] [Order article via Infotrieve]
  14. Imai Y, Morita H, Kurihara H, Sugiyama T, Kato N, Ebihara A, Hamada C, Kurihara Y, Shindo T, Oh-hashi Y, et al. Evidence for association between paraoxonase gene polymorphisms and atherosclerotic diseases. Atherosclerosis.. 2000;149:435–442.[Medline] [Order article via Infotrieve]
  15. Sanghera DK, Aston CE, Saha N, Kamboh MI. DNA polymorphisms in two paraoxonase genes (PON1 and PON2) are associated with the risk of coronary heart disease. Am J Hum Genet.. 1998;62:36–44.[Medline] [Order article via Infotrieve]
  16. Hegele RA, Connelly PW, Scherer SW, Hanley AJ, Harris SB, Tsui LC, Zinman B. Paraoxonase-2 gene (PON2) G148 variant associated with elevated fasting plasma glucose in noninsulin-dependent diabetes mellitus. J Clin Endocrinol Metab. 1997;82:3373–3377.[Abstract/Free Full Text]
  17. Hegele RA, Harris SB, Connelly PW, Hanley AJ, Tsui LC, Zinman B, Scherer SW. Genetic variation in paraoxonase-2 is associated with variation in plasma lipoproteins in Canadian Oji-Cree. Clin Genet. 1998;54:394–399.[Medline] [Order article via Infotrieve]
  18. Watson AD, Leitinger N, Navab M, Faull KF, Hörkkö S, Witztum JL, Palinski W, Schwenke D, Salomon RG, Sha W, et al. Structural identification by mass spectrometry of oxidized phospholipids in minimally oxidized low density lipoprotein that induce monocyte/endothelial interactions and evidence for their presence in vivo. J Biol Chem. 1997;272:13597–13607.[Abstract/Free Full Text]
  19. Havel RJ, Eder HA, Bragdon JH. The distribution and chemical composition of ultracentrifugally separated lipoproteins of human serum. J Clin Invest. 1955;43:1345–1353.
  20. Fogelman AM, Sykes K, Van Lenten BJ, Territo MC, Berliner JA. Modification of the Recalde method for the isolation of human monocytes. J Lipid Res. 1988;29:1243–1247.[Abstract]
  21. Reddy ST, Winstead M, Tischfield JA, Herschman HR. Analysis of the secretory phospholipase A2 that mediates prostaglandin production in mast cells. J Biol Chem. 1997;271:13591–13596.
  22. Navab M, Hama SY, Cooke CJ, Anantharamaiah GM, Chaddha M, Jin L, Subbanagounder G, Faull KF, Reddy ST, Miller NE, et al. Normal high density lipoprotein inhibits three steps in the formation of mildly oxidized low density lipoprotein: step 1. J Lipid Res. 2000;41:1481–1494.[Abstract/Free Full Text]
  23. Auerbach BJ, Kiely JS, Cornicelli JA. A spectrophotometric microtiter-based assay for the detection of hydroperoxide derivatives of linoleic acid. Anal Biochem. 1992;201:375–380.[Medline] [Order article via Infotrieve]
  24. Navab M, Hama SL, Van Lenten BJ, Fonarow GC, Cardinez CJ, Castellani LW, Brennan ML, Lusis AJ, Fogelman AM, La Du BN. Mildly oxidized LDL induces an increased apolipoprotein J/paraoxonase ratio. J Clin Invest. 1997;99:2005–2019.[Medline] [Order article via Infotrieve]
  25. Shih DM, Gu L, Hama S, Xia YR, Navab M, Fogelman AM, Lusis AJ. Genetic-dietary regulation of serum paraoxonase expression and its role in atherogenesis in a mouse model. J Clin Invest. 1996;97:1630–1639.[Medline] [Order article via Infotrieve]
  26. Aviram M, Billecke S, Sorenson R, Bisgaier C, Newton R, Rosenblat M, Erogul J, Hsu C, Dunlop C, La Du B. Paraoxonase active site required for protection against LDL oxidation involves its free-sulfhydryl group and is different from that required for its arylesterase/paraoxonase activities. Arterioscler Thromb Vasc Biol. 1998;18:1617–1624.[Abstract/Free Full Text]
  27. Kobayashi M, Shinohara M, Sakoh C, Kataoka M, Shimizu S. Lactone-ring-cleaving enzyme: genetic analysis, novel RNA editing, and evolutionary implications. Proc Natl Acad Sci U S A. 1998;95:12787–12792.[Abstract/Free Full Text]
  28. Draganov DI, Stetson PL, Watson CE, Billecke SS, La Du BN. Rabbit serum paraoxonase 3 (PON3) is a high density lipoprotein-associated lactonase and protects low density lipoprotein against oxidation. J Biol Chem. 2000;275:33435–33442.[Abstract/Free Full Text]
  29. Van Lenten BJ, Hama SY, de Beer FC, Stafforini DM, McIntyre TM, Prescott SM, La Du BN, Fogelman AM, Navab M. Anti-inflammatory HDL becomes pro-inflammatory during the acute phase response: loss of protective effect of HDL against LDL oxidation in aortic wall cell cocultures. J Clin Invest. 1995;96:2758–2767.
  30. Castellani LW, Navab M, Lenten BJ, V, Hendrick CC, Hama SY, Goto AM, Fogelman AM, Lusis AJ. Overexpression of apolipoprotein AII in transgenic mice converts high density lipoprotein to proinflammatory particles. J Clin Invest. 1997;100:464–474.[Medline] [Order article via Infotrieve]
  31. Feingold KR, Memon RA, Moser AH, Grunfeld C. Paraoxonase activity in the serum and hepatic mRNA levels decrease during the acute phase response. Atherosclerosis.. 1998;139:307–315.[Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
Hum ReprodHome page
R.W. Browne, W.B. Shelly, M.S. Bloom, A.J. Ocque, J.R. Sandler, H.G. Huddleston, and V.Y. Fujimoto
Distributions of high-density lipoprotein particle components in human follicular fluid and sera and their associations with embryo morphology parameters during IVF
Hum. Reprod., August 1, 2008; 23(8): 1884 - 1894.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. F. Teiber, S. Horke, D. C. Haines, P. K. Chowdhary, J. Xiao, G. L. Kramer, R. W. Haley, and D. I. Draganov
Dominant Role of Paraoxonases in Inactivation of the Pseudomonas aeruginosa Quorum-Sensing Signal N-(3-Oxododecanoyl)-L-Homoserine Lactone
Infect. Immun., June 1, 2008; 76(6): 2512 - 2519.
[Abstract] [Full Text] [PDF]


