Vascular Biology |
From the Department of Medicine (A.N.-J., M.P.S.A., G.N.F., L.B., J.N.) and the Division of Experimental Pathology (I.P.-A.), Department of Laboratory Medicine, Malmö University Hospital, Malmö; the Department of Cell and Molecular Biology (A.H.N.), Lund University, Lund; and the Center for Molecular Medicine (S.-Q.Y., D.-X.B.), Karolinska Institutet, Stockholm, Sweden.
Correspondence to Jan Nilsson, Department of Medicine, Malmö University Hospital, 205 02 Malmö, Sweden. E-mail jan.nilsson{at}medforsk.mas.lu.se
| Abstract |
|---|
|
|
|---|
(TNF-
) has been reported to stimulate growth of cultured human SMCs, but activation of TNF receptors is also known to induce cell death by apoptosis. We report here that SMCs isolated from the neointima of injured rat aortas are characterized by increased expression of TNF-
in response to interleukin-1ß and
-interferon compared with medial SMCs. Basal and serum-stimulated DNA synthesis was higher in intimal than in medial SMCs. In contrast to previous findings on human SMCs, exposure to interleukin-1ß/
-interferon or TNF-
did not affect the growth of rat medial SMCs, inhibited DNA synthesis, and decreased cell numbers in cultures of intimal SMCs. Incubation of intimal SMCs with these cytokines also resulted in induction of terminal dUTP nick end-labeling positivity and caspase-3 expression, suggesting cell death by apoptosis, whereas medial cells were markedly less sensitive in this respect. Cytokine-induced apoptosis in intimal cells was effectively inhibited by treatment with antibodies against TNF receptors. These findings suggest that endogenous activation of TNF receptors may represent a way to limit accumulation of SMCs in injured arteries. This mechanism may also be important in SMC death in advanced atherosclerotic plaques.
Key Words: smooth musclecells apoptosis injury cell replication
| Introduction |
|---|
|
|
|---|
-actin expression, and a more epithelioid morphology than do medial SMCs.2,3 This finding is also in accordance with the observation that vascular activation of transcription factors and growth-regulatory genes by injury is restricted to the media in the immediate phase but thereafter takes place mainly in intimal cells.4 Cells that, during development, lose their functional role are removed by apoptosis.5,6 Apoptosis also is believed to be important for remodeling processes in the adult organism, such as in repair after tissue injury.7 In experimental animals, the induction of intimal SMC replication by mechanical injury is accompanied by neointimal SMC apoptosis.2,8,9 The latter is likely to modulate the repair process and to facilitate the return to normal tissue structure. A high rate of SMC cell death by apoptosis also occurs in advanced atherosclerotic plaques.1013 The pathophysiological role of this phenomenon remains to be fully understood but may be of considerable importance for loss of plaque stability and rupture.
Tumor necrosis factor-
(TNF-
) is a pluripotent mediator of inflammation14 and is expressed in atherosclerotic plaques.15,16 It is also expressed by medial and neointimal SMCs after balloon injury but is absent in the normal vasculature.17,18 In culture, TNF-
stimulates the migration and replication of human SMCs,18 suggesting that it may play a role in the recruitment of SMCs during plaque formation. However, when given together with interleukin-1ß (IL-1ß) and
-interferon (IFN-
), TNF-
has also been shown to induce apoptosis in SMCs.19 Accordingly, TNF-
may contribute to the development, tissue turnover, and stabilization of atherosclerotic lesions by regulating both SMC proliferation and cell death during different stages of atherogenesis. The aim of the present study was to investigate the role of TNF-
in activation of proliferation and cell death in intimal versus medial SMCs.
| Methods |
|---|
|
|
|---|
-smooth muscle actin, and possible contamination by macrophages or endothelial cells was excluded by immunostaining with monoclonal antibodies to ED2 (clone MCA342, Serotec) and von Willebrand factor (clone 2F2-A9, Pharmingen), respectively. Cell cultures were maintained in Dulbeccos modified Eagles medium (DMEM)/10% FCS, 1 mmol/L L-glutamine, 50 U/mL penicillin, and 50 µg/mL streptomycin. Cells from passages 5 to 10 were used for the present studies. Cells were grown in DMEM/F12 medium supplemented with 10% FCS and 100 U/mL penicillin/streptomycin (Gibco). To reach comparable cell densities at 48 hours, intimal SMCs were always seeded at a slightly lower density than were medial cells. Each experiment was performed with an independent analysis of 3 different batches of intimal or medial SMCs. All experiments that compared intimal and medial SMCs were performed in parallel.
Analysis of TNF-
Expression
SMCs were seeded at a density of 15 000 to 20 000 cells per well in 24-well plates (Nunc) and grown to subconfluent density. Great care was taken to adjust these conditions so that there were similar cell densities in medial and intimal cells when serum starvation was started. The cells were serum starved in 0.1% FCS-supplemented F12/DMEM medium for 48 hours and subsequently exposed to rat IFN-
(1 ng/mL, Genzyme), human IL-1ß (100 U/mL, R&D Systems), rat TNF-
(10 ng/mL, R&D Systems), or control medium (0.1% FCS-supplemented F12/DMEM) for 24, 48, and 72 hours. Inhibition assay was performed by the addition of a 1:100 dilution of goat polyclonal anti-rat TNF type 1 receptor and TNF type 2 receptor or a control nonimmune goat IgG (all from Santa Cruz Biotech Inc) to the culture medium 1 hour before treatment.
For quantitative determination of rat TNF-
levels, the Biotrak rat TNF-
ELISA system (Amersham) was used. For this, 1.5 mL culture medium was removed from each cell culture and immediately stored at -70°C. On analysis, samples were thawed on ice and spun at 4000 rpm for 10 minutes at 4°C, after which aliquots (50/µL) from 3 independent samples were added to high-sensitivity rat TNF-
immunoassay plates and read at 450 nm. Analysis and calculation of results were performed according to the manufacturers notes.
DNA Synthesis
SMCs were seeded and grown on 13-mm glass coverslips in 24-well plates as previously described.21 After 48 hours of serum starvation, the cells were incubated in medium containing 2 µCi/mL of Net-355 thymidine 6-3H (NEN Life Science Products Inc) and different concentrations of FCS or cytokines. After 24 hours, the cells were rinsed with PBS, fixed overnight in 3% glutaraldehyde in 0.1 mol/L sodium cocadylate/0.05 mol/L sucrose in PBS, and dehydrated for 10 minutes in 70% ethanol and 95% ethanol. The slides were then dipped in Kodak NTB2 emulsion, air dried, exposed at 4°C for 4 days, developed in Kodak D-19, and stained with methylene blue. The fraction of labeled nuclei was determined by counting at least 300 randomly selected cells on each cover slip.
MTT Assay and Cell Counting
Cytotoxicity was analyzed by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Sigma). MTT was dissolved in DMEM/F12 (1:1, vol/vol) without phenol red at a concentration of 5 mg/mL. An amount of this solution equal to 10% of the culture medium volume was added to the cell cultures. After 1 hour, cultures were removed from the incubator, and the formazan crystals were solubilized by adding solubilization solution (10% vol/vol Triton X-100 and 0.1N HCl in isopropanol) equal to the original culture medium volume. Metabolic activity was quantified by measuring light absorbance at 570 nm. Assessment of cell number was performed in a blinded fashion on PBS-washed, trypsinized, and resuspended SMCs with the Medonic CA470 cell counter. At the beginning of each such measurement, random measurements of cell number were also manually performed in a Bürker chamber.
RT-PCR Analysis
For reverse transcription-polymerase chain reaction (RT-PCR) analysis, RNA extracts were prepared and purified with the total RNA isolation system (Promega). For RNA extraction, cells were washed twice with ice-cold PBS and transferred to a vial after being scraped into and resuspended in 0.6 mL denaturing solution containing citrate/sarcosine/ß-mercaptoethanol and guanidine thiocyanate. To each sample, 0.06 mL of 2 mmol/L sodium acetate, pH 4.0, and 0.6 mL phenol/chloroform/alcohol were added, mixed thoroughly between each addition, and chilled for 15 minutes. The sample was then centrifuged at 10 000 rpm for 20 minutes at 4°C, the top aqueous phase was removed, and to this an equal volume of isopropanol was added. The RNA was precipitated at -20°C overnight, pelleted by centrifugation at 10 000 rpm for 15 minutes at 4°C, resuspended in 0.5-mL denaturing solution, reprecipitated in isopropanol, pelleted again, washed in ice-cold ethanol, recovered by centrifugation, and resuspended in 0.1 mL RNase-free water.
For RT-PCR analysis, 2 µg RNA was added to a 50-µL reagent mixture (10 mmol/L DTT, 0.5 mmol/L dNTP, 1 U/µL RNase I, and 10 U/µL M-MLV reverse transcriptase) and reverse-transcribed by the random-priming method with hexamers. cDNA synthesis was performed in a Perkin-Elmer DNA thermal cycler model 9600 at an initial temperature of 30°C for 10 minutes, 42°C for 50 minutes, and 92°C for 2 minutes. Type I (p55) TNF receptor oligonucleotide primers (sense sequence, ATGTATCGCTACCAACGGTGGA and antisense sequence, GCTGTCGCAAGGATGGGGTCAG) were a kind gift of Prof Y. Shen (Roberts Research Center Sun Health Research Institute, Sun City, Arizona). Analysis of specific rat TNF-
and ß-actin mRNAs by RT-PCR was accomplished by using a Clontech amplimer set. For our purpose, the rat TNF-
amplimer set (5500-3) and rat ß-actin amplimer set (5506-1) were used, and PCR amplification was performed by adding 2 µL of cDNA to 50 µL of reagent mixture (0.2 mmol of dNTP, 2 U Taq polymerase, 1.5 mmol/L MgCl2, buffer, and 0.4 mmol/L of each primer) and amplified by a 27- to 30-step cycle program after denaturation at 94°C for 3 minutes. The type I (p55) TNF receptor cDNA amplification step cycle included 94°C for 1 minute, 56°C for 2 minutes, and 72°C for 3 minutes; the rat TNF-
and rat ß-actin amplification step cycle included 94°C for 45 seconds, 60°C for 45 seconds, and 72°C for 2 minutes. The number of step-cycles was determined by finding the logarithmic phase of cDNA amplification. This step is crucial for a semiquantitative evaluation of mRNA amount. A 15-µL aliquot of each reaction was electrophoresed on a 2% agarose gel, and the bands were analyzed by ethidium bromide staining. Quantification of the bands was performed by using the Kodak Digital Science Electrophoresis Documentation and Analysis System 120 (Kodak). The results are expressed as band intensity ratios: TNF receptor/ß-actin and TNF-
/ß-actin.
Real-Time Quantitative RT-PCR (Taq-Man PCR)
For real-time quantitative RT-PCR, rat intimal and medial SMCs (passages 7 to 9) were cultured and seeded in duplicate or triplicate at a density of 15 000/well in 24-well plates. Cells grown in DMEM with 0.1% FCS for 24 hours were then treated with 1 ng/mL IFN-
plus 100 U/mL IL-1ß for the indicated time. Total RNA was extracted from cells with an Ultraspec reagent (Nordic BioSite AB). The total RNA (1 µg) was incubated with 50 pmol/µL hexanucleotides (pdN6, Pharmacia Biotech AB) at 70°C for 3 minutes and subsequently reverse-transcribed at 25°C for 10 minutes, 42°C for 50 minutes, and 94°C for 4 minutes in the presence of 25 mmol/L dNTP mixture, 0.1 mol/L DTT, 60 U RNasin per 40 µL (Promega Corp), and 400 U Superscript II RT per 40 µL (Life Technologies, Inc) in RT buffer. The cDNAs were stored at -80°C until use.
A 3-µL cDNA sample was amplified in a volume of 25 µL containing 1x TaqManTM buffer; 5 mmol/L MgCl2; 200 µmol/L each of dGTP, dATP, dUTP, and dCTP; 200 µmol/L of each primer; 0.01 U Amp-EraseTM uracil N-glycosylase; 0.05 U Ampli Taq GoldTM (Perkin Elmer/Applied Biosystems); and 0.1 pmol/L probe. The reactions were performed in Micro Amp optical 96-well plates. The following primers and probes were used: (1) primer/probe for TNF-
: forward, 5'GACCCTCACACTCAGATCATCCTTCT-3'; reverse, 5'-ACGCTGGCTCAGCCACTC-3'; probe, 5'TAGCCCA- CGTCGTAGCAAACCACCAA-3'; and (2) primer/probe for ß-actin: forward, 5'-AGAGGGAAATCGTGCGTGAC-3'; reverse, 5'-CAATAGTGATGACCTGGCCGT-3'; probe, 5'-CACTGCCGC- ATCCTCTTCCTCCC-3'. All primers and probes were purchased from Perkin Elmer/Applied Biosystems.
PCR amplification was performed in duplicate (2 minutes at 50°C, 10 minutes at 95°C, 0.15 minute at 95°C, and 1 minute at 60°C for a total of 40 cycles) with an ABI PrismTM 7700 sequence detector (Perkin Elmer/Applied Biosystems). The threshold value of the PCR was assigned at a level corresponding to the exponential phase in the different plates. The quantity of applicant corresponding to the threshold value was calculated against a standard curve. Levels of TNF-
were normalized against ß-actin, and the ratio of TNF-
/ß-actin was presented.
Terminal dUTP Nick End-Labeling (TUNEL)
For detection and quantification of apoptosis at the single-cell level based on labeling of DNA strand breaks, the in situ cell detection kit with fluorescein (Boehringer Mannheim) was used. SMCs were seeded and grown on 13-mm glass coverslips in 24-well plates, treated with cytokines and/or antibody, and fixed for 30 minutes, as previously described. The cells were permeabilized, washed, labeled according to the manufacturers notes; embedded with anti-fade (p-phenylendiamine); and analyzed (blindly) under a fluorescence microscope. Results are presented as the number of labeled cells divided by the total number of cells.
Caspase Activity
Caspase-3 activity was determined with the caspase-3 assay kit (Pharmingen). SMCs were seeded at 90 000 cells/well in 6-well plates, grown to 70% confluence, and serum starved for 24 hours before treatment with cytokine(s) and/or antibody as previously described. At the termination of each experiment, the cells were kept on ice, rinsed with ice-cold PBS, and lysed in 70 µL lysis buffer with 4 mmol/L DTT; from each well, 50 µL was transferred to a 96-well fluorescence plate well (Nunc Fluoronunc Polysorb) containing 200 µL reaction buffer with 4 mmol/L DTT and 5 µL substrate. Caution was taken to remove all PBS before addition of the lysis buffer, fresh DTT was added before each assay, and the samples not assayed immediately were stored at -70°C. The plates were incubated for 60 minutes at 37°C and directly measured at an excitation wavelength of 390 nm and an emission wavelength of 460 nm. Negative control groups included in each reading were as follows: cell lysate without substrate, cell lysate plus substrate plus substrate inhibitor, and finally, cell lysate from nonapoptotic cells plus substrate. Caspase activity was calculated as absorbance value minus value of cell lysate without substrate.
Statistics
Values are given as mean±SD or mean±SEM. Between-group analyses were made with ANOVA and post hoc testing. A value of P<0.05 was considered significant.
| Results |
|---|
|
|
|---|
Growth-arrested intimal and medial SMCs contained none or only minor amounts of TNF-
mRNA transcripts, as assessed by RT-PCR (data not shown). Exposure of the cells to IFN-
/IL-1ß induced a marked increase in TNF-
mRNA levels in both intimal and medial SMCs. However, this increase was significantly greater in intimal than in medial cells (Figure 1).
|
The media from serum-starved control cultures of intimal and medial SMCs contained low amounts of TNF-
as determined by ELISA (8±12 and 10±25 pg/mL, respectively). Addition of IFN-
or IL-1ß to medial cells did not induce additional TNF-
secretion, whereas costimulation with IFN-
and IL-1ß resulted in significant induction of TNF-
(169±25 pg/mL, P<0.05 vs control). In intimal cells, exposure to IFN-
or IL-1ß alone was sufficient to activate a slight increase in TNF-
secretion. In intimal cells exposed to both IFN-
and IL-1ß, a substantial release of TNF-
was observed, which was almost 10-fold higher than that in medial cells exposed to IFN-
and IL-1ß (1496±387 pg/mL, P<0.001 vs control).
The expression of p55 TNF receptors on both medial and intimal cells was confirmed by RT-PCR (Figure 2). There was no difference in p55 receptor mRNA levels in growth-arrested control cultures of medial and intimal cells. Costimulation with IFN-
and IL-1ß increased the expression of p55 receptor mRNA transcripts in both cell types, but the increase was significantly higher in intimal than in medial cells (Figure 2).
|
It has previously been shown that rat aortic SMCs can activate DNA synthesis through an autocrine process involving synthesis of platelet-derived growth factor-AA and that intimal cells are more potent than medial cells in this respect.21,24 These observations suggest the possibility that an increased capacity to produce TNF-
may be involved in the high proliferative capacity of intimal rat SMCs. However, in contrast to this, addition of TNF-
inhibited intimal SMC DNA synthesis (Figure 3) and in serum-free medium, resulted in a loss of cell viability. In medial SMCs, neither TNF-
nor the combined treatment with IFN-
and IL-1ß had any effect on the rate of DNA synthesis. Exposure of intimal SMCs grown in 0.1% FCS to IFN-
/IL-1ß to concentrations that have been shown to activate TNF-
expression was also found to inhibit DNA synthesis (10±5% labeled nuclei vs 46±1% in control cells, P<0.001).
|
In cultures kept in medium containing 0.1% FCS for 48 hours, there was no significant difference in cell numbers between medial and intimal cells. Exposure of the cells to TNF-
or IFN-
/IL-1ß markedly decreased cell numbers in intimal cell cultures (19±7x104 and 16±3x104 cells per well, respectively, vs 29±4x104 cells per well in controls; P<0.05), but did not affect cell number in cultures of medial cells. To analyze the possible activation of apoptosis in response to cytokines, the TUNEL technique was used. In intimal as well as medial SMCs grown in medium containing 0.1% FCS for 48 hours, the frequency of TUNEL-positive cells was <5%. Exposure of intimal SMCs to IFN-
/IL-1ß or TNF-
resulted in a >5-fold increase in the rate of apoptosis, whereas cytokines induced only little apoptosis in medial cells (Figure 4). Addition of blocking antibodies specific for the TNF receptors markedly reduced cytokine-induced TUNEL positivity in intimal cells (Figure 4). In intimal SMC cultures, exposure to IFN-
/IL-1ß or TNF-
also resulted in cell shrinkage and detachment, adding further support to the argument for ongoing cell death by apoptosis (Figure 5), whereas such changes were markedly less frequent in medial SMCs exposed to cytokines.
|
|
The MTT assay of metabolic activity was used as an additional technique for analysis of the effect of cytokines on SMC viability. Exposure of intimal SMCs to IFN-
/IL-1ß for 48 hours reduced MTT levels to 70.9±2.5% of that in control cultures (P<0.0001), whereas no decrease was seen in medial cells. Addition of antibodies against the p55 TNF receptor completely inhibited the MTT-reducing effect of IFN-
/IL-1ß (103.6±6.1% of controls) in intimal SMCs, whereas nonimmune IgG was unable to reverse the decrease in MTT activity caused by cytokines (68.0±4.7%, P<0.0001, compared with control cultures).
To further analyze the possible activation of apoptosis in SMCs exposed to cytokines, activation of the protease caspase-3 was determined. Exposure of intimal SMCs to IFN-
/IL-1ß or TNF-
resulted in a significant increase in caspase-3 activity as determined by ELISA, whereas only a minor increase was observed in medial cells (Figure 6).
|
| Discussion |
|---|
|
|
|---|
and express TNF receptors in response to cytokine stimulation compared with medial SMCs. TNF-
activates cell death by apoptosis in neointimal SMCs, and studies with blocking antibodies suggest that apoptosis induced by IFN-
/IL-1ß involves an autocrine stimulation of TNF receptors. TNF-
does not stimulate DNA synthesis in rat neointimal SMCs and does not appear to be involved in the increased proliferative capacity of these cells. A similar but significantly lower activation of TNF-
and TNF receptor expression, as well as apoptosis, was also observed in medial SMCs exposed to these cytokines.
Balloon injury of rat arteries results in activation of medial SMCs that migrate to the intima, where by proliferation and synthesis of extracellular matrix, they form a thickened neointima.25 There is evidence that SMCs involved in this repair process are recruited from a distinct subpopulation of medial cells. SMCs isolated from the neointima 15 days after injury show decreased smooth muscle
-actin and myosin expression, epithelioid morphology, and increased replicative capacity compared with medial cells.2,22,23,26 Cell lines with similar characteristics have been isolated from rat aortic media.2,23
Experiments with blocking antibodies suggest that fibroblast growth factor plays a role in activation of DNA synthesis in the immediate phase after arterial injury27 and that platelet-derived growth factor is involved primarily in the activation of migration.28 TNF-
is transiently expressed by medial SMCs after injury and subsequently more abundantly by cells in the neointima.17,29 The observation by Tanaka et al17 of a correlation between intimal SMC TNF-
expression and DNA replication suggests that TNF-
may contribute to intimal cell growth. This notion is also supported by the fact that TNF-
is a potent growth factor for human SMCs.30 However, in the present study, we found no evidence that TNF-
is a mitogen for rat SMCs. On the contrary, TNF-
inhibited neointimal SMC DNA synthesis. Interestingly, this effect appeared to be specific for neointimal SMCs and was not observed in cultures of medial cells.
In the neointima of injured rat arteries, the initial phase of cell replication is followed by occurrence of cell death by apoptosis.2,8,9 Our findings indicate that neointimal SMCs are characterized by an increased sensitivity to cytokine-induced apoptosis mediated by increased endogenous TNF-
expression and activation of TNF receptors and that this may serve to limit SMC accumulation in the intima.
The present findings add further support to the notion that TNF-
has an important role in atherosclerosis. TNF-
is expressed in atherosclerotic plaques15,16,31 and has been demonstrated to be functionally important for the development of transplant atherosclerosis.32 It has several biological properties that may influence the development of atherosclerosis. It is a potent activator of endothelial adhesion molecule expression and activates the proinflammatory activities of macrophages.14 In contrast to the present findings, TNF-
functions as a mitogen for growth-arrested human SMCs.30 Interestingly, other studies have shown that TNF-
may stimulate the growth of quiescent cells while inducing apoptosis in rapidly proliferating cells.33 This observation is well in line with the present finding that TNF-
activates apoptosis more in rapidly proliferating neointimal cells than in more slowly replicating medial cells.
The apoptotic effect of TNF-
is mediated by the TNF receptors that activate caspases through the TNF-
receptor-associated death domain protein and the Fas protein associated with the death domain.34 Accordingly, TNF-
, as well as IFN-
/IL-1ß, in concentrations that have been shown to activate endogenous TNF-
expression was found to activate caspase-3 in intimal SMCs. The finding that antibodies against TNF receptors inhibit induction of TUNEL positivity and cause a decrease in MTT levels caused by IFN-
/IL-1ß suggest that this pathway is also involved in cytokine-induced apoptosis of intimal SMCs. Exposure of intimal SMCs to cytokines resulted in a 5-fold increase in TUNEL-positive cells but only a 40% increase in caspase-3 activity. Although no direct linearity may be expected between caspase-3 and TUNEL positivity, this difference may indicate that other apoptotic pathways are also involved. Using a selective inhibitor of the caspase-3 family, Obara et al35 have demonstrated that caspase-3 activation mediates induction of apoptosis in human vascular SMCs. They have also demonstrated that inhibition of nuclear factor-
B by overexpression of I-
B dramatically induces apoptosis in SMCs. Accordingly, differences in nuclear factor-
B activation by TNF-
may also be involved in the differences observed between intimal and medial SMCs in the present study.
In summary, the present study demonstrates an increased TNF-
expression in neointimal SMCs stimulated with IFN-
and IL-1ß. This activation of TNF-
is associated with an increased rate of apoptosis.
| Acknowledgments |
|---|
Received March 3, 2001; accepted August 17, 2001.
| References |
|---|
|
|
|---|
2. Bochaton-Piallat M, Gabbiani F, Gabbiani G. Heterogeneity of rat aortic smooth muscle cell replication during development: correlation with replicative activity after experimental endothelial denudation in adults. J Submicrosc Cytol Pathol. 1994; 26: 18.[Medline] [Order article via Infotrieve]
3. Villaschi S, Nicosia R, Smith M. Isolation of a morphologically and functionally distinct smooth muscle cell type from the intimal aspect of the normal rat aorta: evidence for smooth muscle cell heterogeneity. In Vitro Cell Dev Biol. 1994; 30A: 589595.
4.
Cercek B, Yamashita M, Dimayuga P, Zhu J, Kaul S, Shah PP, Nilsson J, Regnström J. Arterial smooth muscle cells transiently mobilize nuclear factor-
B and express vascular adhesion molecule-1 after balloon injury in rats. Atherosclerosis. 1997; 131: 5966.[Medline]
[Order article via Infotrieve]
5.
Raff MC, Barres BA, Burne JF, Coles HS, Ishizaki Y, Jacobsson MD. Programmed cell death and the control of cell survival: lessons from the nervous system. Science. 1993; 262: 695700.
6. Wyllie AH. The genetic regulation of apoptosis. Curr Opin Genet Dev. 1995; 5: 97104.[Medline] [Order article via Infotrieve]
7. Greenhalgh DG. The role of apoptosis in wound healing. Int J Biochem Cell Biol. 1998; 30: 10191030.[Medline] [Order article via Infotrieve]
8. Bochaton-Piallat M, Gabbiani G, Redard M, Desmouliere A, Gabbiani G. Apoptosis participates in cellularity regulation during rat aortic intimal thickening. Am J Pathol. 1995; 146: 10591064.[Abstract]
9. Han D, Haudenschild C, Hong M, Tinkle B, Leon M, Liau G. Evidence for apoptosis in human atherogenesis and in a rat vascular injury model. Am J Pathol. 1995; 147: 267277.[Abstract]
10. Geng Y-J, Libby P. Evidence for apoptosis in advanced human atheroma: colocalization with interleukin-1ß-converting enzyme. Am J Pathol. 1995; 147: 251266.[Abstract]
11. Crisby M, Kallin B, Thyberg J, Zhivotovsky B, Orrenius S, Kostulas V, Nilsson J. Cell death in atherosclerotic plaques involves both oncosis and apoptosis. Atherosclerosis. 1997; 130: 1727.[Medline] [Order article via Infotrieve]
12.
Kockx M. Apoptosis in the atherosclerotic plaque: quantitative and qualitative aspects. Arterioscler Thromb Vasc Biol. 1998; 18: 15191522.
13.
Bennett M. Apoptosis of vascular smooth muscle cells in vascular remodelling and atherosclerotic plaque rupture. Cardiovasc Res. 1999; 41: 361368.
14.
Beutler B, Cerami A. The biology of TNF-
primary mediator of the host response. Annu Rev Immunol. 1989; 7: 625655.[Medline]
[Order article via Infotrieve]
15. Barath P, Fishbein M, Cao J, Berenson J, Helfant R, Forrester J. Detection and localization of tumour necrosis factor in human atheroma. Am J Pathol. 1990; 65: 297302.
16.
Lei X, Buja L. Detection and localization of tumor necrosis factor-
in WHHL rabbit arteries. Atherosclerosis. 1996; 125: 8189.[Medline]
[Order article via Infotrieve]
17.
Tanaka H, Sukhova G, Schwartz D, Libby P. Proliferating arterial smooth muscle cells after balloon injury express TNF-
but not interleukin-1 or basic fibroblast growth factor. Arterioscler Thromb Vasc Biol. 1996; 16: 1218.
18.
Jovinge S, Hamsten A, Tornvall P, Båvenholm P, Godsland I, Ericsson C-G, de Faire U, Nilsson J. Evidence for a role of tumor necrosis factor-
in disturbances of triglyceride and glucose metabolism predisposing to coronary heart disease. Metabolism. 1998; 47: 113118.[Medline]
[Order article via Infotrieve]
19.
Geng YJ, Wu Q, Muszynski M, Hansson GK, Libby P. Apoptosis of vascular smooth muscle cells induced by in vitro stimulation with interferon-
, tumor necrosis factor-
, and interleukin-1ß. Arterioscler Thromb Vasc Biol. 1996; 16: 1927.
20.
Yan Z, Hansson GK. Overexpression of inducible nitric oxide synthase by neointimal smooth muscle cells. Circ Res. 1998; 82: 2129.
21.
Nilsson J, Sjölund M, Palmberg L, Thyberg J, Heldin C-H. Arterial smooth muscle cells in primary culture produce a platelet-derived growth factor-like protein. Proc Natl Acad Sci U S A. 1985; 82: 44184422.
22.
Orlandi A, Ehrlich H, Ropraz P, Spagnoli L, Gabbiani G. Rat aortic smooth muscle cells isolated from different layers and at different times after endothelial denudation show distinct biological features in vitro. Arterioscler Thromb. 1994; 14: 982989.
23.
Bochaton-Piallat M, Ropratz P, Gabbiani F, Gabbiani G. Phenotypic heterogeneity of rat arterial smooth muscle cell clones: implications for the development of experimental intimal thickening. Arterioscler Thromb Vasc Biol. 1996; 16: 815820.
24. Seifert RA, Schwartz SM, Bowen-Pope DF. Developmentally regulated production of platelet-derived growth factor-like molecules. Nature (London). 1984; 311: 669671.[Medline] [Order article via Infotrieve]
25. Clowes AW, Reidy MA, Clowes MM. Mechanisms of stenosis after arterial injury. Lab Invest. 1983; 49: 208215.[Medline] [Order article via Infotrieve]
26. Kocher O, Gabbiani F, Gabbiani G, Reidy M, Cokay M, Peters H, Huttner I. Phenotypic features of smooth muscle cells during the evolution of experimental carotid artery intimal thickening: biochemical and morphologic studies. Lab Invest. 1991; 65: 459470.[Medline] [Order article via Infotrieve]
27.
Lindner V, Lappi DA, Baird A, Majack RA, Reidy MA. Role of basic fibroblast growth factor in vascular lesion formation. Circ Res. 1991; 68: 106113.
28.
Ferns GA, Raines EW, Sprugel KH, Motani AS, Reidy MA, Ross R. Inhibition of neointimal smooth muscle cell accumulation after angioplasty by an antibody to PDGF. Science. 1991; 253: 11291132.
29.
Jovinge S, Hultgårdh-Nilsson A, Regnström J, Nilsson J. Tumor necrosis factor-
activates smooth muscle cell migration in culture and is expressed in the balloon-injured rat aorta. Arterioscler Thromb Vasc Biol. 1997; 17: 490497.
30.
Jovinge S, Ares M, Kallin B, Nilsson J. Human monocytes/macrophages release TNF-
in response to ox-LDL. Arterioscler Thromb Vasc Biol. 1997; 17: 15731579.
31.
Rus H, Niculescu F, Vlaicu R. Tumor necrosis factor-
in human arterial wall with atherosclerosis. Atherosclerosis. 1991; 89: 247254.[Medline]
[Order article via Infotrieve]
32.
Tanaka H, Swanson S, Sukhova G, Schoen F, Libby P. Smooth muscle cells of the coronary arterial tunica media express tumor necrosis factor-
and proliferate during acute rejection of rabbit cardiac allografts. Am J Pathol. 1995; 147: 617626.[Abstract]
33.
Baxter GT, Kuo RC, Jupp OJ, Vandenabeele P, MacEwan DJ. Tumor necrosis factor-
mediates both apoptotic cell death and cell proliferation in a human hematopoietic cell line dependent on mitotic activity and receptor subtype expression. J Biol Chem. 1999; 274: 95399547.
34. Baker SJ, Reddy EP. Modulation of life and death by the TNF receptor superfamily. Oncogene. 1998; 17: 32613270.[Medline] [Order article via Infotrieve]
35.
Obara H, Takayanagi A, Hirahashi J, Tanaka K, Wakabayashi G, Matsumoto K, Shimazu M, Shimizu N, Kitajima M. Overexpression of truncated I
-B
induces TNF-
-dependent apoptosis in human vascular smooth muscle cells. Arterioscler Thromb Vasc Biol. 2000; 20: 21982204.
This article has been cited by other articles:
![]() |
W. J Mach, A. R Knight, J. A Orr, and J. D Pierce Apoptosis and haemorrhagic shock Journal of Research in Nursing, January 1, 2009; 14(1): 77 - 88. [Abstract] [PDF] |
||||
![]() |
S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wei, A. T. Whaley-Connell, K. Chen, J. Habibi, G. M.-E. Uptergrove, S. E. Clark, C. S. Stump, C. M. Ferrario, and J. R. Sowers NADPH Oxidase Contributes to Vascular Inflammation, Insulin Resistance, and Remodeling in the Transgenic (mRen2) Rat Hypertension, August 1, 2007; 50(2): 384 - 391. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Tellides and J. S. Pober Interferon-{gamma} Axis in Graft Arteriosclerosis Circ. Res., March 16, 2007; 100(5): 622 - 632. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. K. Bhatia, S. Yun, V. Leung, D. C. Grimsditch, G. M. Benson, M. B. Botto, J. J. Boyle, and D. O. Haskard Complement C1q Reduces Early Atherosclerosis in Low-Density Lipoprotein Receptor-Deficient Mice Am. J. Pathol., January 1, 2007; 170(1): 416 - 426. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Tang, A. Dhirapong, A. P. Yabes, and R. H. Weiss TNF-{alpha}-mediated apoptosis in vascular smooth muscle cells requires p73 Am J Physiol Cell Physiol, July 1, 2005; 289(1): C199 - C206. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, D. Li, X. Zhang, and J. L. Mehta Tumor Necrosis Factor-{alpha}-Induced Apoptosis of Human Coronary Artery Endothelial Cells: Modulation by the Peroxisome Proliferator-Activated Receptor-{gamma} Ligand Pioglitazone Journal of Cardiovascular Pharmacology and Therapeutics, March 1, 2004; 9(1): 35 - 41. [Abstract] [PDF] |
||||
![]() |
K. V. Ramana, D. Chandra, S. Srivastava, A. Bhatnagar, B. B. Aggarwal, and S. K. Srivastava Aldose Reductase Mediates Mitogenic Signaling in Vascular Smooth Muscle Cells J. Biol. Chem., August 23, 2002; 277(35): 32063 - 32070. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2001 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |