© 2001 American Heart Association, Inc.
Atherosclerosis and Lipoproteins |
Human Paraoxonase-3 Is an HDL-Associated Enzyme With Biological Activity Similar to Paraoxonase-1 Protein but Is Not Regulated by Oxidized Lipids
From the Atherosclerosis Research Unit, Division of Cardiology, Department of Medicine (S.T.R., D.J.W., V.G., C.N., S.M., D.M.S., A.J.L., M.N., A.M.F.), the Department of Molecular and Medical Pharmacology (S.T.R.), and the Department of Microbiology, Immunology and Molecular Genetics (A.J.L.), University of California, Los Angeles, and the School of Medicine (A.G.), Vanderbilt University, Nashville, Tenn.
Correspondence to Srinivasa T. Reddy, PhD, Department of Medicine, and Department of Molecular and Medical Pharmacology, University of California, Los Angeles, 650 Charles E. Young Drive South, A8-131 CHS, Los Angeles, CA 90095. E-mail sreddy{at}mednet.ucla.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Paraoxonase-1 (PON1) is a secreted protein associated primarily with high density lipoprotein (HDL) and participates in the prevention of low density lipoprotein (LDL) oxidation. Two other paraoxonase (PON) family members, namely, PON2 and PON3, have been identified. In this study, we report the cloning and characterization of the human PON3 gene from HepG2 cells. Tissue Northern analysis identifies an
1.3-kb
transcript for PON3 primarily in the liver. PON3-specific peptide
antibodies detect an 40-kDa protein associated with HDL and absent
from LDL. Pretreatment of cultured human aortic
endothelial cells with supernatants from HeLa Tet On
cell lines overexpressing PON3 prevents the formation of mildly
oxidized LDL and inactivates preformed mildly oxidized LDL.
In contrast to PON1, PON3 is not active against the synthetic
substrates paraoxon and phenylacetate. Furthermore, PON3 expression is
not regulated in HepG2 cells by oxidized phospholipids and is not
regulated in the livers of mice fed a high-fat atherogenic
diet.
Key Words: paraoxonase • MM-LDL • PON3 • atherosclerosis • oxidized lipids
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
High density lipoprotein inhibits LDL modification1 2 and abolishes the induction of monocyte chemotactic protein-1 (MCP-1) in arterial wall cells, thus preventing monocyte transmigration.3 HDL-associated enzymes possess antiatherogenic properties that may be due, in part, to their interaction with oxidized LDL. Paraoxonase-1 (PON1, EC 3.1.8.1) is 1 of several enzymes associated with HDL. PON1 is a calcium-dependent ester hydrolase that is tightly associated with apoA-I in HDL.4 Purified PON1 prevents LDL oxidation in vitro,5 and treatment of mildly oxidized LDL (MM-LDL) with purified PON1 significantly reduces the ability of MM-LDL to induce monocyte-endothelial interactions.6 Human epidemiological studies have shown that polymorphisms of the human PON1 gene are correlated with coronary artery disease, indicating a genetic association between PON1 and coronary artery disease.7 8 Mackness et al9 showed that alloenzymes of PON1 determine the effectiveness of HDL in protecting LDL from lipid peroxidation. Mice lacking serum PON1 exhibit increased LDL oxidation in vivo and are more susceptible to atherosclerosis than are wild-type mice.10 11
Two other members of the paraoxonase (PON) gene family,
termed PON2 and PON3, have been
identified.12 It is not known
whether PON2 and PON3 play a role similar to PON1 in the regulation of
atherosclerosis. All 3 PON genes are located adjacent
to each other on chromosome 7 in humans and on chromosome 6 in mice and
seem to be a result of gene duplication. The 3 PON genes share 65%
similarity at the amino acid level. Although the
physiological roles of the corresponding gene
products are still unknown, the ability to hydrolyze paraoxon (PON
activity) and phenylacetate (arylesterase activity) is routinely used
for measuring PON1 activity in vitro and in serum samples. To date,
only PON1 has been purified and characterized from human sources, and
PON and/or arylesterase activities have not been reported for human
PON2 and human PON3. PON1 is expressed primarily in the liver. PON2, on
the other hand, is expressed widely in a number of tissues, including,
brain, liver, kidney, and testis, and may have multiple mRNA
forms.13 PON3 expression in
human tissues has not been reported. Missense variations of PON2 have
also been reported, and significant associations were observed between
PON2 polymorphisms, variation in plasma lipoprotein levels, and
risk for heart
disease.14 15 16 17
To date, there are no reports on polymorphisms in the PON3
gene.
In the present study, we report the cloning and
characterization of human PON3 from HepG2 cells. PON3 is an 40-kDa
protein primarily synthesized in the liver and is associated with HDL
fractions of human plasma. PON3 not only prevents the formation of
MM-LDL but also inhibits MM-LDL–induced monocyte chemotactic activity.
Our data suggest that PON3 is similar to PON1 in its association with
HDL and the prevention of MM-LDL formation or the inactivation of
MM-LDL. However, unlike PON1, PON3 expression is not affected in HepG2
cells by oxidized phospholipids or in the livers of mice by a high-fat
diet.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Materials
Cell culture reagents and oligonucleotides were purchased from GIBCO-BRL. Human tissue blots containing 2 µg of poly A+ RNA in each lane were from Origene Technologies Inc. L-
-1-Palmitoyl-2-arachidonoyl-sn-glycero-3-phosphotidylcholine
(PAPC) was obtained from Avanti Polar Lipids. Oxidized PAPC (ox-PAPC)
was prepared as described
previously.18 Purified PON1
was a generous gift from B.N. La Du (University of Michigan, Ann
Arbor). LDL (density 1.019 to 1.063 g/mL) and HDL (density 1.063 to
1.21 g/mL) were isolated according to the protocol described by Havel
et al19 from the plasma of
normal volunteers after obtaining informed consent according to the
Human Research Subject Protection Committee at the University of
California, Los Angeles (UCLA). LDL and HDL had endotoxin levels <20
pg/mL.
Cell Culture
HepG2 cells were cultured on 0.1% gelatin–coated
plates in EMEM medium containing 10% FBS, 1% nonessential amino
acids, and 1 mmol/L sodium pyruvate. HeLa Tet On cells
(Clontech) were grown in DMEM high glucose containing 10%
tetracycline-free FBS. Human aortic endothelial cells
(HAECs) were isolated and cultured as described
previously.3 Cells
(2x105
cells/cm2) were allowed to grow, forming a
complete monolayer of confluent HAECS in 2 days. HAECS were used at
passage levels 4 to 6. Monocytes were isolated by a modification of the
Recalde method, as previously described by Fogelman et
al,20 from the blood of
normal volunteers after obtaining written consent under a protocol
approved by the Human Research Subject Protection Committee at UCLA.
The 293 cells were cultured in DMEM high glucose containing 10%
FBS.
Cloning of Human PON1 and PON3 From HepG2
Cells
On the basis of the available sequence information in
the NCBI databases, specific primers were designed to amplify
the complete coding sequences of PON1 and PON3. The PON1- and
PON3-specific primers along with HepG2 cell total RNA (1 µg) were
subjected to reverse transcriptase (RT)–polymerase chain reaction
(PCR) by use of the Access RT-PCR system kit from Promega. The upper
and lower primers for human PON1 were 5' ATTAGTCGACGACCATGGCGAAGCTGATT
3' and 5' ATAGTTTAGCGGCCGCTTAGAGCTCACAGTAAAGA 3', respectively, and the
upper and lower primers for human PON3 were 5'
GATTAGTCGACCATGGGGAAGCTCGTGGCGCT 3' and 5'
ATAGTTTAGCGGCCGCTTAGAGCTCACAGTAC 3', respectively. In each set of
primers, the upper primers contained a
SalI restriction site on the
5'end, and the lower primer had a
NotI restriction site on the
3'end. After RT-PCR, the products were identified on agarose gel
and cloned into the pCR II vector with a TOPO TA cloning kit
(Invitrogen). Multiple clones containing the PON1 and PON3 cDNA were
sequenced at the UCLA sequencing core facility. The sequences were
aligned with PON1 and PON3 sequences available in the National Center
for Biotechnology Information databases by using MacVector and
Assemblyalign programs.
SalI-NotI
fragments containing PON1 and PON3 were excised from the TA vectors and
cloned into pGex-6p2 (Amersham Pharmacia Biotech). BL21 bacteria were
transformed with the resulting glutathione S-transferase (GST)
plasmids, and GST fusion proteins were prepared according to the
manufacturer’s protocol. These GST-PON1 and GST-PON3 fusion proteins
were verified by size on polyacrylamide gel. We also cloned the
SalI-NotI
PON1 and PON3 cDNAs into a plasmid containing tetracycline response
element (TRE) to generate pTRE-PON1 and pTRE-PON3, respectively. RT-PCR
amplification of mouse PON3 was performed by using mouse PON3 upper
primer 5' ATCTTGGACCCTCACTGGACTT 3' and mouse PON3 lower primer 5'
ACAGCTTCATGGGGTTAGGGTG 3'.
Antibody Generation and Specificity
Peptides CRNHQSSYQTRLNALREVQ (PON1) and
CRVNASQEVEPVEPEN (PON3) were synthesized at the UCLA peptide synthesis
core facility. Peptides were chosen on the basis of their
hydrophilicity as well as their specificity to the corresponding PON
protein. The cysteine residues in the N-terminus of each peptide are
not part of the original PON1 and PON3 sequences. They were added to
PON1 and PON3 peptides to facilitate conjugation to carrier protein.
Two milligrams of each peptide was conjugated to 2 mg of keyhole
limpet hemocyanin (KLH) by using the Imject
Maleimide–Activated KLH kit (Pierce), and the KLH-conjugated
peptides were purified according to manufacturer’s protocol. Rabbit
polyclonal antibodies against PON1- and PON3-conjugated peptides were
developed at Cocalico Biologicals. Total lysates (5 µg each) from
GST-PON1– and GST-PON3–expressing bacteria were used to determine the
specificity of PON1 and PON3 antibodies. PON1 antibody recognizes the
GST-PON1 protein and not the GST-PON3 protein. Similarly, the PON3
antibody detects the GST-PON3 protein but not the GST-PON1 protein. In
immune-depletion experiments, PON1 and PON3 antibodies preincubated
with 1 µg of PON1- and PON3-specific peptides, respectively, did not
detect their corresponding GST fusion protein. Immune-depletion
experiments in which the PON1 and PON3 antibodies were preincubated
with either the corresponding peptide antigen or GST fusion protein
enabled the identification of mammalian and of expressed PON1 and PON3
proteins on Western blots.
Western Analysis
Appropriate protein samples were reduced in
ß-mercaptoethanol, boiled, electrophoresed on 10% SDS-PAGE gels, and
electroblotted onto Hybond ECL nitrocellulose membranes by using a
semidry transfer apparatus from Bio-Rad. Membranes were
blocked with Tris-buffered saline/5% nonfat dry milk for 60 minutes,
washed, and incubated with primary and secondary antibodies for 2 hours
and 1 hour, respectively. The secondary antibody used was horseradish
peroxidase–conjugated anti-rabbit IgG (Amersham). Primary and
secondary antibodies were used at 1:1000 and 1:4000 dilutions,
respectively. The membranes were washed extensively with Tris-buffered
saline/0.1% Tween after secondary antibody incubation and detected by
using the ECL Western blotting kit (Amersham) according to the
manufacturer’s suggested protocol. To determine the presence of PON1
and PON3 in human lipoproteins, equal amounts of HDL and LDL fractions
(based on cholesterol content, 1.4 µg), isolated by
fast-performance liquid chromatography, were
resolved on SDS-PAGE. Approximately 0.25 µg of purified PON1 and 80
µg of concentrated 293 cell culture supernatants were used as
positive controls for PON1 and PON3,
respectively.