Home page
HeartHome page
D J Hausenloy and D M Yellon
Targeting residual cardiovascular risk: raising high-density lipoprotein cholesterol levels
Heart, June 1, 2008; 94(6): 706 - 714.
[Abstract] [Full Text] [PDF]


Home page
JAMAHome page
T. Bhattacharyya, S. J. Nicholls, E. J. Topol, R. Zhang, X. Yang, D. Schmitt, X. Fu, M. Shao, D. M. Brennan, S. G. Ellis, et al.
Relationship of Paraoxonase 1 (PON1) Gene Polymorphisms and Functional Activity With Systemic Oxidative Stress and Cardiovascular Risk
JAMA, March 19, 2008; 299(11): 1265 - 1276.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
E. Senol, A. Ersoy, S. Erdinc, E. Sarandol, and M. Yurtkuran
Oxidative stress and ferritin levels in haemodialysis patients
Nephrol. Dial. Transplant., February 1, 2008; 23(2): 665 - 672.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
E. Levy, K. Trudel, M. Bendayan, E. Seidman, E. Delvin, M. Elchebly, J.-C. Lavoie, L.-P. Precourt, D. Amre, and D. Sinnett
Biological role, protein expression, subcellular localization, and oxidative stress response of paraoxonase 2 in the intestine of humans and rats
Am J Physiol Gastrointest Liver Physiol, December 1, 2007; 293(6): G1252 - G1261.
[Abstract] [Full Text] [PDF]


Home page
J. Neurol. Neurosurg. PsychiatryHome page
S. Cronin, M. J Greenway, J. H M Prehn, and O. Hardiman
Paraoxonase promoter and intronic variants modify risk of sporadic amyotrophic lateral sclerosis
J. Neurol. Neurosurg. Psychiatry, September 1, 2007; 78(9): 984 - 986.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
C. J. Ng, N. Bourquard, S. Y. Hama, D. Shih, V. R. Grijalva, M. Navab, A. M. Fogelman, and S. T. Reddy
Adenovirus-Mediated Expression of Human Paraoxonase 3 Protects Against the Progression of Atherosclerosis in Apolipoprotein E-Deficient Mice
Arterioscler. Thromb. Vasc. Biol., June 1, 2007; 27(6): 1368 - 1374.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. I. Draganov
Human PON3, Effects Beyond the HDL: Clues From Human PON3 Transgenic Mice
Circ. Res., April 27, 2007; 100(8): 1104 - 1105.
[Full Text] [PDF]


Home page
Circ. Res.Home page
D. M. Shih, Y.-R. Xia, X.-P. Wang, S. S. Wang, N. Bourquard, A. M. Fogelman, A. J. Lusis, and S. T. Reddy
Decreased Obesity and Atherosclerosis in Human Paraoxonase 3 Transgenic Mice
Circ. Res., April 27, 2007; 100(8): 1200 - 1207.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. A. Stoltz, E. A. Ozer, C. J. Ng, J. M. Yu, S. T. Reddy, A. J. Lusis, N. Bourquard, M. R. Parsek, J. Zabner, and D. M. Shih
Paraoxonase-2 deficiency enhances Pseudomonas aeruginosa quorum sensing in murine tracheal epithelia
Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L852 - L860.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
C. K. Roberts, C. Ng, S. Hama, A. J. Eliseo, and R. J. Barnard
Effect of a short-term diet and exercise intervention on inflammatory/anti-inflammatory properties of HDL in overweight/obese men with cardiovascular risk factors
J Appl Physiol, December 1, 2006; 101(6): 1727 - 1732.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. J. Ng, N. Bourquard, V. Grijalva, S. Hama, D. M. Shih, M. Navab, A. M. Fogelman, A. J. Lusis, S. Young, and S. T. Reddy
Paraoxonase-2 Deficiency Aggravates Atherosclerosis in Mice Despite Lower Apolipoprotein-B-containing Lipoproteins: ANTI-ATHEROGENIC ROLE FOR PARAOXONASE-2
J. Biol. Chem., October 6, 2006; 281(40): 29491 - 29500.
[Abstract] [Full Text] [PDF]


Home page
NeurologyHome page
M. Saeed, N. Siddique, W. Y. Hung, E. Usacheva, E. Liu, R. L. Sufit, S. L. Heller, J. L. Haines, M. Pericak-Vance, and T. Siddique
Paraoxonase cluster polymorphisms are associated with sporadic ALS
Neurology, September 12, 2006; 67(5): 771 - 776.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. Mackness, R. Quarck, W. Verreth, M. Mackness, and P. Holvoet
Human Paraoxonase-1 Overexpression Inhibits Atherosclerosis in a Mouse Model of Metabolic Syndrome
Arterioscler. Thromb. Vasc. Biol., July 1, 2006; 26(7): 1545 - 1550.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
C. S. Carlson, P. J. Heagerty, T. S. Hatsukami, R. J. Richter, J. Ranchalis, J. Lewis, T. J. Bacus, L. A. McKinstry, G. D. Schellenberg, M. Rieder, et al.
TagSNP analyses of the PON gene cluster: effects on PON1 activity, LDL oxidative susceptibility, and vascular disease
J. Lipid Res., May 1, 2006; 47(5): 1014 - 1024.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
K. Ranade, T. G. Kirchgessner, O. A. Iakoubova, J. J. Devlin, T. DelMonte, P. Vishnupad, L. Hui, Z. Tsuchihashi, F. M. Sacks, M. S. Sabatine, et al.
Evaluation of the Paraoxonases as Candidate Genes for Stroke: Gln192Arg Polymorphism in the Paraoxonase 1 Gene Is Associated With Increased Risk of Stroke
Stroke, November 1, 2005; 36(11): 2346 - 2350.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
D. I. Draganov, J. F. Teiber, A. Speelman, Y. Osawa, R. Sunahara, and B. N. La Du
Human paraoxonases (PON1, PON2, and PON3) are lactonases with overlapping and distinct substrate specificities
J. Lipid Res., June 1, 2005; 46(6): 1239 - 1247.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
A. Chait, C. Y. Han, J. F. Oram, and J. W. Heinecke
Thematic review series: The Immune System and Atherogenesis. Lipoprotein-associated inflammatory proteins: markers or mediators of cardiovascular disease?
J. Lipid Res., March 1, 2005; 46(3): 389 - 403.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. J. Barter, S. Nicholls, K.-A. Rye, G.M. Anantharamaiah, M. Navab, and A. M. Fogelman
Antiinflammatory Properties of HDL
Circ. Res., October 15, 2004; 95(8): 764 - 772.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Aharoni, L. Gaidukov, S. Yagur, L. Toker, I. Silman, and D. S. Tawfik
Directed evolution of mammalian paraoxonases PON1 and PON3 for bacterial expression and catalytic specialization
PNAS, January 13, 2004; 101(2): 482 - 487.
[Abstract] [Full Text] [PDF]


Home page