This Article Abstract Full Text (PDF) Data Supplement Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Madamanchi, N. R. Articles by Runge, M. S. Search for Related Content PubMed PubMed Citation Articles by Madamanchi, N. R. Articles by Runge, M. S.

(Arteriosclerosis, Thrombosis, and Vascular Biology. 2001;21:321.)
© 2001 American Heart Association, Inc.

Vascular Biology

Reactive Oxygen Species Regulate Heat-Shock Protein 70 via the JAK/STAT Pathway

Nageswara R. Madamanchi; Suzhen Li; Cam Patterson; Marschall S. Runge

From the Program in Molecular Cardiology, University of North Carolina, Chapel Hill.

Correspondence to Marschall S. Runge, MD, PhD, Department of Medicine, 3033 Old Clinic Building, CB# 7005, University of North Carolina, Chapel Hill, NC 27599-7005. E-mail mrunge{at}med.unc.edu

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—Reactive oxygen species (ROS) such as hydrogen peroxide (H₂O₂) activate intracellular signal transduction pathways implicated in the pathogenesis of cardiovascular disease. H₂O₂ is a mitogen for rat vascular smooth muscle cells (VSMCs), and protein tyrosine phosphorylation is a critical event in VSMC mitogenesis. Therefore, we investigated whether the mitogenic effects of H₂O₂, such as stimulation of extracellular signal–regulated kinase (ERK)2, are mediated via activation of cytoplasmic Janus tyrosine kinases (JAKs). JAK2 was activated rapidly in VSMCs treated with H₂O₂, and signal transducers and activators of transcription (STAT) STAT1 and STAT3 were tyrosine-phosphorylated and translocated to the nucleus in a JAK2-dependent manner. Inhibition of JAK2 activity with AG-490 partially inhibited H₂O₂-induced ERK2 activity, suggesting that JAK2 is upstream of the Ras/Raf/mitogen-activated protein kinase–ERK/ERK mitogenic pathway. Because heat-shock proteins (HSPs) can protect cells from ROS, we investigated the effect of H₂O₂ on HSP expression. H₂O₂ stimulated HSP70 expression in a time-dependent manner, and AG-490 abolished H₂O₂-induced HSP70 expression. H₂O₂ activated the HSP70 promoter via enhanced binding of STATs to cognate binding sites in the promoter. Regulation of chaperones such as HSP70 via activation of the JAK/STAT pathway suggests that in addition to its growth-promoting effects, this pathway may help VSMCs adapt to oxidative stress.

Key Words: vascular smooth muscle cells • JAK2 • reactive oxygen species • STAT • AG-490

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Accumulating evidence supports a critical role for oxidative stress in the pathogenesis of atherosclerosis, cancer, and other human diseases.¹ High levels of reactive oxygen species (ROS) damage DNA and inactivate proteins,² resulting in chronic cellular dysfunction. Many cell types have also harnessed ROS, albeit in lower concentrations, as intracellular signaling molecules to mediate growth factor and cytokine responses.^{3 4} Modulation of growth responses by ROS has been demonstrated in a number of cell types, including vascular smooth muscle cells (VSMCs).^{5 6} Stimulation of VSMC proliferation by ROS is thought to be a critical step in atherosclerotic lesion formation.⁷

Tyrosine phosphorylation of cellular proteins and the consequent induction of transcription of early-response genes are key determinants of cell growth and differentiation in response to mitogenic signaling.⁸ VSMC mitogens such as platelet-derived growth factor and epidermal growth factor activate receptor protein tyrosine kinases on binding, which stimulate intracellular signaling pathways that result in mitogen-activated protein kinase activation.^{9 10} Other mitogens, such as thrombin and angiotensin II, activate G protein–coupled receptors that do not possess intrinsic tyrosine kinase activity but require tyrosine phosphorylation events to induce mitogenesis.^{11 12 13}

The necessary role for protein tyrosine phosphorylation in mitogenesis elicited by thrombin and ROS indicates that these mitogens may utilize cytoplasmic protein tyrosine kinases in their signaling cascade. Forming 1 such group of tyrosine kinases are Janus kinases (JAKs), which along with their substrates, signal transducers and activators of transcription (STATs), have hitherto been characterized as essential mediators of cytokine and polypeptide hormone-induced signaling.^{8 14} Members of the JAK/STAT pathway mediate at least some biological effects of angiotensin II,¹⁵ platelet-derived growth factor-BB,^{15 16} and endothelial growth factor.¹⁷ Activation of the JAK/STAT pathway has also been observed in response to generation of intracellular ROS¹⁸ and exogenous hydrogen peroxide (H₂O₂).¹⁹ On phosphorylation by JAKs of tyrosine residues, activated STAT dimers translocate to the nucleus to transactivate target gene expression.²⁰

The 70- and 90-kDa heat-shock proteins (HSPs) are among the subset of stress-responsive proteins known to be transactivated by STATs.^{21 22} Elevated levels of HSPs are rapidly synthesized within the cell in response to environmental stresses.²³ Under physiological conditions, constitutively expressed HSPs function as molecular chaperones, whereas under stress conditions, HSPs prevent protein aggregation.²⁴ In addition, HSPs may directly regulate specific stress-responsive signaling pathways and may antagonize signaling cascades that result in apoptosis.²⁵