Establishment of HeLa-Tet-PON1 and
HeLa-Tet-PON3 Cell Lines
HeLa Tet On cells (Clontech) were cotransfected with
either pTRE-PON1 or pTRE-PON3 and pBabe-Puro
(puromycin-resistant plasmid) by using Superfect reagent
(Qiagen Inc). The day after transfection, the cultures were given
medium containing 0.1 µg/mL of puromycin. After 10 days,
puromycin-resistant clones were isolated, expanded, and tested
for doxycycline inducibility. Several isolates of HeLa-Tet-PON1 or
HeLa-Tet-PON3 with high doxycycline-inducible expression were pooled
and used for the present study. The cells were treated for 2 days
with 2 µg/mL of doxycycline for induction of PON message and protein.
After induction with doxycycline, supernatants from HeLa-Tet-PON1 and
HeLa-Tet-PON3 cells were collected and concentrated by using
Centricon-10 filters (Millipore). For Western analysis,
cells were lysed in a buffer containing 50 mmol/L Tris (pH 7.5),
100 mmol/L NaCl, 5 mmol/L EDTA, 5 mmol/L sodium
orthovanadate, 1% Triton X-100, and protease
inhibitors.
Northern Analysis
Total RNA from cell cultures was purified by using
the RNeasy kit (Qiagen Inc). Ten micrograms of total RNA from HepG2
cells or 2.5 µg of total RNA from HeLa Tet On cell lines was
subjected to electrophoresis on 1% agarose gel, transferred to
Hybond-N membranes (Amersham Pharmacia Biotech), and hybridized with
cDNA probes for human PON1, PON3, and GAPDH. Electrophoresis and
hybridization protocols have been described
previously.21
Monocyte Chemotaxis Assay and Lipid
Hydroperoxide Measurement
HAECs were plated at
2x105 cells/cm2
and allowed to grow, forming a monolayer of confluent HAECs in 2 days.
To study the formation of MM-LDL by HAECs, confluent cultures were
preincubated for 2 hours with concentrated supernatants from
HeLa-Tet-PON1 and HeLa-Tet-PON3 cells. The cells were washed and
further incubated with native LDL (200 µg of LDL protein/mL) in
medium 199 containing 10% lipoprotein-deficient serum. Fourteen hours
later, supernatants were collected and stored until further
analysis. For monocyte chemotaxis assay, supernatants were
diluted 40-fold and assayed as described
previously.22 The number of
migrated monocytes was determined microscopically and expressed as the
mean±SD of 12 standardized high-power fields counted in quadruplicate
wells. For lipid hydroperoxide content, lipids in supernatants from
HAECs were extracted with chloroform-methanol, and hydroperoxides were
determined by the method reported by Auerbach et
al.23 For MM-LDL inactivation
studies, concentrated supernatants from HeLa-Tet-PON1 and HeLa-Tet-PON3
cell cultures were incubated with MM-LDL for 2 hours, filtered through
300 000–molecular weight cutoff filters, and added to cultured
confluent HAECs. Four hours later, the resulting supernatants were
analyzed for monocyte chemotactic activity and lipid
hydroperoxide content.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cloning and Expression of the Human PON3 Gene
As detailed in Methods, we RT-PCR–amplified and cloned a full-length cDNA encoding human PON3 from HepG2 cells (sequence submitted to GenBank, accession No. AF320003). A human tissue blot probed with PON3 cDNA identifies a band
1.3 kb in size
(Figure 1
). PON3 is expressed primarily in the liver,
although low levels of PON3 message are also detected in the kidney
(Figure 1). The PON3 antiserum identifies an 40-kDa
protein in HepG2 cells (data not shown). Because low levels of PON3
message are also detected in the kidney
(Figure 1), we examined whether the 293 human embryonic
kidney cell line expresses PON3 protein. The PON3 antiserum recognizes
an 40-kDa protein in 293 cell culture supernatants
(Figure 2), which can be competed away with PON3-specific
peptides but not PON1-specific peptides (data not shown). Moreover, in
these experiments, we do not detect any PON1 protein in 293 cell
culture supernatants
(Figure 2). To determine whether PON3 is associated with
human plasma fractions, Western analysis of HDL and LDL
fractions was performed by using anti-PON1 and anti-PON3 antibodies. As
expected, PON1 protein is detected in the HDL fractions of human plasma
but not in the LDL fractions
(Figure 2). PON3 protein is also detected only in the HDL
fractions of human plasma
(Figure 2). Our results suggest that (similar to PON1) PON3
protein is also a secreted protein associated with the HDL fractions of
human plasma but absent in the LDL fractions.
|
|
PON3 Prevents the Formation of MM-LDL and
Inactivates Preformed MM-LDL
We generated stable HeLa Tet On cell lines carrying
doxycycline-inducible PON1 and PON3 cDNA. The resulting cell lines were
designated HeLa-Tet-PON1 and HeLa-Tet-PON3, respectively. Parental HeLa
Tet On cells do not express any detectable PON1 and PON3 mRNA or
protein. PON1 and PON3 messages are induced by doxycycline in
HeLa-Tet-PON1 and HeLa-Tet-PON3 cell lines, respectively
(Figure 3A). Moreover, on induction with doxycycline,
HeLa-Tet-PON1 and HeLa-Tet-PON3 cell lines synthesize PON1 and PON3
proteins, respectively
(Figure 3B).
|
After incubation with HAECs, LDL is modified to become
MM-LDL. The resulting MM-LDL is elevated in lipid hydroperoxide content
and induces monocyte chemotactic activity in target
HAECs.3 22 HDL and
purified PON1 inhibit the modification of LDL by
HAECs.22 HAECs pretreated
with concentrated (10-fold) supernatants containing PON3 protein are
less effective in modifying LDL (as measured by the induction of
monocyte chemotactic activity) than are HAECs pretreated with
concentrated supernatants from uninduced HeLa-Tet-PON3 cells
(Figure 4A). This suggests that (similar to PON1) PON3 also
prevents the modification of LDL by HAECs. Moreover, preformed MM-LDL
incubated with supernatants containing PON3 protein has significantly
lower amounts of lipid hydroperoxides
(Figure 4B, top) and is less effective in inducing monocyte
chemotaxis
(Figure 4B, bottom).
|
PON3 Is Not Regulated by Oxidized
Lipids
PON1 mRNA expression is repressed by ox-PAPC in HepG2
cells24 and in the livers of
mice fed an atherogenic
diet.25 We examined whether
oxidized lipids can also regulate PON3 mRNA expression. PON3 message is
constitutively expressed and, in contrast to PON1, is not affected by
ox-PAPC in HepG2 cells
(Figure 5A). Moreover, unlike PON1, PON3 mRNA is not altered
in the livers of C57BL/6 mice fed an atherogenic diet
(Figure 5B and 5C).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Biochemical Properties and Biological Activities of PON1 and PON3 Proteins
Most of our understanding of PON proteins is derived primarily from studies involving PON1 protein. PON and arylesterase assays are routinely used to determine PON activity in human and animal serum samples. Although a physiological role for PON1 has not been proven, the ability of PON1 to prevent or destroy modifications in LDL is thought to be its prime biological activity in vivo. Interestingly, the arylesterase and PON activities of PON1 appear to be distinct from the ability of PON1 to protect against LDL oxidation, inasmuch as site-directed mutagenesis of the free sulfhydryl–modified Cys283 residue, although leaving its PON and arylesterase activities intact, eliminates its ability to protect LDL from oxidation.26 However, this free-sulfhydryl group may still be important for the structure of the PON1 protein, inasmuch as chemical removal of this group abrogates its PON and arylesterase activities as well as its ability to protect against LDL oxidation.26 Human PON3 protein shares the 3 conserved cysteine residues identified in PON1, suggesting that the free-sulfhydryl residue at Cys283 and the intramolecular disulfide bond linking the other 2 cysteines in PON1 may also be important features of the structure and in vivo activities PON3.
Recent studies attribute a new enzyme activity to PON1 and
PON3 proteins. Kobayashi et
al27 have reported the
cloning of a lactone hydrolase (lactonase) from
Fusarium oxysporum AKU 3702 and
discovered similarities between the lactonase and PON1 gene. While we
were preparing the present article, Draganov et
al28 reported the
purification and characterization of PON3 protein from rabbit serum.
Interestingly, lactonase activity, as well as the lack of significant
PON and arylesterase activities for rabbit PON3, facilitated the
purification and characterization of rabbit serum
PON3.28 We did not test the
supernatants from our PON3-overexpressing cell lines for lactonase
activity. However, in agreement with Draganov et al, we did not find
significant activity against the substrates paraoxon and phenyl acetate
associated with PON3-containing supernatants (data not shown). However,
because the PON and arylesterase activities of PON1 appear to be
distinct from its in vivo ability to protect against LDL
oxidation,26 it is not
surprising that the lack of apparent PON or arylesterase activity in
PON3 does not preclude it from possessing the ability to protect LDL
from oxidation. Indeed, like PON1, we find that PON3 is capable of
preventing the formation of MM-LDL as well as inactivating preformed
MM-LDL
(Figure 4
) but that it apparently lacks detectable
arylesterase and PON activity. Draganov et al have shown that rabbit
PON3 is also associated with the HDL fraction of rabbit serum and that
rabbit PON3 is more effective than is rabbit PON1 in protecting LDL
from copper-induced
oxidation.28 This suggests
that in vivo, PON3 may play a significant atheroprotective role. It
will be interesting to determine the exact spectrum of enzymatic
products resulting from PON3 action on MM-LDL and whether PON1 and
PON3 proteins possibly yield different enzymatic end products. We
are currently preparing purified fractions of human PON3 to further
characterize its enzymatic activities.
PON1 and PON3 proteins share numerous conserved
phosphorylation and N-glycosylation consensus sites.
However, it is not known whether the PON proteins are modified at these
sites or whether modification at any of these sites is required for
activity in vivo. Based on the sequence analysis, the predicted
sizes for human PON1 and PON3 proteins are 38.6 and 39.6, respectively.
However, HDL-associated PON1 runs as an 48-kDa protein, whereas PON3
runs as an 40-kDa protein. This suggests that PON1 may be
significantly posttranslationally modified, especially relative to
PON3.
Localization and Expression of PON3
Protein
We have found that PON3 (similar to PON1) is primarily
localized to the HDL fractions of plasma and that the primary site of
synthesis of the PON1 and PON3 proteins appears to be the liver. It is
likely that PON1 and PON3 synthesis in the liver provides a location
for the insertion of these proteins into nascent HDL particles. It will
be interesting to determine whether the PON1 and PON3 proteins coexist
on the same or different HDL particles. Interestingly, we detected
significant amounts of PON3 mRNA in the kidney and also identified PON3
protein in the supernatants of 293 cell cultures; however, PON1 message
is not detectable in the kidney (data not shown), and PON1 protein is
not expressed in 293 cells
(Figure 2). This suggests that PON3 protein may play a role,
distinct from PON1, in the lipoprotein metabolism of the
kidney.
Regulation of PON3 mRNA
PON1 mRNA expression is significantly repressed during
an acute-phase response in
rabbits,29 in apoA-II
transgenic mice,30 in
C57BL/6J(B6) mice fed an atherogenic
diet,25 29 and in
cultured HepG2 cells treated with the cytokines tumor necrosis
factor and interleukin-131 or
MM-LDL.24 Because, unlike
PON1, PON3 mRNA expression is not altered by either ox-PAPC in HepG2
cells
(Figure 5A) or a high-fat diet in the livers of C57BL/6 mice
(Figure 5B and 5C), PON1 and PON3 may play distinct roles in
the prevention of atherosclerosis. PON3 may provide a
basal constitutive atheroprotective function, whereas the protective
effect of PON1 is more variable, inasmuch as PON1 expression is
repressed by proatherogenic stimuli. Future studies, such as the
generation of PON3 knockout and transgenic mouse models, may determine
whether PON3 activity is required in vivo for the prevention of
atherosclerotic lesion development.
In summary, PON3 is a secreted protein associated with HDL in the plasma and can participate in the prevention of LDL oxidation. These characteristics link PON3 with a group of enzymes, such as PON1, platelet-activating factor–acetyl hydrolase, and lecithin-cholesterol acyltransferase, which together may contribute to the antiatherogenic properties of HDL.
|
Acknowledgments |
|---|
This work was supported by US Public Health Service grant HL-30568, a Tobacco Related Disease Research Project grant from the State of California, and the Laubisch, Castera, and M.K. Gray Fund at UCLA. We thank Reza Khorsan for technical assistance in the characterization of PON1 and PON3 antibodies.
Received December 1, 2000; accepted February 14, 2001.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Parthasarathy S, Barnett J, Fong LG. High density lipoprotein inhibits the oxidative modification of low density lipoprotein. Biochem Biophys Acta.. 1990;1044:275–283.[Medline] [Order article via Infotrieve]
2. Maier JA, Barenghi L, Pagani F, Bradamante S, Comi P, Ragnotti G. The protective role of high-density lipoprotein on oxidized-low-density-lipoprotein-induced U937/endothelial cell interactions. Eur J Biochem.. 1994;221:35–41.[Medline] [Order article via Infotrieve]
3. Navab M, Imes SS, Hama SY, Hough GP, Ross LA, Bork RW, Valente AJ, Berliner JA, Drinkwater DC, Laks H, et al. Monocyte transmigration induced by modification of low density lipoprotein in cocultures of human aortic wall cells is due to induction of monocyte chemotactic protein 1 synthesis and is abolished by high density lipoprotein. J Clin Invest.. 1991;88:2039–2046.
4. La Du BN; Kulow W, ed. Pharmacogenetics of Drug Metabolism. New York, NY: Pergamon Press Inc; 1992:51–91.
5. Mackness MI, Arrol S, Durrington PN. Paraoxonase prevents accumulation of lipoperoxides in low-density lipoprotein. FEBS Lett.. 1991;286:152–154.[Medline] [Order article via Infotrieve]
6. Watson AD, Berliner JA, Hama SY, La Du BN, Faull K, Fogelman AM, Navab M. Protective effect of high density lipoprotein associated paraoxonase: inhibition of the biological activity of minimally oxidized low density lipoprotein. J Clin Invest.. 1995;96:2882–2891.
7.
Odawara M, Tachi Y,
Yamashita K. Paraoxonase polymorphism (Gln192-Arg) is associated
with coronary heart disease in Japanese noninsulin-dependent
diabetes mellitus. J Clin Endocrinol
Metab.. 1997;82:2257–2260.
8. Suehiro T, Nakauchi Y, Yamamoto M, Arii K, Itoh H, Hamashige N, Hashimoto K. Paraoxonase gene polymorphism in Japanese subjects with coronary heart disease. Int J Cardiol.. 1996;57:69–73.[Medline] [Order article via Infotrieve]
9. Mackness MI, Arrol S, Mackness B, Durrington PN. Alloenzymes of paraoxonase and effectiveness of high-density lipoproteins in protecting low-density lipoprotein against lipid peroxidation. Lancet.. 1997;349:851–852.[Medline] [Order article via Infotrieve]
10. Shih DM, Gu L, Xia YR, Navab M, Li WF, Hama S, Castellani LW, Furlong CE, Costa LG, Fogelman AM, et al. Mice lacking serum paraoxonase are susceptible to organophosphate toxicity and atherosclerosis. Nature.. 1998;394:284–287.[Medline] [Order article via Infotrieve]
11.
Shih DM, Xia Y-R,
Wang X-P, Miller E, Castellani LW, Subbanagounder G, Cheroutre H, Faull
KF, Berliner JA, Witztum JL, et al. Combined serum paraoxonase
knockout/apolipoprotein E knockout mice exhibit increased lipoprotein
oxidation and atherosclerosis.
J Biol Chem.. 2000;275:17527–17535.
12. Primo-Parmo SL, Sorenson RC, Teiber J, La Du BN. The human serum paraoxonase/arylesterase gene (PON1) is one member of a multigene family. Genomics.. 1996;33:498–507.[Medline] [Order article via Infotrieve]
13. Mochizuki H, Scherer SW, Xi T, Nickle DC, Majer M, Huizenga JJ, Tsui LC, Prochazka M. Human PON2 gene at 7q21.3: cloning, multiple mRNA forms, and missense polymorphisms in the coding sequence. Gene.. 1998;213:149–157.[Medline] [Order article via Infotrieve]
14. Imai Y, Morita H, Kurihara H, Sugiyama T, Kato N, Ebihara A, Hamada C, Kurihara Y, Shindo T, Oh-hashi Y, et al. Evidence for association between paraoxonase gene polymorphisms and atherosclerotic diseases. Atherosclerosis.. 2000;149:435–442.[Medline] [Order article via Infotrieve]
15. Sanghera DK, Aston CE, Saha N, Kamboh MI. DNA polymorphisms in two paraoxonase genes (PON1 and PON2) are associated with the risk of coronary heart disease. Am J Hum Genet.. 1998;62:36–44.[Medline] [Order article via Infotrieve]
16.
Hegele RA,
Connelly PW, Scherer SW, Hanley AJ, Harris SB, Tsui LC, Zinman B.
Paraoxonase-2 gene (PON2) G148 variant associated with elevated fasting
plasma glucose in noninsulin-dependent diabetes mellitus.
J Clin Endocrinol Metab. 1997;82:3373–3377.
17. Hegele RA, Harris SB, Connelly PW, Hanley AJ, Tsui LC, Zinman B, Scherer SW. Genetic variation in paraoxonase-2 is associated with variation in plasma lipoproteins in Canadian Oji-Cree. Clin Genet. 1998;54:394–399.[Medline] [Order article via Infotrieve]
18.
Watson AD,
Leitinger N, Navab M, Faull KF, Hörkkö S, Witztum JL, Palinski W,
Schwenke D, Salomon RG, Sha W, et al. Structural identification by mass
spectrometry of oxidized phospholipids in minimally oxidized low
density lipoprotein that induce monocyte/endothelial
interactions and evidence for their presence in vivo.
J Biol Chem. 1997;272:13597–13607.
19. Havel RJ, Eder HA, Bragdon JH. The distribution and chemical composition of ultracentrifugally separated lipoproteins of human serum. J Clin Invest. 1955;43:1345–1353.
20. Fogelman AM, Sykes K, Van Lenten BJ, Territo MC, Berliner JA. Modification of the Recalde method for the isolation of human monocytes. J Lipid Res. 1988;29:1243–1247.[Abstract]
21. Reddy ST, Winstead M, Tischfield JA, Herschman HR. Analysis of the secretory phospholipase A2 that mediates prostaglandin production in mast cells. J Biol Chem. 1997;271:13591–13596.
22.
Navab M, Hama SY,
Cooke CJ, Anantharamaiah GM, Chaddha M, Jin L, Subbanagounder G, Faull
KF, Reddy ST, Miller NE, et al. Normal high density lipoprotein
inhibits three steps in the formation of mildly oxidized low density
lipoprotein: step 1. J Lipid
Res. 2000;41:1481–1494.
23. Auerbach BJ, Kiely JS, Cornicelli JA. A spectrophotometric microtiter-based assay for the detection of hydroperoxide derivatives of linoleic acid. Anal Biochem. 1992;201:375–380.[Medline] [Order article via Infotrieve]
24. Navab M, Hama SL, Van Lenten BJ, Fonarow GC, Cardinez CJ, Castellani LW, Brennan ML, Lusis AJ, Fogelman AM, La Du BN. Mildly oxidized LDL induces an increased apolipoprotein J/paraoxonase ratio. J Clin Invest. 1997;99:2005–2019.[Medline] [Order article via Infotrieve]
25. Shih DM, Gu L, Hama S, Xia YR, Navab M, Fogelman AM, Lusis AJ. Genetic-dietary regulation of serum paraoxonase expression and its role in atherogenesis in a mouse model. J Clin Invest. 1996;97:1630–1639.[Medline] [Order article via Infotrieve]
26.
Aviram M, Billecke
S, Sorenson R, Bisgaier C, Newton R, Rosenblat M, Erogul J, Hsu C,
Dunlop C, La Du B. Paraoxonase active site required for protection
against LDL oxidation involves its free-sulfhydryl group and is
different from that required for its arylesterase/paraoxonase
activities. Arterioscler Thromb Vasc
Biol. 1998;18:1617–1624.
27.
Kobayashi M,
Shinohara M, Sakoh C, Kataoka M, Shimizu S. Lactone-ring-cleaving
enzyme: genetic analysis, novel RNA editing, and evolutionary
implications. Proc Natl Acad Sci
U S A. 1998;95:12787–12792.
28.
Draganov DI,
Stetson PL, Watson CE, Billecke SS, La Du BN. Rabbit serum paraoxonase
3 (PON3) is a high density lipoprotein-associated lactonase and
protects low density lipoprotein against oxidation.
J Biol Chem. 2000;275:33435–33442.
29. Van Lenten BJ, Hama SY, de Beer FC, Stafforini DM, McIntyre TM, Prescott SM, La Du BN, Fogelman AM, Navab M. Anti-inflammatory HDL becomes pro-inflammatory during the acute phase response: loss of protective effect of HDL against LDL oxidation in aortic wall cell cocultures. J Clin Invest. 1995;96:2758–2767.
30. Castellani LW, Navab M, Lenten BJ, V, Hendrick CC, Hama SY, Goto AM, Fogelman AM, Lusis AJ. Overexpression of apolipoprotein AII in transgenic mice converts high density lipoprotein to proinflammatory particles. J Clin Invest. 1997;100:464–474.[Medline] [Order article via Infotrieve]
31. Feingold KR, Memon RA, Moser AH, Grunfeld C. Paraoxonase activity in the serum and hepatic mRNA levels decrease during the acute phase response. Atherosclerosis.. 1998;139:307–315.[Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  M. Cesari, E. Marzetti, A. Laudisio, L. Antonica, M. Pahor, R. Bernabei, and G. Zuccala Interaction of HDL cholesterol concentrations on the relationship between physical function and inflammation in community-dwelling older persons Age Ageing, November 5, 2009; (2009) afp194v1. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Romani, G. E. De Medio, S. di Tullio, R. Lapalombella, I. Pirisinu, V. Margonato, A. Veicsteinas, M. Marini, and G. Rosi Modulation of paraoxonase 1 and 3 expression after moderate exercise training in the rat J. Lipid Res., October 1, 2009; 50(10): 2036 - 2045. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Y. Fujimoto, J. P. Kane, B. Y. Ishida, M. S. Bloom, and R. W. Browne High-density lipoprotein metabolism and the human embryo Hum. Reprod. Update, August 28, 2009; (2009) dmp029v2. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z.-G. She, W. Zheng, Y.-S. Wei, H.-Z. Chen, A.-B. Wang, H.-L. Li, G. Liu, R. Zhang, J.-J. Liu, W. B. Stallcup, et al. Human Paraoxonase Gene Cluster Transgenic Overexpression Represses Atherogenesis and Promotes Atherosclerotic Plaque Stability in ApoE-Null Mice Circ. Res., May 22, 2009; 104(10): 1160 - 1168. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Sattler and B. Levkau Sphingosine-1-phosphate as a mediator of high-density lipoprotein effects in cardiovascular protection Cardiovasc Res, May 1, 2009; 82(2): 201 - 211. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Richter, G. P. Jarvik, and C. E. Furlong Determination of Paraoxonase 1 Status Without the Use of Toxic Organophosphate Substrates Circ Cardiovasc Genet, December 1, 2008; 1(2): 147 - 152. [Full Text] [PDF]
|
|
|
|
 |
|
 D J Hausenloy and D M Yellon Targeting residual cardiovascular risk: raising high-density lipoprotein cholesterol levels Postgrad. Med. J., November 1, 2008; 84(997): 590 - 598. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R.W. Browne, W.B. Shelly, M.S. Bloom, A.J. Ocque, J.R. Sandler, H.G. Huddleston, and V.Y. Fujimoto Distributions of high-density lipoprotein particle components in human follicular fluid and sera and their associations with embryo morphology parameters during IVF Hum. Reprod., August 1, 2008; 23(8): 1884 - 1894. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. F. Teiber, S. Horke, D. C. Haines, P. K. Chowdhary, J. Xiao, G. L. Kramer, R. W. Haley, and D. I. Draganov Dominant Role of Paraoxonases in Inactivation of the Pseudomonas aeruginosa Quorum-Sensing Signal N-(3-Oxododecanoyl)-L-Homoserine Lactone Infect. Immun., June 1, 2008; 76(6): 2512 - 2519. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D J Hausenloy and D M Yellon Targeting residual cardiovascular risk: raising high-density lipoprotein cholesterol levels Heart, June 1, 2008; 94(6): 706 - 714. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Bhattacharyya, S. J. Nicholls, E. J. Topol, R. Zhang, X. Yang, D. Schmitt, X. Fu, M. Shao, D. M. Brennan, S. G. Ellis, et al. Relationship of Paraoxonase 1 (PON1) Gene Polymorphisms and Functional Activity With Systemic Oxidative Stress and Cardiovascular Risk JAMA, March 19, 2008; 299(11): 1265 - 1276. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Senol, A. Ersoy, S. Erdinc, E. Sarandol, and M. Yurtkuran Oxidative stress and ferritin levels in haemodialysis patients Nephrol. Dial. Transplant., February 1, 2008; 23(2): 665 - 672. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Levy, K. Trudel, M. Bendayan, E. Seidman, E. Delvin, M. Elchebly, J.-C. Lavoie, L.-P. Precourt, D. Amre, and D. Sinnett Biological role, protein expression, subcellular localization, and oxidative stress response of paraoxonase 2 in the intestine of humans and rats Am J Physiol Gastrointest Liver Physiol, December 1, 2007; 293(6): G1252 - G1261. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Cronin, M. J Greenway, J. H M Prehn, and O. Hardiman Paraoxonase promoter and intronic variants modify risk of sporadic amyotrophic lateral sclerosis J. Neurol. Neurosurg. Psychiatry, September 1, 2007; 78(9): 984 - 986. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Ng, N. Bourquard, S. Y. Hama, D. Shih, V. R. Grijalva, M. Navab, A. M. Fogelman, and S. T. Reddy Adenovirus-Mediated Expression of Human Paraoxonase 3 Protects Against the Progression of Atherosclerosis in Apolipoprotein E-Deficient Mice Arterioscler Thromb Vasc Biol, June 1, 2007; 27(6): 1368 - 1374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. I. Draganov Human PON3, Effects Beyond the HDL: Clues From Human PON3 Transgenic Mice Circ. Res., April 27, 2007; 100(8): 1104 - 1105. [Full Text] [PDF]
|
|
|
|
|
|
D. M. Shih, Y.-R. Xia, X.-P. Wang, S. S. Wang, N. Bourquard, A. M. Fogelman, A. J. Lusis, and S. T. Reddy Decreased Obesity and Atherosclerosis in Human Paraoxonase 3 Transgenic Mice Circ. Res., April 27, 2007; 100(8): 1200 - 1207. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. A. Stoltz, E. A. Ozer, C. J. Ng, J. M. Yu, S. T. Reddy, A. J. Lusis, N. Bourquard, M. R. Parsek, J. Zabner, and D. M. Shih Paraoxonase-2 deficiency enhances Pseudomonas aeruginosa quorum sensing in murine tracheal epithelia Am J Physiol Lung Cell Mol Physiol, April 1, 2007; 292(4): L852 - L860. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. K. Roberts, C. Ng, S. Hama, A. J. Eliseo, and R. J. Barnard Effect of a short-term diet and exercise intervention on inflammatory/anti-inflammatory properties of HDL in overweight/obese men with cardiovascular risk factors J Appl Physiol, December 1, 2006; 101(6): 1727 - 1732. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. J. Ng, N. Bourquard, V. Grijalva, S. Hama, D. M. Shih, M. Navab, A. M. Fogelman, A. J. Lusis, S. Young, and S. T. Reddy Paraoxonase-2 Deficiency Aggravates Atherosclerosis in Mice Despite Lower Apolipoprotein-B-containing Lipoproteins: ANTI-ATHEROGENIC ROLE FOR PARAOXONASE-2 J. Biol. Chem., October 6, 2006; 281(40): 29491 - 29500. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Saeed, N. Siddique, W. Y. Hung, E. Usacheva, E. Liu, R. L. Sufit, S. L. Heller, J. L. Haines, M. Pericak-Vance, and T. Siddique Paraoxonase cluster polymorphisms are associated with sporadic ALS Neurology, September 12, 2006; 67(5): 771 - 776. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Mackness, R. Quarck, W. Verreth, M. Mackness, and P. Holvoet Human Paraoxonase-1 Overexpression Inhibits Atherosclerosis in a Mouse Model of Metabolic Syndrome Arterioscler Thromb Vasc Biol, July 1, 2006; 26(7): 1545 - 1550. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. S. Carlson, P. J. Heagerty, T. S. Hatsukami, R. J. Richter, J. Ranchalis, J. Lewis, T. J. Bacus, L. A. McKinstry, G. D. Schellenberg, M. Rieder, et al. TagSNP analyses of the PON gene cluster: effects on PON1 activity, LDL oxidative susceptibility, and vascular disease J. Lipid Res., May 1, 2006; 47(5): 1014 - 1024. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Ranade, T. G. Kirchgessner, O. A. Iakoubova, J. J. Devlin, T. DelMonte, P. Vishnupad, L. Hui, Z. Tsuchihashi, F. M. Sacks, M. S. Sabatine, et al. Evaluation of the Paraoxonases as Candidate Genes for Stroke: Gln192Arg Polymorphism in the Paraoxonase 1 Gene Is Associated With Increased Risk of Stroke Stroke, November 1, 2005; 36(11): 2346 - 2350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. I. Draganov, J. F. Teiber, A. Speelman, Y. Osawa, R. Sunahara, and B. N. La Du Human paraoxonases (PON1, PON2, and PON3) are lactonases with overlapping and distinct substrate specificities J. Lipid Res., June 1, 2005; 46(6): 1239 - 1247. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Chait, C. Y. Han, J. F. Oram, and J. W. Heinecke Thematic review series: The Immune System and Atherogenesis. Lipoprotein-associated inflammatory proteins: markers or mediators of cardiovascular disease? J. Lipid Res., March 1, 2005; 46(3): 389 - 403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Barter, S. Nicholls, K.-A. Rye, G.M. Anantharamaiah, M. Navab, and A. M. Fogelman Antiinflammatory Properties of HDL Circ. Res., October 15, 2004; 95(8): 764 - 772. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Aharoni, L. Gaidukov, S. Yagur, L. Toker, I. Silman, and D. S. Tawfik Directed evolution of mammalian paraoxonases PON1 and PON3 for bacterial expression and catalytic specialization PNAS, January 13, 2004; 101(2): 482 - 487. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Rosenblat, T. Hayek, K. Hussein, and M. Aviram Decreased Macrophage Paraoxonase 2 Expression in Patients With Hypercholesterolemia Is the Result of Their Increased Cellular Cholesterol Content: Effect of Atorvastatin Therapy Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 175 - 180. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Gouedard, N. Koum-Besson, R. Barouki, and Y. Morel Opposite Regulation of the Human Paraoxonase-1 Gene PON-1 by Fenofibrate and Statins Mol. Pharmacol., April 1, 2003; 63(4): 945 - 956. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Rosenblat, D. Draganov, C. E. Watson, C. L. Bisgaier, B. N. La Du, and M. Aviram Mouse Macrophage Paraoxonase 2 Activity Is Increased Whereas Cellular Paraoxonase 3 Activity Is Decreased Under Oxidative Stress Arterioscler Thromb Vasc Biol, March 1, 2003; 23(3): 468 - 474. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Wang, Z. Fan, J. Huang, S. Su, Q. Yu, J. Zhao, R. Hui, Z. Yao, Y. Shen, B. Qiang, et al. Extensive Association Analysis Between Polymorphisms of PON Gene Cluster With Coronary Heart Disease in Chinese Han Population Arterioscler Thromb Vasc Biol, February 1, 2003; 23(2): 328 - 334. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Rantala, M.-L. Silaste, A. Tuominen, J. Kaikkonen, J. T. Salonen, G. Alfthan, A. Aro, and Y. A. Kesaniemi Dietary Modifications and Gene Polymorphisms Alter Serum Paraoxonase Activity in Healthy Women J. Nutr., October 1, 2002; 132(10): 3012 - 3017. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. Satoh, P. Taylor, W. F. Bosron, S. P. Sanghani, M. Hosokawa, and B. N. L. Du Current Progress on Esterases: From Molecular Structure to Function Drug Metab. Dispos., May 1, 2002; 30(5): 488 - 493. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. S. Ng, G. F. Maguire, J. Wylie, A. Ravandi, W. Xuan, Z. Ahmed, M. Eskandarian, A. Kuksis, and P. W. Connelly Oxidative Stress Is Markedly Elevated in Lecithin:Cholesterol Acyltransferase-deficient Mice and Is Paradoxically Reversed in the Apolipoprotein E Knockout Background in Association with a Reduction in Atherosclerosis J. Biol. Chem., March 29, 2002; 277(14): 11715 - 11720. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. N. La Du Is Paraoxonase-3 Another HDL-Associated Protein Protective Against Atherosclerosis? Arterioscler Thromb Vasc Biol, April 1, 2001; 21(4): 467 - 468. [Full Text] [PDF]
|
|
|
|
|
|
C. J. Ng, D. J. Wadleigh, A. Gangopadhyay, S. Hama, V. R. Grijalva, M. Navab, A. M. Fogelman, and S. T. Reddy Paraoxonase-2 Is a Ubiquitously Expressed Protein with Antioxidant Properties and Is Capable of Preventing Cell-mediated Oxidative Modification of Low Density Lipoprotein J. Biol. Chem., November 21, 2001; 276(48): 44444 - 44449. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||