© 2001 American Heart Association, Inc.
Thrombosis |
Thrombomodulin Promoter Mutations, Venous Thrombosis, and Varicose Veins
From the Service d’Hématologie Biologique A and Service des Maladies Vasculaires (L.L.F., M.L.A., J.E., M.A., M.A.G.), Hôpital Européen Georges Pompidou, AP-HP and Unité INSERM 428, Faculté de Pharmacie, Université René Descartes, and Unité INSERM 258 (M.M., P.Y.S.), Paris, France.
Correspondence to Dr Martine Alhenc-Gelas, Service d’Hématologie Biologique A, Hôpital Européen Georges Pompidou, 20 rue Leblanc, F-75908 Paris Cedex 15, France. E-mail martine.alhenc-gelas{at}egp.ap-hop-paris.fr
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—We analyzed the distal promoter region of the thrombomodulin (TM) gene (nucleotides -300 to -2052) in subjects from the Paris Thrombosis Study (PATHROS), a French case-control study of venous thrombosis, to identify polymorphisms that might modify TM gene expression. Eight novel mutations were found in the 40 DNA samples initially screened. Two of these mutations (-1748G/C and -1208/-1209 del TT) were frequent. One rare transition (-1166G/A) might have functional consequences owing to its position. These 3 mutations were screened for in the entire study population of 327 patients and 398 controls. None of the 3 was significantly associated with thrombosis. Interestingly, the -1208/-1209 TT deletion was associated with varicose veins in the patients. This mutation was in tight linkage disequilibrium with the +1418 C/T change in the coding sequence, a known polymorphism that predicts an Ala 455 Val substitution in the sixth epidermal growth factor–like TM module, a domain previously implicated in the proliferative functions of TM. This linkage suggests that the Ala 455 Val mutation may promote changes in these functions and thus be involved in varicose vein formation.
Key Words: thrombomodulin • thrombosis • coagulation • gene • angiogenesis
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Identification of novel genetic risk factors for venous thromboembolism has led thrombophilia to be considered a multigene disorder. However, thrombotic events in many thrombophilic families remain largely unexplained. The natural anticoagulant protein C/protein S (PC/PS) system contributes largely to the regulation of hemostasis. Thrombin binds to thrombomodulin (TM), an endothelial cell surface glycoprotein receptor, in a stoichiometric 1:1 complex that rapidly activates PC.1 In the presence of its cofactor PS, activated PC degrades the clotting cofactors activated factors Va (FVa) and VIIIa (FVIIIa), thereby downregulating the coagulation cascade. The thrombin-TM complex is also involved in the physiological regulation of fibrinolysis by activating the recently discovered thrombin-activated fibrinolysis inhibitor.2 Genetic defects in components of the PC/PS system are risk factors for venous thrombosis. This is the case of PC and PS gene mutations, as well as the FV Leiden mutation (which modifies the activated PC cleavage site at position 506 of FVa3 ) and the prothrombin gene 20210G/A mutation associated with high levels of circulating prothrombin.4
The TM gene is located on chromosome 20. It spans 6.1 kb and contains no introns. The sequences of the adjacent 5'-(2200 nucleotides) and 3'-flanking regions have been determined.5 6 7 8 Nine point mutations of the coding sequence (nucleotides 127G/A, 129G/C, 236G/C, 543G/A, 1418C/T, 1456G/T, 1483C/T, 1502C/T, and 1689 ins T) have been found in patients with venous or arterial thrombosis,9 10 11 but no clear association with thrombosis has been demonstrated. The promoter region contains several positive and negative regulatory elements for constitutive and modulated expression.8 12 13 14 15 16 Ohlin et al9 recently studied the proximal promoter up to nucleotide -287 (numbering according to Yu et al12 ). No mutations were found in >300 patients with thromboembolism. Three mutations (nucleotides -133C/A, -33G/A, and -9 to -10 GG/AT) were found by Ireland et al17 in 1, 1, and 3 subjects, respectively, among 104 patients with myocardial infarction. The -33G/A mutation was also found in 1 control. Interestingly, both -33G/A mutations were found in Asians, pointing to a polymorphic site in this population. This idea was recently confirmed by Li et al,18 who found a 15% frequency of this mutation in Han Chinese subjects of Mongolian origin. Moreover, Li et al also found evidence that the G-33A mutation was significantly associated with coronary artery disease. In a recent case-control study of venous thromboembolism involving >200 patients and 300 healthy subjects of similar age and sex living in Paris (the Paris Thrombosis Study [PATHROS]), we also found the -33G/A mutation, but no other sequence variations of the proximal promoter were identified. The -33G/A mutation, albeit rare, was slightly more frequent in the patients (0.97%) than in the controls (0.25%). However, transient transfection experiments with unstimulated cultured endothelial cells failed to show a clear association between the -33G/A transition and gene expression.19
The distal promoter of the TM gene (nucleotides -300 to -2052) has not yet been screened in patients with thromboembolism. This region contains a silencer element,15 a putative shear stress–responsive element (SSRE),20 and 4 retinoic acid response elements that could modulate TM promoter activity.8 In the present study, we screened the entire TM promoter region (up to nucleotide -2052) in the PATHROS population for novel polymorphisms that could modify TM gene expression.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Subjects, Blood Sampling, and DNA Preparation
The study population consisted of 327 patients <61 years who had had at least 1 objectively diagnosed episode of deep venous thrombosis and/or pulmonary embolism and 398 controls of similar age and sex. The PATHROS study design has been described elsewhere.19 Varicose veins of the lower limbs were diagnosed by physical examination. As expected, known genetic risk factors for thrombosis, the FV R506Q mutation and the prothrombin gene 20210G/A mutation, and oral contraceptive use (an acquired risk factor for thrombosis) were more frequent in the cases than in the controls (Table 1
). Venous blood (9 vol) was collected onto 0.129
mol/L trisodium citrate (1 vol), and DNA was isolated by the
method described by Miller et
al21 and stored at 4°C.
Plasma was stored at -30°C until
analysis.
|
Plasma Studies
Coagulation activation markers (prothrombin fragment
1+2 [F1+2] and D-dimer) and soluble TM were assayed in plasma from
control subjects by using the Enzygnost F1+2 (Behring),
Asserachrom D-Di (Diagnostica Stago), and Asserachrom TM
(Diagnostica Stago) kits,
respectively.
DNA Studies
For a mutation with an allele frequency of 5%,
the likelihood of detecting at least 1 case of this mutation in a
sample of 40 subjects is 95%. We therefore initially sequenced the TM
promoter regions of the first 40 patients enrolled in PATHROS to
establish the spectrum of "frequent" polymorphisms. We then
used restriction site analysis to study the entire PATHROS
population to determine whether venous thromboembolism was associated
with the 3 novel mutations identified in the 40 subjects, namely, 2
frequent polymorphisms and 1 rare mutation at an interesting
location.
Genomic DNA Studies
Direct Sequencing of the TM Promoter
Region
The TM promoter region (up to nucleotide
-2052) was screened for sequence variations by sequencing the 4
overlapping fragments: 101B/102B (nucleotides -2073 to
-1465), PTM9/302 (nucleotides -1598 to -447), 301/302
(nucleotides -1049 to -466), and 401/402
(nucleotides -526 to +55) after polymerase chain reaction
(PCR) amplification. The PCR mixtures contained 500 ng of genomic DNA,
200 µmol/L dNTPs (Pharmacia Biotech), 30 pmol of each primer, 1x PCR
buffer 1 (10 mmol/L Tris-HCl, 20 mmol/L KCl, pH 8.3) or 1x
PCR buffer 2 [166 mmol/L
(NH4)2SO4,
666 mmol/L Tris-HCl, 67 µmol/L disodium EDTA, 100 mmol/L
mercapto-2-ethanol, and 2 µg/mL bovine serum albumin) and 1 U
of Taq polymerase (Super Taq,
ATGC Biotechnologie) in a final volume of 100 µL. The sequences of
the primers and the specific PCR conditions used to amplify each
fragment are given in
Table 2.
|
Automated cycle sequencing of double-stranded DNA was
performed with the ABI prism dye terminator cycle sequencing ready
reaction kit (Perkin Elmer) according to the manufacturer’s
instructions. The primers used for sequencing were the same as those
used for PCR, except for the PTM9/302 and 301/302 fragments. The
primers used to sequence the PTM9/302 fragment were 201 and 202B
(Table 2
). For 301/302, the reverse sequencing primer was
302, and the forward sequencing primer was changed to 301B (5'
-1034 CGAGCAAGTGGCGTTTCTATG
-1014 3'). The sequencing profiles were
analyzed on an ABI prism 310 or 377 apparatus
(Perkin Elmer).
Restriction Site Analysis
The novel TM promoter mutations identified by
sequencing were verified by restriction site analysis, and the
same method was then used to screen for these mutations in the entire
study population. The sequences of the primers used for amplification
are reported in
Table 2, together with the specific PCR conditions. The
restriction enzymes used and the restriction profiles associated with
these mutations are shown in
Table 3. For 2 mutations (-1084C/T and -1078/-1079
del CC), restriction sites were created in the amplified
fragments by using modified primers (pTM
StuI and pTM
XcmI).
|
The G-33A mutation was screened for as previously
described.19 The
nucleotide 1418 C/T common dimorphism in the TM gene,
responsible for the Ala 455 Val
mutation,9 was also screened
for by digestion after amplification of the region of interest with a
primer modified to introduce a cleavage site for
AflIII in the presence of a T
at position 1418
(Table 2).
Statistical Analysis
Data were analyzed by using
SAS software (SAS Institute
Inc). The frequencies of oral contraceptive use and of the FV Leiden
and prothrombin gene G20210A mutations were compared between the cases
and controls by using the 
2 test. The
2 test was also used to test whether the
genotype distributions in cases and controls were in
Hardy-Weinberg equilibrium. Allele frequencies were deduced from
genotype frequencies. Standard disequilibrium coefficients
(
) were calculated by using likelihood methods.
Characteristics of cases heterozygous for the TM del TT
mutation and those homozygous for the wild-type TM allele were
compared by using Student’s t
test for age and mean follow-up since the first venous thrombosis,
whereas the 2 test was used to compare
the percentage of women, oral contraceptive use, type of venous
thrombosis, and the presence of varicose veins, postthrombotic
syndrome, and known genetic risk factors for thrombosis (FV Leiden,
prothrombin gene G20210A mutation, and PC or PS deficiency). The few
subjects homozygous for the TM del TT mutation were excluded from these
analyses.
Logistic regression analysis was used to determine whether venous thrombosis, varicose veins, and a postthrombotic syndrome were related to the TM gene mutations, with and without adjustment for age and sex. Because of their small number, subjects homozygous for the mutations were combined with heterozygotes for these analyses. The effect of sex, age, and type of venous thrombosis was evaluated by repeating the same analyses in each group separately (men versus women, young versus old, spontaneous versus nonspontaneous venous thrombosis, and first versus recurrent venous thrombosis). ANOVA with adjustment for age, sex, and oral contraceptive use was used to evaluate the mean concentrations of soluble TM, F1+2, and D-dimer by genotype of TM in controls. Differences with a probability value <0.05 were considered statistically significant.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Comparison of the patients’ TM promoter sequences with the sequence published by Dittman et al8 showed 5 differences present in all of the sequences, namely, 2 nucleotide changes (the G at position -827 upstream of the transcription start site proposed by Yu et al12 was replaced by a T, and the G at position -753 was replaced by a C) and 3 insertions of a G at positions -735, -730, and -701. These insertions thus change the numbering upstream of nucleotide -701. For clarity, nucleotides will hereafter be numbered as proposed by Yu et al, followed by the new numbering system in brackets and italics.
The 40 DNA samples initially screened contained 7
substitutions in the TM promoter, namely, the previously identified
nucleotide -33 G/A mutation and 6 novel substitutions
located at positions -1848
[-1851] (C/G), -1799
[-1802] (G/C), -1748
[-1751] (G/C), -1166
[-1169] (G/A), -1084
[-1087] (C/T), and -797
[-800] (C/G). We also found
2 deletions of 2 nucleotides each at positions
-1208/-1209
([-1211/-1212],
del TT) and -1078/-1079
([-1081/-1082],
del CC)
(Table 3). The sequence variations at positions -1748
[-1751] and -1208/-1209
[-1211/-1212]
were frequent: the first was found in the heterozygous state in 10
patients and in the homozygous state in 3 patients, whereas the second
was found in the heterozygous state in 11 patients. These variations
were then screened for in the entire study population
(Table 4).
|
The other variations were rare, being found in the
heterozygous state in 1 patient each. These rare variations did not
modify or create consensus binding sequences for transcription factors
and were unlikely to have functional consequences, except for the
-1166 [-1169] G/A
mutation, which modified the core binding sequence (GACGACC) of a
putative SSRE.20 For this
reason, the only rare novel mutation screened for in the entire study
population was -1166G/A
(Table 4).
The 2 frequent sequence variations, -1748 [-1751] G/C and -1208/-1209 [-1211/-1212] del TT, and the -1166 [-1169] G-to-A transition were in Hardy-Weinberg equilibrium in both the controls and the cases. The mutated alleles were not more frequent in the patients than in the controls: the odds ratios (followed by their 95% confidence intervals) adjusted for age and sex were 0.90 (0.66 to 1.22), 0.92 (0.63 to 1.35), and 0.78 (0.25 to 2.43) for the -1748 [-1751] G/C, -1208/-1209 [-1211/-1212] del TT, and -1166 [-1169] G-to-A mutations, respectively, suggesting that these mutations are not risk factors for thrombosis.
We then investigated whether these mutations influenced
coagulation activation status by measuring activation markers (F1+2 and
D-dimer) in controls. We found significantly higher D-dimer levels in
subjects with the -1748
[-1751] G/C mutation
(Table 5). Nineteen percent of the patients investigated had
varicose veins. As expected, varicose veins were significantly
associated with thrombosis
(P=0.004) and the
postthrombotic syndrome
(P<0.001). Because varicose
veins are characterized by disorganization of vessel wall structure,
which might be associated with altered TM expression, we sought an
association between varicose veins and the 3 mutations. Interestingly,
patients with the del TT allele were more likely to have varicose
veins of the lower limbs than were patients with the wild-type
allele (33% vs 17%,
P=0.007). The relative risk of
varicose veins associated with this mutation was 2.21 (1.11 to 4.38)
after adjustment for age and sex. The other mutations had no
significant effect. Patients with the del TT allele did not differ
significantly from other patients with regard to demographic data,
clinical characteristics, or known genetic risk factors for venous
thrombosis (FV Leiden, prothrombin gene G20210A mutation, and PC or PS
deficiency). The del TT mutation did not increase the risk of recurrent
thrombosis or the postthrombotic syndrome in patients with varicose
veins.
|
To elucidate the association between the del TT mutation and
varicose veins, we sought disequilibrium linkage with another mutation
that truly modulates TM function. We therefore sequenced DNA from the
53 patients heterozygous for the del TT mutation to identify variations
in the cAMP-regulating element located in the 3'-untranslated region of
the TM gene.16 No mutations
were found. We then screened the same subjects for the Ala 455 Val
mutation in the DNA coding sequence, which was also a good candidate,
being frequent9 and located
in a region of the TM protein putatively involved in proliferative
functions.22 Fifty-one
(96%) of the 53 patients heterozygous for the del TT mutation were
also heterozygous for the Ala 455 Val mutation, while the other 2
patients were homozygous for Ala 455 Val. These results suggested a
tight linkage disequilibrium of the del TT mutation and the Ala 455 Val
mutation. We then genotyped the entire study population for
this mutation
(Table 6) and confirmed the tight linkage of the 2 mutations
in cases (=0.983) and controls (=0.895)
(P<0.01). No effect of the del
TT mutation on TM expression was found when soluble TM levels in
control subjects were analyzed according to
genotype.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
We found 8 novel sequence variations in the TM promoter of patients with venous thromboembolism. Six of the novel sequence variations were rare: -1848 [-1851] C/G, -1799 [-1802] G/C, -1166 [-1169] G/A, -1084 [-1087] C/T, -1078/-1079 [-1081/-1082] del CC, and -797 [-800] C/G. Among them, the -1166 [-1169] G/A mutation modified the core binding sequence (GAGACC) of a putative SSRE.20 Recent studies have shown that blood flow and the associated fluid shear stress cause morphological and functional changes in endothelial cells, including up- or downregulation of TM expression,23 24 25 which could involve this SSRE. By impairing this action, the mutation might alter endothelial cell anticoagulant functions and create a thrombotic tendency. However, we found no relationship between this mutation and the risk of thrombosis in the entire PATHROS population (327 patients and 398 controls).
The other 2 novel mutations, -1748 [-1751] G/C and -1208/-1209 [-1211/-1212) del TT, were frequent. The -1748 [-1751] G/C mutation was located in a promoter region shown by Tazawa et al15 to be responsible for positive transcription in transient transfection assays. Moreover, this mutation created a putative Sp1-like responsive element (C-1748TCCGCGTC) with only 1 mismatch relative to the Sp1 binding consensus sequence (C/AC/TCCGC/AT/CT/CC/A). We found a significant association between the -1748 [-1751] G/C mutation and higher plasma D-dimer levels, but no association with the risk of venous thromboembolism.
The del TT mutation did not affect a known regulating element or create a binding sequence for known transcription factors. The del TT allele did not significantly influence levels of coagulation activation markers (F1+2 or D-dimer) in controls, suggesting no direct influence of the del TT allele on thrombin generation. This concept was supported by the absence of any association between this mutation and the risk of thrombosis.
Interestingly, we found a significant association between the del TT allele and varicose veins in the cases of the PATHROS study. No such relationship was found with the other sequence variations. Because the PATHROS study was not designed to identify risk factors for varicose veins, we have no information on the distribution of del TT in controls according to their history of varicose veins.
The role of heredity in the development of varicose veins of the lower limbs has been raised many times in the literature,26 27 but no genetic risk factor had been firmly identified. Varicose veins are characterized by a disorganized state of the vessel wall structure, and blood stasis is involved in their development.28 29 Blood stasis provokes ischemia, thereby decreasing oxygen availability to the tissues. The effect of oxygen privation on endothelial function could be the starting point for a cascade of events leading to endothelial cell activation, profound changes in subendothelial structures with leukocyte infiltration, and proliferation of smooth muscle cells and qualitative and quantitative changes in their functions.
It is not clear how a mutation in the TM promoter could intervene in varicose vein formation. However, we know that TM is expressed on endothelial cells,30 smooth muscle cells,31 and leukocytes32 (the functions of all 3 cell types are modified in varicose veins) and that hypoxia can quantitatively modulate TM expression31 33 34 by mechanisms involving cAMP.35 36 Low intracellular cAMP levels downregulate TM expression at the surface of endothelial cells,37 and a functional cAMP-responsive element has been located in the 3'-untranslated region of the human TM gene.16 TM has been suggested to regulate cell functions, such as proliferation, through mechanisms independent of those regulating hemostasis. An antiproliferative effect of TM has been demonstrated in tumor cells from patients with malignant melanoma, and it has been suggested that the lectin and cytoplasmic domains of TM could be involved in this effect.38 Conversely, TM expression might promote atherosclerosis through mitogenic activity on vascular smooth muscle cells, the epidermal growth factor–like domain of the protein possibly having a juxtacrine mechanism.22 Indeed, this domain has been found to be mitogenic for a fibroblastic cell line.39
The del TT mutation could have a direct or indirect effect
on the level of TM expression at the surface of cells activated
by hypoxia. It has been suggested that in healthy subjects, the
soluble TM level might reflect the quantity of TM expressed on the
endothelial
surface.40 There is also
some evidence to support this hypothesis from a family study of the
mutation 1689 ins T.10 The
del TT mutation was not associated with soluble TM levels in our
control population. A direct effect of this mutation on the level of TM
expression seems doubtful, because it does not create or modify a known
regulating element. The del TT mutation might rather act in tight
linkage disequilibrium with another mutation with functional
consequences. Because this second mutation might be located in the
cAMP-responsive element of the 3'-untranslated
region,16 we sequenced this
region in all of the patients heterozygous for the del TT mutation but
found no sequence variations. The second mutation could also be located
in the epidermal growth factor or lectin domain of the protein, which
have been implicated in cell proliferation. One polymorphism, a
nucleotide 1418C/T change predicting an Ala 455 Val
substitution, has been identified in the sixth epidermal growth
factor–like module. The frequency of the Val allele was 
20%
(16% to 26%) in subjects from the Netherlands, Sweden, and North
America.9 In our study
population, the frequency of the Val allele was 13% in cases and
18% in controls. It has been suggested that the C/T dimorphism could
be neutral with respect to venous thrombophilia and that it might be
involved in the pathogenesis of myocardial infarction, although the
latter hypothesis remains to be confirmed. The observed association
between the Val allele and the del TT allele should now be
explored for its possible involvement in the development of varicose
veins.
Received July 2, 2000; accepted October 27, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Esmon CT. The roles of protein C and thrombomodulin in the regulation of blood coagulation. J Biol Chem. 1989;264:4743–4746.
2. Nesheim M, Wang W, Boffa M, Nagashima M, Morser J, Bajzar L. Thrombin, thrombomodulin, and TAFI in the molecular link between coagulation and fibrinolysis. Thromb Haemost. 1997;78:386–391.[Medline] [Order article via Infotrieve]
3. Lane DA, Mannucci PM, Bauer KA, Bertina RM, Bochkov NP, Boulyjenkov V, Chandy M, Dahlback B, Ginter EK, Miletich JP, Rosendaal FR, Seligsohn U. Inherited thrombophilia, part 1. Thromb Haemost. 1996;76:651–662.[Medline] [Order article via Infotrieve]
4.
Poort SR, Rosendaal
FR, Reitsma PH, Bertina RM. A common genetic variation in the
3'-untranslated region of the prothrombin gene is associated with
elevated plasma prothrombin levels and an increase in venous
thrombosis. Blood. 1996;88:3698–3703.
5. Wen D, Dittman WA, Ye RD, Deaven LL, Majerus PW, Sadler JE. Complete cDNA sequence and chromosome localization of the gene. Biochemistry. 1987;26:4350–4357.[Medline] [Order article via Infotrieve]
6.
Jackman RW, Beeler
DL, Fritze L, Soff G, Rosenberg RD. Human thrombomodulin gene is intron
depleted: nucleic acid sequences of the cDNA and gene predict protein
structure and suggest sites of regulatory control.
Proc Natl Acad Sci
U S A. 1987;84:6425–6429.
7.
Shirai T, Shiojiri
S, Ito H, Yamamoto S, Kusumoto H, Deyashiki Y, Maruyama I, Suzuki K.
Gene structure of human thrombomodulin, a cofactor for
thrombin-catalyzed activation of protein C.
J Biochem. 1988;103:281–285.
8.
Dittman WA, Nelson
SC, Greer PK, Horton ET, Palomba ML, McCachren SS. Characterization of
thrombomodulin expression in response to retinoic acid and
identification of a retinoic acid response element in the human
thrombomodulin gene. J Biol
Chem. 1994;269:16925–16932.
9. Ohlin AK, Nordlund L, Marlar RA. Thrombomodulin gene variations and thromboembolic disease. Thromb Haemost. 1997;78:396–400.[Medline] [Order article via Infotrieve]
10.
Kunz G, Ireland
H, Stubbs P, Kahan M, Coulton GC, Lane DA. Identification and
characterization of a thrombomodulin gene mutation coding for an
elongated protein with reduced expression in a kindred with myocardial
infarction. Blood. 2000;95:569–576.
11. Doggen CJ, Kunz G, Rosendaal FR, Lane DA, Vos HL, Stubbs PJ, Manger Cats V, Ireland H. A mutation in the thrombomodulin gene, 127G-A coding for Ala25Thr, and the risk of myocardial infarction in men. Thromb Haemost. 1998;80:743–748.[Medline] [Order article via Infotrieve]
12.
Yu K, Morioka H,
Fritze LM, Beeler DL, Jackman RW, Rosenberg RD. Transcriptional
regulation of the thrombomodulin gene.
J Biol Chem. 1992;267:23237–23247.
13.
Von der Ahe D,
Nischan C, Kunz C, Otte J, Knies U, Oderwald H, Wasylyk B. Ets
transcription factor binding site is required for positive and
TNF-
-induced negative promoter regulation.
Nucleic Acids Res. 1993;21:5636–5643.
14. Conway EM, Liu L, Nowakowski B, Steiner-Mosonyi M, Jackman RW. Heat shock of vascular endothelial cells induces an up-regulatory transcriptional response of the thrombomodulin gene that is delayed in onset and does not attenuate. J Biol Chem. 1994;239:22804–22810.
15.
Tazawa R,
Hirosawa S, Suzuki K, Hirokawa K, Aoki N. Functional characterization
of the 5'-regulatory region of the human thrombomodulin gene.
J Biochem. 1993;113:600–606.
16. Tazawa R, Yamamoto K, Suzuki K, Hirokawa K, Hirosawa S, Aoki N. Presence of functional cyclic AMP responsive element in the 3'-untranslated region of the human thrombomodulin gene. Biochem Biophys Res Commun. 1994;200:1391–1397.[Medline] [Order article via Infotrieve]
17.
Ireland H, Kunz
G, Kyriakoulis K, Stubbs PJ, Lane DA. Thrombomodulin gene mutations
associated with myocardial infarction.
Circulation. 1997;96:15–18.
18. Li YH, Chen JH, Wu HL, Shi GY, Huang HC, Chao TH, Tsai WC, Tsai LM, Guo HR, Wu WS, Chen ZC. G-33A mutation in the promoter region of thrombomodulin gene and its association with coronary artery disease and plasma soluble thrombomodulin levels. Am J Cardiol. 2000;85:8–12.[Medline] [Order article via Infotrieve]
19.
Le Flem L, Picard
V, Emmerich J, Gandrille S, Fiessinger JN, Aiach M, Alhenc-Gelas M.
Mutations in promoter region of thrombomodulin and venous
thromboembolic disease. Arterioscler
Thromb Vasc Biol. 1999;19:1098–1104.
20. Takada Y, Shinkai F, Kondo S, Yamamoto S, Tsuboi H, Korenaga R, Ando J. Fluid shear stress increases the expression of thrombomodulin by cultured endothelial cells. Biochem Biophys Res Commun. 1994;205:1345–1352.[Medline] [Order article via Infotrieve]
21.
Miller SA, Dykes
DD, Polesky HF. A simple salting out procedure for extracting DNA from
human nucleated cells. Nucleic Acids
Res. 1988;16:1215.
22.
Tohda G, Oida K,
Okada Y, Kosaka S, Okada E, Takahashi S, Ishii H, Miyamori I.
Expression of thrombomodulin in atherosclerotic lesions and
mitogenic activity of recombinant thrombomodulin in
vascular smooth muscle cells. Arterioscler
Thromb Vasc Biol. 1998;18:1861–1869.
23.
Malek AM, Jackman
R, Rosenberg RD, Izumo S. Endothelial expression of
thrombomodulin is reversibly regulated by fluid shear stress.
Circ Res. 1994;74:852–859.
24. Lin MC, Almus-Jacobs F, Chen HH, Parry GCN, Mackman N, Shyy JY-J, Chien S. Shear stress induction of the tissue factor gene. J Clin Invest. 1997;99:737–744.[Medline] [Order article via Infotrieve]
25.
Gosling M,
Golledge J, Turner RJ, Powell JT. Arterial flow conditions
downregulate thrombomodulin on saphenous vein
endothelium.
Circulation. 1999;99:1047–1053.
26. Vanhoutte PM, Corcaud S, de Montrion C. Venous disease: from pathophysiology to quality of life. Angiology. 1997;48:559–567.
27. Cornu-Thenard A, Boivin P, Baud JM, De Vincenzi I, Carpentier PH. Importance of the familial factor in varicose disease: clinical study of 134 families. J Dermatol Surg Oncol. 1994;20:318–326.[Medline] [Order article via Infotrieve]
28. Michiels C, Arnould T, Remacle J. Hypoxia-induced activation of endothelial cells as possible cause of venous diseases: a hypothesis. Angiology. 1993;44:639–646.
29. Michiels C, Arnould T, Thibaut-Vercruyssen R, Bouaziz N, Janssens D, Remacle J. Perfused human saphenous veins for the study of the origin of varicose veins: role of endothelium and hypoxia. Int Angiol. 1997;16:135–141.
30.
Maruyama I, Bell
CE, Majerus PW. Thrombomodulin is found on endothelium
of arteries, veins, capillaries, and lymphatics and on
syncytiotrophoblast of human placenta.
J Cell Biol. 1985;101:363–371.
31. Soff G, Jackman R, Rosenberg R. Expression of thrombomodulin by smooth muscle cells in culture: different effects of tumor necrosis factor and cyclic adenosine monophosphate on thrombomodulin expression by endothelial cells and smooth muscle cells in culture. Blood. 1991;775:515–518.
32.
Conway EM,
Nowakowski B, Steiner-Mosonyi M. Human neutrophils synthesize
thrombomodulin that does not promote thrombin dependent protein C
activation. Blood. 1992;80:1254–1263.
33. Ogawa S, Gerlach H, Esposito C, Pasagian-Macaulay A, Brett J, Stern D. Hypoxia modulates the barrier and coagulant function of cultured bovine endothelium. J Clin Invest. 1990;85:1090–1098.
34. Traynor AR, Cundiff DL, Soff GA. cAMP influence on transcription of thrombomodulin is dependent on de novo synthesis of a protein intermediate: evidence for cohesive regulation of myogenic protein in vascular smooth muscle cells in culture. J Lab Clin Med. 1995;126:316–323.[Medline] [Order article via Infotrieve]
35. Pinsky DJ, Yan SF, Lawson C, Naka Y, Chen JX, Connolly ES Jr, Stern DM. Hypoxia and modification of the endothelium: implications for regulation of vascular homeostatic properties. Semin Cell Biol. 1995;6:283–294.[Medline] [Order article via Infotrieve]
36.
Ogawa S, Koga S,
Karakurum M, Brett J, Morrow B, Morris A, Bilezikian JP,
Joseph-Silverstein J, Stern D. Hypoxia-induced increased
permeability of endothelial monolayers occurs through
lowering of cellular AMPc levels. Am
J Physiol. 1992;262:C546–C554.
37. Dufourcq P, Seigneur M, Pruvost A, Dumain P, Belloc F, Amiral J, Boisseau MR. Membrane thrombomodulin levels are decreased during hypoxia and restored by cAMP and IBMX. Thromb Res. 1994;77:305–310.
38. Zhang Y, Weiler-Guettler H, Chen J, Wilhelm O, Deng Y, Qiu F, Nakagawa K, Klevesath M, Wilhelm S, Böhrer H, Nakagawa M, Graeff H, Martin E, Stern DM, Rosenberg RD, Ziegler R, Nawroth PP. Thrombomodulin modulates growth of tumor cells independent of its anticoagulant activity. J Clin Invest. 1998;101:1301–1309.[Medline] [Order article via Infotrieve]
39.
Hamada H, Ishii
H, Sakyo K, Horie S, Nishiki K, Kazama M. The epidermal growth
factor-like domain of recombinant human thrombomodulin exhibits
mitogenic activity for Swiss 3T3 cells.
Blood. 1995;86:225–233.
40. Salomaa V, Matei C, Aleksic N, Sansores-Garcia L, Folsom AR, Juneja H, Chambless LE, Wu KK. Soluble thrombomodulin as a predictor of incident coronary heart disease and symptomless carotid artery atherosclerosis in the Atherosclerosis Risk in Communities (ARIC) Study: a case-cohort study. Lancet. 1999;353:1729–1734. [Medline] [Order article via Infotrieve]
This article has been cited by other articles:
 |
|
 |
|
  S. Saiki, K. Sakai, M. Saiki, Y. Kitagawa, T. Umemori, K. Murata, M. Matsui, and G. Hirose Varicose veins associated with CADASIL result from a novel mutation in the Notch3 gene. Neurology, July 25, 2006; 67(2): 337 - 339. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-A. Pistorius Chronic Venous Insufficiency: The Genetic Influence Angiology, July 1, 2003; 54(1_suppl): S5 - S12. [Abstract] [PDF]
|
|
|
|
 |
|
 G. Kunz, A.-K. Ohlin, A. Adami, B. Zoller, P. Svensson, and D. A. Lane Naturally occurring mutations in the thrombomodulin gene leading to impaired expression and function Blood, May 15, 2002; 99(10): 3646 - 3653. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||