Because ROS do not directly activate receptor protein tyrosine kinases to exert their mitogenic effects on VSMCs, we investigated the effect of H₂O₂ on the activation of cytoplasmic tyrosine kinases, JAKs, and their substrates, STATs. We show here that H₂O₂ causes activation of JAK2 and subsequent tyrosine phosphorylation and nuclear translocation of STAT1 and STAT3. Our results also indicate that JAK2 partially regulates extracellular signal–regulated kinase (ERK)2 activity and thus, contributes to VSMC proliferation. Furthermore, we demonstrate that the JAK/STAT pathway mediates H₂O₂-induced HSP70 expression, which may help cells adapt to oxidative stress.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Cell Culture and Reagents
VSMCs were isolated from the thoracic aortas of 200- to 250-g male Sprague-Dawley rats. Cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% (vol/vol) calf serum as described previously.¹² VSMCs were growth-arrested by incubation in Dulbecco’s modified Eagle’s medium containing 0.1% calf serum for 72 hours. Antibodies used were as follows: anti-phosphotyrosine (4G10), anti-JAK1, anti-JAK2, anti-TYK2, anti-STAT1, anti-STAT3, and anti-ERK2 (UBI and Santa Cruz Biotechnology); anti-phosphospecific JAK2 (Biosource International); anti-phosphospecific and anti-nonphosphospecific ERK1/2 (New England Biolabs); and anti-HSP70 (Affinity BioReagents). AG-490 was obtained from Calbiochem.

Immunoprecipitation, ERK2 Activity Assay, and Western Blotting
Growth-arrested VSMCs were treated with 200 µmol/L H₂O₂ in the presence or absence of inhibitors for the specified time periods at 37°C. Cell lysates were prepared, and immunoprecipitation, ERK2 activity assay, and Western blotting were performed as described previously.²⁶

Electrophoretic Mobility Shift Assay
Nuclear extracts were prepared from growth-arrested VSMCs that were either left untreated or treated with 200 µmol/L H₂O₂.²⁷ DNA binding was performed by incubating 5 µg of nuclear protein with 100 000 counts per minute of ³²P-labeled, double-stranded HSP70 oligonucleotide (^-122GATCCGGCGAAACCCCTGGAATATTCCCCGACCT^-90) for 20 minutes at room temperature. Canonical double-stranded oligonucleotides for SP1 (5'-ATTCGATCGG-GGCGGGGCGAGC-3') and STAT3 (5'-TGATTACGGGAAATG-3') and a high-affinity, double-stranded STAT1 binding sequence SIEm67 (5'-GATCTGATTACGGGAAATG-3')²⁸ were used in competition studies. For identifying the STAT1-specific band, samples were incubated with STAT1 or STAT3 antibody for 30 minutes before the DNA binding reaction was performed. Protein-DNA complexes were resolved on a 4% polyacrylamide gel.

Transient Transfection and CAT Assay
The HSP70 chloramphenicol acetyltransferase (CAT) reporter constructs LSN (-188 to +1) and LSNP (-100 to +1) were kindly provided by Richard Morimoto (Northwestern University, Evanston, Ill). VSMCs at 70% to 80% confluence were transfected with 10 µg of reporter plasmid DNA by using the calcium precipitate method.²⁶ Cells were cotransfected with ß-galactosidase expression vector to normalize for transfection efficiency and were quiesced for 16 hours after transfection. After quiescence was maintained for 36 hours, cells were either left untreated or treated with 200 µmol/L H₂O₂ for 6 hours. In experiments with AG-490, cells were treated with the inhibitor for 16 hours before H₂O₂ treatment. Cell lysates were prepared,²⁶ and CAT activity was measured by the method of Gorman et al.²⁹ The ß-galactosidase assay was performed by following the manufacturer’s protocol (Promega).

Statistical Analysis
Differences were analyzed with 1-way ANOVA, and post hoc analysis was performed with the Student-Newman-Keuls method. Values of P<0.05 were considered statistically significant.

	Results

Top Abstract Introduction Methods Results Discussion References

 
H₂O₂ Causes Activation of Kinases JAK2 and TYK2 in Rat VSMCs
To test the hypothesis that JAK/STAT pathway activation contributes to the mitogenic effects of ROS on VSMCs, we treated growth-arrested VSMCs with 200 µmol/L H₂O₂, a physiological concentration of this representative ROS that elicits VSMC proliferation.⁶ H₂O₂ caused rapid tyrosine phosphorylation of JAK2, which was sustained for 60 minutes (Figure 1A), but it had no effect on JAK1 phosphorylation (data not shown). JAK2 phosphorylation was biphasic, with peaks at 5 minutes (9.10±2.97-fold increase) and 30 minutes (5.0±1.52-fold increase; Figures 1A, 1B [top], and 1C). A similar biphasic stimulation of various kinases by ROS has been reported, and the second peak has been attributed to the secretion of autocrine factors.³⁰ Tyrosine phosphorylation of JAK2 by H₂O₂ was concentration dependent, and maximum phosphorylation was observed with 200 µmol/L H₂O₂ at 5 minutes (please see http://www.atvb.ahajournals.org). In contrast to JAK2, peak TYK2 tyrosine phosphorylation was observed after a 15-minute exposure to H₂O₂, and TYK2 phosphorylation (3.86±0.64-fold increase) was not as pronounced as that of JAK2 (please see http://atvb.ahajournals.org). H₂O₂ altered tyrosine phosphor- ylation without affecting steady-state protein levels of JAK2 (Figure 1B, bottom) and TYK2 (please see http://atvb.ahajournals.org).

View larger version (29K): [in this window] [in a new window]   Figure 1. H2O2 causes rapid tyrosine phosphorylation of JAK2. Growth-arrested VSMCs were treated with 200 µmol/L H2O2 and harvested in lysis buffer. A, Cell lysates containing equal amounts of protein were immunoprecipitated with anti-phosphotyrosine (PY) antibody (4G10) followed by immunoblotting with anti-JAK2 antibody. B, Cell lysates were immunoblotted with phosphotyrosine-specific anti-JAK2 antibody (top). Western blots (WB) probed with phosphotyrosine-specific anti-JAK2 antibody were reprobed with nonphosphospecific anti-JAK2 antibody (bottom). C, Densitometric analysis of 3 immunoblots, from 3 independent experiments, probed with phosphotyrosine-specific anti-JAK2 antibody (mean±SD).

H₂O₂ Induces Tyrosine Phosphorylation and Nuclear Translocation of STAT1 and STAT3 in Rat VSMCs
To determine whether activation of JAK2 and TYK2 by H₂O₂ leads to activation of STAT proteins, H₂O₂-treated VSMC lysates were immunoprecipitated with an anti-phosphotyrosine antibody, and immunoprecipitates were immunoblotted with antibodies against STAT1/ß or STAT3. Constitutive phosphorylation was lower for STAT1 than for STAT1ß in untreated VSMCs (Figure 2A), but STAT1 phosphorylation was greater than that for STAT1ß after 10 minutes of H₂O₂ treatment. Tyrosine-phosphorylated STAT1/ß were not detectable 15 and 30 minutes after H₂O₂ treatment, and phosphorylated STAT1/ß levels at 60 minutes were much lower than in untreated cells. In broad terms, the biphasic STAT1 phosphorylation corresponded to the biphasic JAK2 phosphorylation, suggesting that the former is dependent on JAK2 activation. STAT1 was rapidly translocated to the nucleus within 5 minutes after H₂O₂ treatment (Figure 2B, top), whereas no detectable change was observed in cytosolic STAT1 protein levels (Figure 2B, bottom). Peak nuclear translocation of STAT1 was observed at 10 minutes (4.03±0.32-fold increase), and in contrast to the tyrosine phosphorylation in immunoprecipitation studies (Figure 2A), was sustained for 60 minutes (Figure 2C). The reason for this discrepancy could be that nuclear fractions may contain some dephosphorylated STAT1. Constitutive tyrosine phosphorylation of STAT3 was observed in growth-arrested VSMCs, and phosphorylation increased within 5 minutes of H₂O₂ treatment and was sustained for 60 minutes (Figure 3A). As with STAT1, rapid nuclear translocation of STAT3 was observed in H₂O₂-treated VSMCs (Figure 3B, top), with no detectable change in protein levels in the cytosolic fractions (Figure 3B, bottom). Peak nuclear STAT3 protein levels were observed at 15 minutes (2.90±0.49-fold increase; Figure 3C) and were sustained for 60 minutes. These experiments demonstrate the phosphorylation and nuclear translocation of STATs in H₂O₂-stimulated VSMCs.

View larger version (19K): [in this window] [in a new window]   Figure 2. Tyrosine phosphorylation and nuclear translocation of STAT1 in response to H2O2. Cell lysates were prepared from growth-arrested VSMCs exposed to 200 µmol/L H2O2. A, Cell lysates containing equal amounts of protein were immunoprecipitated with anti-phosphotyrosine (PY) antibody and analyzed by Western blotting (WB) with anti-STAT1 p84/p91 antibody. B, Nuclear (top) and cytosolic (cytoplasmic, bottom) fractions from H2O2-treated VSMCs were immunoblotted with anti-STAT1 p84/p91 antibody. C, Densitometric analysis of 3 immunoblots of nuclear fractions, from 3 independent experiments, probed with anti-STAT1 p84/p91 antibody (mean±SD).

View larger version (26K): [in this window] [in a new window]   Figure 3. Tyrosine phosphorylation and nuclear translocation of STAT3 in response to H2O2. A, Cell lysates from H2O2-treated VSMCs were immunoprecipitated with anti-phosphotyrosine (PY) antibody, and immunoprecipitates were analyzed by anti-STAT3 Western blotting (WB). B, Nuclear (top) and cytosolic (cytoplasmic, bottom) fractions from H2O2-treated VSMCs were immunoblotted with anti-STAT3 antibody (bottom). C, Densitometric analysis of 3 immunoblots of nuclear fractions, from 3 independent experiments, probed with anti-STAT3 antibody (mean±SD). The asterisks represent significant differences compared with control (P<0.05).

JAK2 Contributes to ERK2 Activation in Response to H₂O₂ in VSMCs
Because ERK1/2 activation is associated with H₂O₂-induced mitogenesis,^{31 32} we investigated the relationship between JAK2 stimulation by H₂O₂ and ERK2 activity. Pretreatment of VSMCs with 50 µmol/L AG-490, a specific JAK2 inhibitor, inhibited H₂O₂-induced JAK2 tyrosine phosphorylation and the consequent phosphorylation of STAT1 and STAT3, whereas it had no effect on c-Src, a non-JAK cytosolic tyrosine kinase (data not shown). Peak ERK2 activity, as measured by an immunocomplex kinase assay, was observed 15 minutes after treatment with H₂O₂ (Figure 4). This increase in ERK2 activation by H₂O₂ is consistent with 1 previous report³² but is contradictory to another³³ ; the reasons for this discrepancy are not clear. H₂O₂-induced ERK2 activation was blocked partially by AG-490 (4.5±1.4-fold increase with H₂O₂ at 15 minutes vs 2.7±0.7 and 1.9±0.4-fold for H₂O₂ in the presence of 10 and 50 µmol/L AG490, respectively), suggesting that JAK2 activation is necessary for H₂O₂-induced ERK2 activation. Partial inhibition of ERK2 activity by a JAK2 antagonist indicates that, along with JAK2-mediated stimulation, there may be an alternative pathway for ERK1/2 activation.

View larger version (25K): [in this window] [in a new window]   Figure 4. AG-490 causes partial inhibition of H2O2-induced ERK2 activation. Growth-arrested VSMCs were pretreated with AG-490 for 16 hours and then treated with 200 µmol/L H2O2. Cell lysates containing equal amounts of protein were immunoprecipitated with nonphosphospecific anti-ERK2 antibody. ERK2 activity was measured through an immunocomplex kinase assay by using myelin basic protein (MBP) as a substrate. Western blot analysis of cell lysates with anti-ERK2 antibody did not show any difference in the amount of ERK2 protein (data not shown). Autoradiograms shown are representative of 3 independent experiments with similar results. DMSO indicates dimethyl sulfoxide.

H₂O₂ Induces HSP70 Expression Through Activation of the JAK/STAT Pathway
Accumulation of RNA for HSPs has been reported during conditions known to produce ROS.³⁴ The 5'-flanking sequences of the HSP70 and HSP90ß genes contain functional binding sites for STATs.²¹ Hence, we investigated whether H₂O₂ causes accumulation of these proteins in rat VSMCs. H₂O₂ stimulated expression of both HSP70 (Figure 5) and HSP90 (data not shown). Because of more pronounced upregulation, we further investigated the expression of HSP70. HSP70 protein levels increased in VSMCs in a time-dependent manner, with a 5.90±0.97-fold increase at 24 hours after 200 µmol/L H₂O₂ treatment (Figures 5A and 5B). Pretreatment of VSMCs with 50 µmol/L AG-490 abolished the increase in HSP70 protein levels induced by H₂O₂ at 24 hours (Figures 5C and 5D; 5.70±0.85 vs 1.40±0.50, P<0.05).

View larger version (14K): [in this window] [in a new window]   Figure 5. AG-490 inhibits H2O2-induced HSP70 protein levels. A, Growth-arrested rat VSMCs were treated with 200 µmol/L H2O2, and HSP70 protein levels were measured by Western blot (WB) analysis with anti-HSP70 antibody. B, Densitometric analysis of 3 immunoblots, from 3 independent experiments, probed with anti-HSP70 antibody (mean±SD). C, Cells were pretreated with AG-490 for 16 hours and then treated with H2O2 for 24 hours. Cell lysates were analyzed by Western blotting with anti-HSP70 antibody. D, Densitometric analysis of 3 immunoblots, from 3 independent experiments, probed with anti-HSP70 antibody (mean±SD). D, The asterisk represents significant differ-ences compared with control, and the double asterisks represent significant difference compared with H2O2 treatment (P<0.05). DMSO indicates dimethyl sulfoxide.

To investigate whether HSP70 expression in VSMCs exposed to H₂O₂ is mediated by the binding of STATs to their responsive element (-122 to -90 bp of the HSP70 promoter), we measured the ability of nuclear proteins from H₂O₂-treated cells to bind an HSP70-STAT oligonucleotide (please see http://www.atvb.ahajournals.org). Nuclear extracts from H₂O₂-treated VSMCs produced 2 shifted bands that were competed with an excess of unlabeled specific oligonucleotide but not with a nonspecific sequence. The faster migrating band was competed with an unlabeled, high-affinity STAT1 binding site (SIEm67 oligonucleotide) from the c-fos promoter, but not with an unlabeled STAT3 consensus sequence, and was abolished by preincubation of the complexes with an anti-STAT1 antibody (but not by an anti-STAT3 antibody), demonstrating the presence of STAT1 protein in this complex. The slower migrating band was partially competed by STAT1 and STAT3 oligonucleotides and partially abolished by anti-STAT1 and anti-STAT3 antibodies, suggesting that it contains a STAT1/STAT3 heterodimer.

H₂O₂ activates the HSP70 promoter in a JAK2-dependent manner. To investigate whether H₂O₂-induced HSP70 expression was mediated via a direct effect on its promoter, VSMCs were transfected with HSP70 promoter-reporter constructs either containing (LSN, -188 to +1) or lacking (LSNP, -100 to +1) a functional STAT binding site. The reporter construct LSN was activated 2.5-fold by 200 µmol/L H₂O₂, whereas transactivation in response to H₂O₂ was lost by deletion of the STAT binding site (Figure 6A). AG-490 inhibited the H₂O₂-induced increase in HSP70 promoter activity, suggesting that STATs require JAK2 activation for activity (Figure 6B). Taken together with the results shown in Figure 5, these findings indicate that H₂O₂ activates the JAK/STAT pathway in VSMCs, which has functional consequences on the expression of physiologically relevant proteins such as HSP70.

View larger version (22K): [in this window] [in a new window]   Figure 6. AG-490 inhibits H2O2-induced HSP70 promoter activity. A, VSMCs were transiently transfected with an HSP70 CAT reporter construct containing (LSN, -188 to +1) or lacking (LSNP, -100 to +1) an STAT binding region or a vector lacking any insert (Vector), growth-arrested, and treated in the presence and absence of 200 µmol/L H2O2 for 6 hours, and cell lysates were prepared. Lysates containing equal amounts of protein were assayed for CAT activity. To normalize for transfection efficiency, cells were also cotransfected with ß-galactosidase construct, and the fold increase in CAT activity was reported. B, VSMCs transfected with HSP70 CAT reporter constructs were growth-arrested, pretreated with AG-490 for 16 hours, and treated with 200 µmol/L H2O2. Autoradiogram shown represents an experiment that was repeated at least twice with similar results. DMSO indicates dimethyl sulfoxide.

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
We have shown that H₂O₂ stimulates specific members of the JAK/STAT pathway, an effect that participates in stress-responsive gene expression. Rapid activation of different JAKs and STATs in response to H₂O₂ has recently been reported in fibroblasts and lymphocytes.^{18 19 35} In this report, we link JAK2 activation by H₂O₂ with STAT phosphorylation and specific transactivation of a STAT-responsive gene promoter.

H₂O₂ stimulates ERK2 activity in VSMCs in a time-dependent manner, with peak activity occurring at 15 to 30 minutes. Inhibition of JAK2 activity by AG-490 pretreatment partially inhibits H₂O₂-stimulated ERK2 activity (Figure 4). In contrast, a temporal shift in ERK1/2 activation was observed in fibroblasts treated with H₂O₂ and AG-490.³⁵ The formation of a Ras/JAK2/Raf-1 complex after JAK2 phosphorylation, resulting in Ras and Raf-1 activation, was initially thought to be a cytokine-induced response.³⁶ Emerging evidence indicates that JAK2 activation is also required for angiotensin II– and platelet-derived growth factor–induced JAK2/Raf-1 complex formation, Raf-1 tyrosine phosphorylation, and ERK1/2 activation.¹⁵ Recently it was reported that H₂O₂-mediated Ras and ERK1/2 activations are partially dependent on JAK2 activity. Based on those findings, it is proposed that JAK2 is upstream of Ras in the Ras/Raf/mitogen-activated protein kinase–ERK/ERK pathway and thus, regulates activation of early growth–response genes and cell proliferation, although a parallel H₂O₂-stimulated pathway independent of JAK2 must also exist to activate ERK1/2.³⁵ Cross-talk between the JAK/STAT and ERK pathways suggests that inhibition of JAK2 activity not only blocks direct tyrosine phosphorylation but can also indirectly inhibit serine phosphorylation of STATs by ERK1/2. Maximal transactivation by STATs requires serine phosphorylation by mitogen-activated protein kinase besides tyrosine phosphorylation.³⁷ On the contrary, ERK1/2 activation inhibits interleukin-6–induced JAK/STAT signaling.³⁸ Further experiments will define the role of ERK1/2 in the activation of STATs by H₂O₂.

Increased HSP70 protein synthesis is seen in cardiovascular tissues exposed to various stressors³⁹ and in VSMCs surrounding the necrotic zones of atherosclerotic plaques.⁴⁰ Enhanced HSP70 protein levels protect against lethal heat stress and ischemia.⁴¹ ROS such as H₂O₂ have pleiomorphic effects on cells, eliciting apoptosis in some cell types⁴² while stimulating early growth–response gene expression and proliferation in others.⁵ The cell types that exhibit proliferative responses likely have adaptive mechanisms to overcome the adverse effects of oxidants. Because HSPs modulate the stress response, we hypothesized that they might be induced in VSMCs exposed to H₂O₂, especially because HSP promoters contain functional STAT binding sites.²¹ Our results demonstrate a time-dependent increase in HSP70 protein levels in VSMCs treated with H₂O₂, which is blocked by pretreatment with AG-490, indicating that this protein is indeed regulated via activation of the JAK/STAT pathway. HSP70 has been reported to promote cell proliferation.⁴³ Oxidative stress–induced HSP90 and cyclophilin may promote VSMC growth.³⁷ These observations suggest that regulation of HSP70 could be 1 of the mechanisms by which the H₂O₂-induced JAK/STAT pathway promotes VSMC growth. Further studies will determine the growth-promoting versus protective effects of HSP70 on H₂O₂-induced VSMC growth.

Our results also indicate that the HSP70 promoter construct containing a functional STAT-binding site is activated by H₂O₂, which is blocked by pretreatment with AG-490. JAK2-mediated phosphorylation of STATs is therefore required for HSP70 promoter activation by H₂O₂. STAT1 is the major protein binding the STAT-responsive element in VSMCs, although it is possible that STAT3 also participates, as STAT3 is rapidly phosphorylated after H₂O₂ treatment and an anti-STAT3 antibody partially competes for H₂O₂-induced binding activity. In addition to STAT binding sites, the HSP70 promoter (LSN, -188 to +1) also has overlapping binding sites for another transcription factor, heat-shock factor-1.²¹ Although we do not specifically address this point, it is possible that heat-shock factor-1 may also be involved in H₂O₂-mediated HSP70 expression in VSMCs. Indeed, significant heat-shock factor-1 activation has been observed in heart tissue perfused with H₂O₂.⁴⁴ Stephanou et al²¹ have shown that overexpression of STAT1 and heat-shock factor-1 has additive effects on HSP70 promoter activity in HepG2 cells and suggest that protein-protein interactions may play a role in transcriptional activity. The demonstration of enhanced HSP70 expression in VSMCs treated with H₂O₂ via the JAK/STAT pathway suggests that, in addition to its growth-promoting effects, this pathway may play a key role in the adaptive response to oxidative stress.

	Acknowledgments

 
We are thankful to Joann Aaron and Chris Horaist for editorial assistance.

	Footnotes

 
This work was supported by National Institutes of Health grants HL57352 and HL61656.

Received October 12, 2000; accepted December 15, 2000.

	References

Top Abstract Introduction Methods Results Discussion References

 

1. Halliwell B. Free radicals, reactive oxygen species and human disease: a critical evaluation with special reference to atherosclerosis. Br J Exp Pathol. 1989;70:737–757.[Medline] [Order article via Infotrieve]
2. Shacter E, Beecham EJ, Covey JM, Kohn KW, Potter M. Activated neutrophils induce prolonged DNA damage in neighboring cells. Carcinogenesis. 1998;9:2297–2304.[Abstract/Free Full Text]
3. Sundaresan M, Yu Z-X, Ferrans VJ, Irani K, Finkel T. Requirement for generation of H₂O₂ for platelet derived growth factor signal transduction. Science. 1995;270:296–299.[Abstract/Free Full Text]
4. Thannickal VJ, Hassoun PM, White AC, Fanburg BL. Enhanced rate of H₂O₂ release from bovine pulmonary artery endothelial cells induced by TGF-ß₁. Am J Physiol. 1993;265:L622–L626.[Abstract/Free Full Text]
5. Duque I, Puyol MR, Ruiz P, Gonzalez I-R, Marques MLD, Puyol DR. Calcium channel blockers inhibit hydrogen-peroxide induced proliferation of cultured rat mesangial cells. J Pharmacol Exp Ther. 1993;267:612–616.[Abstract/Free Full Text]
6. Rao GN, Berk BC. Active oxygen species stimulate vascular smooth muscle cell growth and proto-oncogene expression. Circ Res. 1992;70:593–599.[Abstract/Free Full Text]
7. Griendling KK, Alexander RW. Oxidative stress and cardiovascular disease. Circulation. 1997;96:3264–3265.
8. Larner AC, Finbloom DS. Protein tyrosine phosphorylation as a mechanism which regulates cytokine activation of early response genes. Biochem Biophys Acta. 1995;1266:278–287.[Medline] [Order article via Infotrieve]
9. Arvidsson A-N, Rupp E, Nanberg E, Downward J, Ronnstrand L, Wenstrom S, Schlessinger J, Heldin C-H, Claesson-Welsh L. Tyr-716 in the platelet-derived growth factor ß-receptor kinase insert is involved in Grb-2 binding and Ras activation. Mol Cell Biol. 1994;14:6715–6726.[Abstract/Free Full Text]
10. Ulrich A, Schlessinger J. Signal transduction by receptors with tyrosine kinase activity. Cell. 1990;61:203–212.[Medline] [Order article via Infotrieve]
11. Molloy CJ, Taylor DS, Weber H. Angiotensin II stimulation of rapid protein tyrosine phosphorylation and protein kinase activation in rat aortic smooth muscle cells. J Biol Chem. 1993;268:7338–7345.[Abstract/Free Full Text]
12. Rao GN, Delafontaine P, Runge MS. Thrombin stimulates phosphorylation of insulin like growth factor-1 receptor, insulin receptor substrate-1, and phospholipase C-1 in rat aortic smooth muscle cells. J Biol Chem. 1995;270:27871–27875.[Abstract/Free Full Text]
13. Weiss RH, Nuccitelli R. Inhibition of tyrosine phosphorylation prevents thrombin-induced mitogenesis, but not intracellular calcium release, in vascular smooth muscle cells. J Biol Chem. 1992;267:5608–5613.[Abstract/Free Full Text]
14. Yeh TC, Pelligrini S. The Janus kinase family of protein tyrosine kinases and their role in signaling. Cell Mol Life Sci. 1999;55:1523–1534.[Medline] [Order article via Infotrieve]
15. Marrero MB, Schieffer B, Li B, Sun J, Harp JB, Ling BN. Role of Janus kinase/signal transducer and activator of transcription and mitogen-activated protein kinase cascades in angiotensin II- and platelet-derived growth factor-induced vascular smooth muscle cell proliferation. J Biol Chem. 1997;272:24684–24690.[Abstract/Free Full Text]
16. Choudhury GG, Ghosh-Choudhury N, Abboud HE. Association and direct activation of signal transducer and activator of transcription-1 by platelet-derived growth factor receptor. J Clin Invest. 1998;101:2751–2760.[Medline] [Order article via Infotrieve]
17. Zhong Z, Wen Z, Darnell JE Jr. STAT3: a STAT family member activated by tyrosine phosphorylation in response to epidermal growth factor and interleukin-6. Science. 1994;264:95–98.[Abstract/Free Full Text]
18. Simon AR, Rai U, Fanburg BL, Cochran BH. Activation of the JAK-STAT pathway by reactive oxygen species. Am J Physiol. 1998;275:C1640–C1652.
19. Carballo M, Conde M, Bekay RE, Nieto JM, Camacho MJ, Monteseirin J, Conde J, Bedoya FJ, Sobrino F. Oxidative stress triggers STAT3 tyrosine phosphorylation and nuclear translocation in human lymphocytes. J Biol Chem. 1999;274:17580–17586.[Abstract/Free Full Text]
20. Darnell JE Jr, Kerr IM, Stark GR. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science. 1994;264:1415–1421.[Abstract/Free Full Text]
21. Stephanou A, Isenberg DA, Nakajima K, Latchman DS. Signal transducer and activator of transcription-1 and heat shock factor-1 interact and activate the transcription of the Hsp-70 and HSP-90ß gene promoters. J Biol Chem. 1999;274:1723–1728.[Abstract/Free Full Text]
22. Stephanou A, Latchman DS. Transcriptional regulation of the heat shock protein genes by STAT family transcription factors. Gene Expression. 1999;7:311–319.[Medline] [Order article via Infotrieve]
23. Benjamin IJ, McMillan DR. Stress (heat shock) proteins: molecular chaperones in cardiovascular biology and disease. Circ Res. 1998;83:117–132.[Abstract/Free Full Text]
24. Gething MJ, Sambrook J. Protein folding in the cell. Nature. 1992;355:33–45.[Medline] [Order article via Infotrieve]
25. Mosser DD, Caron AW, Bourget L, Denis-Larose C, Massie B. Role of the human heat shock protein hsp70 in protection against stress-induced apoptosis. Mol Cell Biol. 1997;17:5317–5327.[Abstract]
26. Rao GN, Katki KA, Madamanchi NR, Wu Y, Birrer MJ. JunB forms the majority of the AP-1 complex and is a target for redox regulation by receptor tyrosine kinase and G protein-coupled receptor agonists in smooth muscle cells. J Biol Chem. 1999;274:6003–6010.[Abstract/Free Full Text]
27. Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 1983;11:1475–1489.[Abstract/Free Full Text]
28. Wagner BJ, Hayes TE, Hoban CJ, Cochran BH. The SIF binding element confers sis/PDGF inducibility onto the c-fos promoter. EMBO J. 1990;9:4477–4484.[Medline] [Order article via Infotrieve]
29. Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol. 1982;2:1044–1051.[Abstract/Free Full Text]
30. Liao D-F, Jin Z-G, Baas AS, Daum G, Gygi SP, Aebersold R, Berk BC. Purification and identification of secreted oxidative stress-induced factors from vascular smooth muscle cells. J Biol Chem. 2000;275:189–196.[Abstract/Free Full Text]
31. Pages G, Lenormand P, L’Allemain G, Chambard J, Meloche S, Pouyssegur J. Mitogen-activated protein kinases p42 mapk and p44 mapk are required for fibroblast proliferation. Proc Natl Acad Sci U S A. 1993;90:8319–8323.[Abstract/Free Full Text]
32. Rao GN. Hydrogen peroxide induces complex formation of SHC-Grb2-SOS with receptor tyrosine kinase and activates Ras and extracellular signal-regulated protein kinases group of mitogen-activated protein kinases. Oncogene. 1996;13:713–719.[Medline] [Order article via Infotrieve]
33. Baas AS, Berk BC. Differential activation of mitogen-activated protein kinases by H₂O₂ and O₂^- in vascular smooth muscle cells. Circ Res. 1995;77:29–36.[Abstract/Free Full Text]
34. Plumier J-CL, Robertson HA, Currie RW. Differential accumulation of mRNA for immediate early genes and heat shock genes in heart after ischemic injury. J Mol Cell Cardiol. 1996;28:1251–1260.[Medline] [Order article via Infotrieve]
35. Abe J, Berk BC. Fyn and Jak2 mediate ras activation by reactive oxygen species. J Biol Chem. 1999;274:21003–21010.[Abstract/Free Full Text]
36. Winston LA, Hunter T. Jak2, Ras, and Raf are required for activation of extracellular signal regulated kinase/mitogen-activated protein kinase by growth hormone. J Biol Chem. 1995;270:30837–30840.[Abstract/Free Full Text]
37. Wen Z, Zhong Z, Darnell JE Jr. Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell. 1995;82:241–250.[Medline] [Order article via Infotrieve]
38. Sengupta TK, Talbot ES, Scherle PA, Ivashkiv LB. Rapid inhibition of interleukin-6 signaling and STAT3 activation mediated by mitogen-activated protein kinases. Proc Natl Acad Sci U S A. 1998;95:11107–11112.[Abstract/Free Full Text]
39. Yellon DM, Latchman DS. Stress proteins and myocardial protection. J Mol Cell Cardiol. 1992;24:113–124.[Medline] [Order article via Infotrieve]
40. Johnson AD, Berberian PA, Tytell M, Bond MG. Differential distribution of 70-kD heat shock protein in atherosclerosis: its potential role in arterial SMC survival. Arterioscler Thromb Vasc Biol. 1995;15:27–36.[Abstract/Free Full Text]
41. Cumming DVE, Heads RJ, Watson A, Latchman DS, Yellon DM. Differential protection of primary rat cardiocytes by transfection of specific heat stress proteins. J Mol Cell Cardiol. 1996;28:2343–2349.[Medline] [Order article via Infotrieve]
42. Dumont A, Hehner SP, Hofmann TG, Ueffing M, Dröge W, Schmitz ML. Hydrogen peroxide-induced apoptosis is CD95-independent, requires the release of mitochondria-derived reactive oxygen species and the activation of NF-B. Oncogene. 1999;18:747–757.[Medline] [Order article via Infotrieve]
43. Wei Y, Zhao X, Kariya Y, Teshigawara K, Uchida A. Inhibition of proliferation and induction of apoptosis by abrogation of heat-shock protein (HSP) 70 expression in tumor cells. Cancer Immunol Immunother. 1995;40:73–78.[Medline] [Order article via Infotrieve]
44. Nishizawa J, Nakai A, Matsuda K, Komeda M, Ban T, Nagata K. Reactive oxygen species play an important role in the activation of heat shock factor 1 in ischemic-reperfused heart. Circulation. 1999;99:934–941. [Abstract/Free Full Text]

This article has been cited by other articles:

				T. Araki, J. Langenick, M. Gamper, R. A. Firtel, and J. G. Williams Evidence that DIF-1 and hyper-osmotic stress activate a Dictyostelium STAT by inhibiting a specific protein tyrosine phosphatase Development, April 1, 2008; 135(7): 1347 - 1353. [Abstract] [Full Text] [PDF]

				Y. Yokomaku, T. Sugimoto, S. Kume, S.-i. Araki, K. Isshiki, M. Chin-Kanasaki, M. Sakaguchi, N. Nitta, M. Haneda, D. Koya, et al. Asialoerythropoietin Prevents Contrast-Induced Nephropathy J. Am. Soc. Nephrol., February 1, 2008; 19(2): 321 - 328. [Abstract] [Full Text] [PDF]

				E. M. Hurt, S. B. Thomas, B. Peng, and W. L. Farrar Integrated molecular profiling of SOD2 expression in multiple myeloma Blood, May 1, 2007; 109(9): 3953 - 3962. [Abstract] [Full Text] [PDF]

				P. K. Mehta and K. K. Griendling Angiotensin II cell signaling: physiological and pathological effects in the cardiovascular system Am J Physiol Cell Physiol, January 1, 2007; 292(1): C82 - C97. [Abstract] [Full Text] [PDF]

				K. R. Brunt, K. K. Fenrich, G. Kiani, M. Yat Tse, S. C. Pang, C. A. Ward, and L. G. Melo Protection of Human Vascular Smooth Muscle Cells From H2O2-Induced Apoptosis Through Functional Codependence Between HO-1 and AKT Arterioscler. Thromb. Vasc. Biol., September 1, 2006; 26(9): 2027 - 2034. [Abstract] [Full Text] [PDF]

				I. Kuwahara, E. P. Lillehoj, W. Lu, I. S. Singh, Y. Isohama, T. Miyata, and K. C. Kim Neutrophil elastase induces IL-8 gene transcription and protein release through p38/NF-{kappa}B activation via EGFR transactivation in a lung epithelial cell line Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L407 - L416. [Abstract] [Full Text] [PDF]

				R. E. Clempus and K. K. Griendling Reactive oxygen species signaling in vascular smooth muscle cells Cardiovasc Res, July 15, 2006; 71(2): 216 - 225. [Abstract] [Full Text] [PDF]

				J. I. Mendez, W. J. Nicholson, and W. R. Taylor SOD Isoforms and Signaling in Blood Vessels: Evidence for the Importance of ROS Compartmentalization Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 887 - 888. [Full Text] [PDF]

				N. R. Madamanchi, S.-K. Moon, Z. S. Hakim, S. Clark, A. Mehrizi, C. Patterson, and M. S. Runge Differential Activation of Mitogenic Signaling Pathways in Aortic Smooth Muscle Cells Deficient in Superoxide Dismutase Isoforms Arterioscler. Thromb. Vasc. Biol., May 1, 2005; 25(5): 950 - 956. [Abstract] [Full Text] [PDF]

				B. Xu, G.-h. Dong, H. Liu, Y.-q. Wang, H.-w. Wu, and H. Jing Recombinant Human Erythropoietin Pretreatment Attenuates Myocardial Infarct Size: A Possible Mechanism Involves Heat Shock Protein 70 and Attenuation of Nuclear Factor-kappaB Ann. Clin. Lab. Sci., April 1, 2005; 35(2): 161 - 168. [Abstract] [Full Text] [PDF]

				N. Strunnikova, C. Zhang, D. Teichberg, S. W. Cousins, J. Baffi, K. G. Becker, and K. G. Csaky Survival of Retinal Pigment Epithelium after Exposure to Prolonged Oxidative Injury: A Detailed Gene Expression and Cellular Analysis Invest. Ophthalmol. Vis. Sci., October 1, 2004; 45(10): 3767 - 3777. [Abstract] [Full Text] [PDF]

				E. M. Sandberg and P. P. Sayeski Jak2 Tyrosine Kinase Mediates Oxidative Stress-induced Apoptosis in Vascular Smooth Muscle Cells J. Biol. Chem., August 13, 2004; 279(33): 34547 - 34552. [Abstract] [Full Text] [PDF]

				M. Takano, A. Meneshian, E. Sheikh, Y. Yamakawa, K. B. Wilkins, E. A. Hopkins, and G. B. Bulkley Rapid upregulation of endothelial P-selectin expression via reactive oxygen species generation Am J Physiol Heart Circ Physiol, November 1, 2002; 283(5): H2054 - H2061. [Abstract] [Full Text] [PDF]

				Q. Xu Role of Heat Shock Proteins in Atherosclerosis Arterioscler. Thromb. Vasc. Biol., October 1, 2002; 22(10): 1547 - 1559. [Abstract] [Full Text] [PDF]

				J. M. Carcamo, O. Borquez-Ojeda, and D. W. Golde Vitamin C inhibits granulocyte macrophage-colony-stimulating factor-induced signaling pathways Blood, May 1, 2002; 99(9): 3205 - 3212. [Abstract] [Full Text] [PDF]

				C. Patterson, G. A. Stouffer, N. Madamanchi, and M. S. Runge New Tricks for Old Dogs : Nonthrombotic Effects of Thrombin in Vessel Wall Biology Circ. Res., May 25, 2001; 88(10): 987 - 997. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Data Supplement Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire