Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2001;21:1662-1667
doi: 10.1161/hq1001.096625
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dansky, H. M.
Right arrow Articles by Smith, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dansky, H. M.
Right arrow Articles by Smith, J. D.
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2001;21:1662.)
© 2001 American Heart Association, Inc.


Atherosclerosis and Lipoproteins

Adhesion of Monocytes to Arterial Endothelium and Initiation of Atherosclerosis Are Critically Dependent on Vascular Cell Adhesion Molecule-1 Gene Dosage

Hayes M. Dansky; Courtenay B. Barlow; Chris Lominska; John L. Sikes; Catherine Kao; Jonathan Weinsaft; Myron I. Cybulsky; Jonathan D. Smith

From The Rockefeller University, New York, NY, and the Toronto General Research Institute (M.I.C.), University of Toronto, Toronto, Ontario, Canada.

Correspondence to Jonathan D. Smith, The Rockefeller University, 1230 York Ave, New York, NY 10021. E-mail smithj{at}rockvax.rockefeller.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract— Vascular cell adhesion molecule-1 (VCAM-1/Vcam1) is a cytokine-inducible member of the immunoglobulin gene superfamily that is expressed by arterial endothelial cells in regions predisposed to atherosclerosis and at borders of atherosclerotic plaques. To determine whether VCAM-1 expression regulates atherosclerotic lesion formation, we crossed Vcam1 domain 4–deficient (D4D) mice, which partially circumvent the embryonic lethality of Vcam1 null mice, with apolipoprotein E null (Apoe-/-) mice, which spontaneously develop hypercholesterolemia and atherosclerosis. In the Apoe-/- background, mice homozygous for the Vcam1 D4D allele had markedly reduced arterial VCAM-1 expression, monocyte adherence in the aortic root, and fatty streak formation. Heterozygous Vcam1 D4D mice revealed a Vcam1 gene-dosage effect and had intermediate, yet significant, reductions in these parameters. Our data demonstrate that VCAM-1 plays a pivotal role in the initiation of atherosclerosis in Apoe-/- mice.


Key Words: vascular cell adhesion molecule-1 • apolipoprotein E • hypercholesterolemia • gene targeting • monocytes


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Atherosclerosis begins as a focal process at specific regions of the vasculature, so-called lesion-prone areas, where hemodynamic flow is altered. The arterial endothelium expresses numerous adhesion molecules, such as P-selectin, intercellular adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1), at these lesion-prone areas before lesion development1,2 and at the borders of atherosclerotic lesions.2,3 Whereas ICAM-1 is also abundantly expressed at lesion-prone areas in wild-type mice with normal cholesterol levels,1,2 VCAM-1, a cytokine-inducible member of the immunoglobulin gene superfamily,4 is specifically upregulated in arterial endothelial cells at lesion-prone areas in hypercholesterolemic mice and rabbits.1,2,5 This specific upregulation of VCAM-1 at lesion-prone areas in hypercholesterolemic animals suggests that VCAM-1 may regulate monocyte adhesion in early atherogenesis.

To circumvent the embryonic lethality of Vcam1 null mice,6,7 mutant mice were generated with a targeted disruption of the exon encoding the fourth immunoglobulin domain of VCAM-1, which codes for an {alpha}4 integrin binding site.8 Domain 4–deficient (D4D) mice (Vcam1D4D/D4D) express only a 6-immunoglobulin domain form of Vcam1, with VCAM-1 mRNA and protein levels <10% of those found in wild-type mice.8 Reduced expression of VCAM-1 protein resulted in decreased embryonic survival of Vcam1D4D/D4D mice.8 The frequency of embryonic survival was strain dependent, ranging from 29% in 129-C57BL/6 hybrids to 6% of expected in C57BL/6 Vcam1D4D/D4D mice.8 When Vcam1D4D/D4D of mixed genetic background were bred with LDL receptor–deficient (Ldlr-/-) mice, the aortic surface area occupied by atherosclerosis was reduced by 40% compared with that of Ldlr-/-mice.8 In the present study, Vcam1D4D/D4D mice were bred with hypercholesterolemic apoE null (Apoe-/-) mice9 to determine whether relative deficiency in VCAM-1 would also attenuate lesion formation in the apoE-deficient background. Mice homozygous for the Vcam1 D4D allele (Apoe-/- and Vcam1D4D/D4D) had markedly reduced arterial VCAM-1 expression, monocyte adherence, and an 84% decrease in aortic root lesion area. We also demonstrate a significant Vcam1 gene-dosage effect on these parameters. Our data indicate that endothelial VCAM-1 plays a critical role in monocyte entry into the subendothelial space in early atherogenesis.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Mice
Because of the high incidence of embryonic lethality of Vcam1D4D/D4D mice on the C57BL/6 genetic background,8 all studies were performed with littermate-controlled outbred mice. Apoe-/- mice on an outbred C57BL/6-129 mixed genetic background9 were first crossed to Vcam1+/D4D mice on the same outbred background, and progeny were bred back to Apoe-/- mice to obtain Apoe-/-, Vcam1+/D4D mice. Apoe-/-, Vcam1+/D4D mice were then intercrossed to obtain the 3 possible Vcam1 genotypes: Vcam1+/+, Vcam1+/D4D, and Vcam1D4D/D4D. Because of the partially penetrant lethality of mice homozygous for the Vcam1 D4D-targeted allele, we did not obtain a sufficient number of Vcam1D4D/D4D mice from Vcam1+/D4D intercrosses. Only {approx}6% of the progeny were Vcam1D4D/D4D instead of the expected 25%. Therefore, 2 parallel littermate-controlled experiments were established to obtain sufficient numbers of Vcam1D4D/D4D: for cross 1, Vcam1+/+ mice were bred with Vcam1+/D4D mice to generate Vcam1+/+ and Vcam1+/D4D littermate mice; for cross 2, Vcam1+/D4D mice were bred to Vcam1D4D/D4D mice to obtain Vcam1+/D4D and Vcam1D4D/D4D littermates. Twenty-five percent of the progeny from cross 2 were Apoe-/-, Vcam1D4D/D4D mice, instead of the 50% expected by mendelian inheritance. Progeny from both crosses were fed a chow diet and were euthanized at 16 weeks of age. Vcam1D4D/D4D mice appeared healthy and were indistinguishable by appearance from the wild-type or heterozygous Vcam1 D4D mice. There were no significant differences in body weight, total cholesterol, HDL cholesterol, or median aortic atherosclerotic lesion area in Vcam1+/D4D mice of both sexes from cross 1 compared with sex-matched Vcam1+/D4D mice obtained from cross 2 (data not shown). Therefore, data from Vcam1+/D4D mice from both crosses were pooled, and these mice are referred to as Vcam1+/D4D mice in the tables and figures.

Genotyping
Vcam1 genotype and Apoe genotype were determined by polymerase chain reaction (PCR) assay from genomic DNA isolated from tail tips. The Apoe genotype was determined by PCR assay as previously described.10 The wild-type Vcam1 allele was detected by using 10 pmol of primers AACTTAAAATCCATGTTTTCATAGG and ATACATTGGGTATGGTGTGATATG in a reaction volume of 25 µL containing 2.5 µL of 10x PCR buffer (Promega), 1.5 mmol/L MgCl2, 200 µmol/L dNTPs, 1 U Taq polymerase, and 3 µL genomic DNA. The reaction was preheated to 99°C for 5 minutes, cooled to 70°C, and run for 35 cycles at 94°C for 30 seconds, 50°C for 30 seconds, and 72°C for 1 minute in a Perkin-Elmer 9700 thermocycler. The Vcam1 D4D allele was detected by using 10 pmol of primers TGCATGCATACATTGGGTATGGTGTGATATGTGG and GGGCCAGCTCATTCCTCCACTCATGATC as described above for the wild-type allele, except that the annealing temperature was 62°C. Products were run on 1.5% agarose gels. PCR of the wild-type Vcam1 allele produced a 300-bp product, and PCR of the D4D allele produced a 500-bp product.

Leukocyte Counts
Total blood leukocyte counts were measured with a particle and size analyzer (Beckman Coulter) after red blood cell lysis with Zapto-globin II (Beckman Coulter). The percentage of monocytes was calculated on the basis of a microscopic visualization with a x100 oil immersion lens of >=100 leukocytes on a blood smear stained with Diff Quick (Baxter).

Pathology and Cholesterol Measurements
The heart containing the aortic root was processed for the aortic root quantitative atherosclerosis assay as previously described.11 For immunohistochemistry, the aortic root and arch were stained with a monoclonal rat anti-mouse VCAM-1 antibody (M/K-2, Southern Biotechnology) that does not bind to domain 4.8 Quantification of the area occupied by CD11a-positive cells was performed by using a monoclonal rat anti-mouse CD11a antibody (2D7, Pharmingen) as described previously.12 Briefly, hearts and aortic arches were removed after perfusion with PBS and were frozen in OCT embedding medium (VWR International). Aortic root sections (8 µm) were obtained from an anatomically defined area of the aortic root, starting with the appearance of the aortic valve leaflets and ending when the aortic leaflets were no longer visualized. Aortic root and aortic arch sections were fixed with acetone, treated with 0.1% hydrogen peroxide, and blocked with normal goat serum. VCAM-1 (dilution 1:250) or CD11a (dilution 1:100) antibody was applied, and sections were washed with PBS and incubated with a biotinylated rabbit anti-rat mouse-absorbed secondary antibody (1:200, Vector Laboratories). After a wash with PBS, Avidin-Biotin-Complex linked to horseradish peroxidase (Vector-Elite, Vector Labs) was applied, sections were washed with PBS, and peroxidase was detected with NovaRed substrate (Vector Labs). Controls were performed with an irrelevant isotype-matched monoclonal antibody or in the absence of primary antibody, and no background staining was visualized. The area occupied by adherent CD11a mononuclear cells was measured on 1 section per slide for a total of 5 slides per animal. The 5 areas were then averaged. Total plasma cholesterol and HDL cholesterol were isolated and measured as described previously.13

Statistical Analysis
The Kolmogorov-Smirnov test with the Dalal and Wilkinson approximation was used to determine whether distributions were gaussian. When data were gaussian, ANOVA with a Newman-Keuls multiple comparison test was performed. Atherosclerosis measurements often were not gaussian, so comparisons between group median values were made by using a nonparametric ANOVA (Kruskal-Wallis) with the Dunn multiple comparison post test, or for comparisons of 2 groups, the Mann-Whitney t test was used. Statistics were performed with Prism 3.0 software (GraphPad).


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
We evaluated the role of Vcam1 in early atherogenesis by breeding Vcam1D4D/D4D mice to Apoe-/- mice, with the subsequent generation of Apoe-/- mice with 2, 1, or 0 wild-type Vcam1 alleles. All viable mice appeared healthy, and the number of Vcam1 wild-type alleles did not affect body weight, total cholesterol, or HDL cholesterol (Table 1). Total leukocyte count and numbers of circulating monocytes were not altered in mice harboring the D4 mutation (Table 2). The extent of VCAM-1 immunostaining was assessed at lesion-prone sites in the aortic arch of 16-week-old Apoe-/- mice (Figure 1A through 1C). Atherosclerotic lesions were not present in the aortic arch at this time point, inasmuch as atherogenesis is temporally delayed in the aortic arch compared with the aortic root. In Vcam1+/+ mice, VCAM-1 staining in the aortic arch was found primarily on endothelial cells with less abundant staining in the media. VCAM-1 staining of endothelial cells in lesion-prone areas of the aortic arch was gene-dosage dependent. The extent of immunohistochemical staining for VCAM-1 was greatest for Apoe-/-, Vcam1+/+ mice, intermediate for Apoe-/-, Vcam1+/D4D mice, and nearly absent in Apoe-/-, Vcam1D4D/D4D mice (Figure 1A through 1C).


View this table:
[in this window]
[in a new window]
 
Table 1. Plasma Lipids and Body Weight Measurements in Apoe-/- Mice


View this table:
[in this window]
[in a new window]
 
Table 2. Leukocyte Counts, Monocyte Counts, and Percentage of Monocytes in Peripheral Blood in Apoe-/- Mice



View larger version (142K):
[in this window]
[in a new window]
 
Figure 1. Immunohistochemical staining for VCAM-1 in representative aortic arch sections (A through C) and CD11a in representative aortic root sections (D through F) from Apoe-/-, Vcam1+/+ (A and D), Apoe-/-, Vcam1+/D4D (B and E), and Apoe-/-, Vcam1D4D/D4D (C and F) mice (left, original magnification x40; right, original magnification x100). The extent of endothelial VCAM-1 staining (red color) at lesion-prone areas was greatest for Apoe-/-, Vcam1+/+, intermediate for Apoe-/-, Vcam1+/D4D, and lowest for Apoe-/-, Vcam1D4D/D4D mice (n=4 of each genotype). CD11a+ adherent cells are noted (arrowheads) in aortic root sections taken from Apoe-/-, Vcam1+/+ (D) and Apoe-/-, Vcam1+/D4D (E) mice, but CD11a+ cells were absent from nearly all sections from Apoe-/-, Vcam1D4D/D4D mice (F).

Monocyte adhesion to the aortic root was assessed in 8-week-old chow-fed mice at a time point before atherosclerotic lesion development. CD11a immunostaining was performed at the aortic root in male Apoe-/- mice of the 3 Vcam1 genotypes. Representative sections of CD11a staining are shown Figure 1D through 1F. No CD11a+ cells were observed in this Vcam1D4D/D4D aortic root section (Figure 1F). Quantification of the area occupied by CD11a+ cells was performed by using sections from multiple mice from each genotype (Figure 2A). Adherent CD11a+ cells were detected in only 1 of 8 Apoe-/-, Vcam1D4D/D4D mice. The area occupied by CD11a-positive cells was significantly higher in Apoe-/-, Vcam1+/+ mice and Apoe-/-, Vcam1+/D4D mice than in Apoe-/-, Vcam1D4D/D4D mice (Figure 2A). Linear regression analysis revealed a significant correlation between the areas of CD11a+ cells and Vcam1 genotype (r2=0.24, P<0.01), suggesting an overall Vcam1 gene-dosage–dependent effect on mononuclear cell adherence. This suggests that VCAM-1 plays an important role in monocyte adherence to arterial endothelium during early atherogenesis. This is consistent with the observation that antibody blockade of VCAM-1 function reduced mononuclear cell adhesion by 75% in isolated-perfused carotid arteries from Apoe-/- mice.14



View larger version (12K):
[in this window]
[in a new window]
 
Figure 2. Effect of VCAM-1 on monocyte adherence and atherosclerotic lesion area in apoE-/- mice. A, Quantification of CD11a+ mononuclear cells bound to the aortic root endothelium of male Vcam1+/+ (n=5), Vcam1+/D4D (n=15), and Vcam1D4D/D4D (n=8) Apoe-/- mice. Values are mean±SD. B and C, Aortic root atherosclerotic lesion areas in male (B) and female (C) Apoe-/- mice according to Vcam1 genotype.

A Vcam1 gene-dosage–dependent effect on atherosclerotic plaque formation was noted in mice of both sexes (Figure 2). In males, there was a 54% decrease in median lesion area in Apoe-/-, Vcam1+/D4D mice and a 74% decrease in Apoe-/-, Vcam1D4D/D4D mice compared with the median lesion area in Apoe-/-, Vcam1+/+ mice (Figure 2B). In females, there was a 55% decrease in median lesion area in Apoe-/-, Vcam1+/D4D mice and an 89% decrease in Apoe-/-, Vcam1D4D/D4D mice (Figure 2C). Because there were no significant differences in lesion size between male and female mice of a given Vcam1 genotype, male and female data were combined. In the combined sex groups, the median lesion areas were 37x103, 17x103, and 6x103 µm2 for Apoe-/-, Vcam1+/+ mice, Apoe-/-, Vcam1+/D4D mice, and Apoe-/-, Vcam1D4D/D4D mice, respectively (P<0.001 for Vcam1D4D/D4D versus Vcam1+/+, P<0.01 for Vcam1D4D/D4D versus Vcam1+/D4D, and P<0.05 for Vcam1+/D4D versus Vcam1+/+). Thus, the presence of 1 and 2 Vcam1 D4D alleles was associated with significant (56% and 84%, respectively) reductions in lesion areas. These data reveal a robust Vcam1 gene-dosage effect on lesion cross-sectional area.

Microscopic examination of atherosclerotic lesions revealed that the majority of the lesions in mice with 2, 1, or 0 wild-type Vcam1 alleles were fatty streaks composed of macrophage foam cells (Figure 3). Lesions in Apoe-/-, Vcam1D4D/D4D mice were limited to very small nascent fatty streak lesions (Figure 3E and 3F), and fatty streak lesions of progressively increased size were noted in Apoe-/-, Vcam1+/D4D mice (Figure 3C and 3D) and in Apoe-/-, Vcam1+/+ mice (Figure 3A and 3B). The extent of VCAM-1 immunostaining was also assessed in aortic root fatty streak lesions of 20-week-old Apoe-/- mice. In Vcam1+/+ mice, VCAM-1 staining was observed on the endothelium and even more prominently within the intimal lesions (Figure 4A). In Vcam1+/D4D mice, aortic lesions were smaller, and VCAM-1 staining was predominantly observed on the endothelium but also visible in the intima (Figure 4B). In the lesion from a Vcam1D4D/D4D mouse shown in Figure 4C, VCAM-1 staining was not observed.



View larger version (119K):
[in this window]
[in a new window]
 
Figure 3. Representative oil red O staining for lipid in aortic root sections from male 16-week-old chow-fed Apoe-/-, Vcam1+/+ mice (A and B), Apoe-/-, Vcam1+/D4D mice (C and D), and Apoe-/-, Vcam1D4D/D4D mice (E and F). Images of the aortic root were taken at low and intermediate magnification (x4 objective on the left and x20 objective on the right, respectively).



View larger version (86K):
[in this window]
[in a new window]
 
Figure 4. Immunohistochemical staining for VCAM-1 in aortic root lesions (x20 objective) from Apoe-/- mice. VCAM-1 staining (red color) was abundant on endothelial cells and on cells within the lesions from an Apoe-/-, Vcam1+/+ mouse (A). Less abundant staining was found in lesions from an Apoe-/-, Vcam1+/D4D mouse (B), and no staining was visualized in lesions from an Apoe-/-, Vcam1D4D/D4D mouse (C).


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The pathogenesis of early atherosclerosis in Apoe-/- mice involves the accumulation of lipoprotein aggregates in the subendothelial space,15 upregulation of specific endothelial adhesion molecules and chemokines,1,2,16,17 monocyte recruitment, and subsequent foam cell formation.18 Deficiencies of P-selectin, E-selectin, and ICAM-1 have been shown to decrease atherosclerosis in hypercholesterolemic mice,1923 although a gene-dosage–dependent effect has not been documented for any of these deficiencies, and results in ICAM-1–deficient mice have not been consistent.8,24 Embryonic demise of Vcam1 null mice6,7 has made it difficult to study the role of VCAM-1 in atherogenesis with the use of mutant mouse models. Cybulsky et al8 created Vcam1 D4D mice that had dramatic decreases in VCAM-1 expression and an improved survival rate compared with those in Vcam1 null mice. The effect of very low levels of VCAM-1 expression on survival was strain dependent, with very low rates of survival of C57BL/6 D4D homozygous mice and better survival rates of D4D homozygous mice on a mixed genetic background.8 To generate sufficient numbers of mice for atherosclerosis studies, we bred C57BL/6-129 hybrid Vcam1 D4D mice onto the apoE-deficient background to determine the effect of decreased VCAM-1 expression on atherosclerosis.

Vcam1 gene dosage affected endothelial VCAM-1 expression and the subsequent monocyte adherence to lesion-prone areas of the arterial wall. Decreased VCAM-1 expression in Vcam1D4D/D4D mice resulted in an overall 84% decrease in fatty streak formation in the aortic root. Cybulsky et al8 reported a 40% decrease in the percentage of aortic surface area occupied by lesions in Ldr-/-, Vcam1 D4D homozygous mice. There are several potential differences that may explain the varying magnitude of reduction of atherosclerosis between these 2 studies. The varying lipoprotein profiles in Ldr-/- and Apoe-/- mice may have different downstream effects on lipoprotein deposition and endothelial activation. The high-fat high-cholesterol diet used in the study by Cybulsky et al might have induced a VCAM-1–independent inflammatory response that may not be present in the chow-fed Apoe-/- mice used in the present study. In addition, Cybulsky et al measured atherosclerosis as the percentage of the entire aorta occupied by lesions, whereas in the present study, atherosclerosis was assessed in cross sections through the aortic root. Taken together, these studies demonstrate that arterial expression of VCAM-1 plays an important role in atherosclerotic lesion formation in the context of varying lipoprotein profiles and at multiple sites in the vasculature. The interanimal variation in aortic root lesion size within each genotype may have been partly due to genetic heterogeneity. Despite this variation, the Vcam1 genotype had a highly significant effect on atherosclerosis.

The reduction in endothelial VCAM-1 expression most likely led to a decrease in monocyte adhesion and fatty streak formation in the Vcam1D4D/D4D mice. An alternative explanation for these findings is that decreased VCAM-1 expression affected the number of circulating monocytes and, by this mechanism, attenuated atherogenesis. There are several reasons why we do not favor this alternative explanation. It has been previously shown that the D4D mutation does not affect myeloid differentiation in vivo.25 In addition, leukocyte number and monocyte counts were not affected by the D4D mutation in the present study or in the study by Cybulsky et al.8 An additional explanation is that VCAM-1 may be involved in T-cell–dependent humoral immune responses,26 and the immune system has been shown to play a modifying role in atherosclerosis.27 However, complete ablation of cellular and humoral immunity in chow-fed Apoe-/- mice had a lesser effect in reducing atherosclerosis13 than that observed in Vcam1D4D/D4D mice in the present study.

Atherosclerotic lesion formation was not abolished in the present study. Although we observed an 84% reduction in lesion area in the Vcam1D4D/D4D mice, it is possible that the residual VCAM-1 expression was responsible for the remaining lesion formation. It is unclear whether a total deficiency in VCAM-1 would result in abolition of atherosclerosis. The use of temporal or tissue-specific conditional Vcam1 knockout mice could be used to study whether lesions develop in the total absence of VCAM-1 expression. Recently, 2 conditional Vcam1 knockout mouse models have been created.26,28 However, the observed impairment of immune responses in these conditional Vcam1 knockout mice may confound the interpretation of atherosclerosis studies.26,28 In conclusion, VCAM-1 plays a pivotal role in early atherogenesis. Future studies are necessary to determine whether VCAM-1 expression plays a role in fibroproliferative lesion progression and whether therapeutic targeting of VCAM-1 will attenuate atherosclerosis in humans.


*    Acknowledgments
 
This work was supported in part by an Established Investigatorship from the American Heart Association (J.D.S. and M.I.C.), by a grant from the National Institutes of Health (J.D.S.), and by a grant from the Heart and Stroke Foundation of Ontario (M.I.C.). H.M.D. is a recipient of a new investigator development award from the American Heart Association Heritage Affiliate. The authors wish to thank Jie Tang and Jonathan Beslow for their technical assistance in the immunohistochemical protocols.

Received June 13, 2001; accepted July 25, 2001.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Nakashima Y, Raines EW, Plump AS, Breslow JL, Ross R. Upregulation of VCAM-1 and ICAM-1 at atherosclerosis-prone sites on the endothelium in the apoE-deficient mouse. Arterioscler Thromb Vasc Biol. 1998; 18: 842–851.[Abstract/Free Full Text]

2. Iiyama K, Hajra L, Iiyama M, Li H, DiChiara M, Medoff BD, Cybulsky MI. Patterns of vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 expression in rabbit and mouse atherosclerotic lesions and at sites predisposed to lesion formation. Circ Res. 1999; 85: 199–207.[Abstract/Free Full Text]

3. O’Brien KD, McDonald TO, Chait A, Allen MD, Alpers CE. Neovascular expression of E-selectin, intercellular adhesion molecule-1, and vascular cell adhesion molecule-1 in human atherosclerosis and their relation to intimal leukocyte content. Circulation. 1996; 93: 672–682.[Abstract/Free Full Text]

4. Khan BV, Parthasarathy SS, Alexander RW, Medford RM. Modified low density lipoprotein and its constituents augment cytokine-activated vascular cell adhesion molecule-1 gene expression in human vascular endothelial cells. J Clin Invest. 1995; 95: 1262–1270.

5. Li H, Cybulsky MI, Gimbrone MA Jr, Libby P. An atherogenic diet rapidly induces VCAM-1, a cytokine-regulatable mononuclear leukocyte adhesion molecule, in rabbit aortic endothelium. Arterioscler Thromb. 1993; 13: 197–204.[Abstract/Free Full Text]

6. Gurtner GC, Davis V, Li H, McCoy MJ, Sharpe A, Cybulsky MI. Targeted disruption of the murine VCAM1 gene: essential role of VCAM-1 in chorioallantoic fusion and placentation. Genes Dev. 1995; 9: 1–14.[Abstract/Free Full Text]

7. Kwee L, Baldwin HS, Shen HM, Stewart CL, Buck C, Buck CA, Labow MA. Defective development of the embryonic and extraembryonic circulatory systems in vascular cell adhesion molecule (VCAM-1) deficient mice. Development. 1995; 121: 489–503.[Abstract]

8. Cybulsky MI, Iiyama K, Li H, Zhu S, Chen M, Iiyama M, Davis V, Gutierrez-Ramos JC, Connelly PW, Milstone DS. A major role for VCAM-1, but not ICAM-1, in early atherosclerosis. J Clin Invest. 2001; 107: 1255–1262.[Medline] [Order article via Infotrieve]

9. Plump AS, Smith JD, Hayek T, Aalto-Setala K, Walsh A, Verstuyft JG, Rubin EM, Breslow JL. Severe hypercholesterolemia and atherosclerosis in apolipoprotein E-deficient mice created by homologous recombination in ES cells. Cell. 1992; 71: 343–353.[Medline] [Order article via Infotrieve]

10. Smith JD, Trogan E, Ginsberg M, Grigaux C, Tian J, Miyata M. Decreased atherosclerosis in mice deficient in both macrophage colony-stimulating factor (op) and apolipoprotein E. Proc Natl Acad Sci U S A. 1995; 92: 8264–8268.[Abstract/Free Full Text]

11. Plump AS, Scott CJ, Breslow JL. Human apolipoprotein A-I gene expression increases high density lipoprotein and suppresses atherosclerosis in the apolipoprotein E-deficient mouse. Proc Natl Acad Sci U S A. 1994; 91: 9607–9611.[Abstract/Free Full Text]

12. Dansky HM, Charlton SA, Barlow CB, Tamminen M, Smith JD, Frank JS, Breslow JL. Apo A-I inhibits foam cell formation in apo E-deficient mice after monocyte adherence to endothelium. J Clin Invest. 1999; 104: 31–39.[Medline] [Order article via Infotrieve]

13. Dansky HM, Charlton SA, Harper MM, Smith JD. T and B lymphocytes play a minor role in atherosclerotic plaque formation in the apolipoprotein E-deficient mouse. Proc Natl Acad Sci U S A. 1997; 94: 4642–4646.[Abstract/Free Full Text]

14. Huo Y, Hafezi-Moghadam A, Ley K. Role of vascular cell adhesion molecule-1 and fibronectin connecting segment-1 in monocyte rolling and adhesion on early atherosclerotic lesions. Circ Res. 2000; 87: 153–159.[Abstract/Free Full Text]

15. Tamminen M, Mottino G, Qiao JH, Breslow JL, Frank JS. Ultrastructure of early lipid accumulation in apoE-deficient mice. Arterioscler Thromb Vasc Biol. 1999; 19: 847–853.[Abstract/Free Full Text]

16. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, Rollins BJ. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell. 1998; 2: 275–281.[Medline] [Order article via Infotrieve]

17. Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion formation in CCR2-/- mice reveals a role for chemokines in the initiation of atherosclerosis. Nature. 1998; 394: 894–897.[Medline] [Order article via Infotrieve]

18. Nakashima Y, Plump AS, Raines EW, Breslow JL, Ross R. ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arterioscler Thromb. 1994; 14: 133–140.[Abstract/Free Full Text]

19. Dong ZM, Brown AA, Wagner DD. Prominent role of P-selectin in the development of advanced atherosclerosis in apoE-deficient mice. Circulation. 2000; 101: 2290–2295.[Abstract/Free Full Text]

20. Collins RG, Velji R, Guevara NV, Hicks MJ, Chan L, Beaudet AL. P-Selectin or intercellular adhesion molecule (ICAM)-1 deficiency substantially protects against atherosclerosis in apolipoprotein E-deficient mice. J Exp Med. 2000; 191: 189–194.[Abstract/Free Full Text]

21. Dong ZM, Chapman SM, Brown AA, Frenette PS, Hynes RO, Wagner DD. The combined role of P- and E-selectins in atherosclerosis. J Clin Invest. 1998; 102: 145–152.[Medline] [Order article via Infotrieve]

22. Johnson RC, Chapman SM, Dong ZM, Ordovas JM, Mayadas TN, Herz J, Hynes RO, Schaefer EJ, Wagner DD. Absence of P-selectin delays fatty streak formation in mice. J Clin Invest. 1997; 99: 1037–1043.[Medline] [Order article via Infotrieve]

23. Bourdillon MC, Poston RN, Covacho C, Chignier E, Bricca G, McGregor JL. ICAM-1 deficiency reduces atherosclerotic lesions in double-knockout mice (apoE-/-/ICAM-1-/-) fed a fat or a chow diet. Arterioscler Thromb Vasc Biol. 2000; 20: 2630-2635.[Abstract/Free Full Text]

24. Smith JD. Mouse models of atherosclerosis. Lab Anim Sci. 1998; 48: 573–579.[Medline] [Order article via Infotrieve]

25. Friedrich C, Cybulsky MI, Gutierrez-Ramos JC. Vascular cell adhesion molecule-1 expression by hematopoiesis-supporting stromal cells is not essential for lymphoid or myeloid differentiation in vivo or in vitro. Eur J Immunol. 1996; 26: 2773–2780.[Medline] [Order article via Infotrieve]

26. Leuker CE, Labow M, Muller W, Wagner N. Neonatally induced inactivation of the vascular cell adhesion molecule 1 gene impairs B cell localization and T cell-dependent humoral immune response. J Exp Med. 2001; 193: 755–768.[Abstract/Free Full Text]

27. Hansson GK, Zhou X, Tornquist E, Paulsson G. The role of adaptive immunity in atherosclerosis. Ann N Y Acad Sci. 2000; 902: 53–64.[Medline] [Order article via Infotrieve]

28. Koni PA, Joshi SK, Temann UA, Olson D, Burkly L, Flavell RA. Conditional vascular cell adhesion molecule 1 deletion in mice: impaired lymphocyte migration to bone marrow. J Exp Med. 2001; 193: 741–754.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Cardiovasc ResHome page
B. A. Kaufmann
Ultrasound molecular imaging of atherosclerosis
Cardiovasc Res, September 1, 2009; 83(4): 617 - 625.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Civelek, E. Manduchi, R. J. Riley, C. J. Stoeckert Jr, and P. F. Davies
Chronic Endoplasmic Reticulum Stress Activates Unfolded Protein Response in Arterial Endothelium in Regions of Susceptibility to Atherosclerosis
Circ. Res., August 28, 2009; 105(5): 453 - 461.
[Abstract] [Full Text] [PDF]


Home page
J Am Coll CardiolHome page
E. M. deGoma, R. L. deGoma, and D. J. Rader
Beyond high-density lipoprotein cholesterol levels evaluating high-density lipoprotein function as influenced by novel therapeutic approaches.
J. Am. Coll. Cardiol., June 10, 2008; 51(23): 2199 - 2211.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Caprio, B. G. Newfell, A. la Sala, W. Baur, A. Fabbri, G. Rosano, M. E. Mendelsohn, and I. Z. Jaffe
Functional Mineralocorticoid Receptors in Human Vascular Endothelial Cells Regulate Intercellular Adhesion Molecule-1 Expression and Promote Leukocyte Adhesion
Circ. Res., June 6, 2008; 102(11): 1359 - 1367.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. M. Mansouri, E. Bauge, B. Staels, and P. Gervois
Systemic and Distal Repercussions of Liver-Specific Peroxisome Proliferator-Activated Receptor-{alpha} Control of the Acute-Phase Response
Endocrinology, June 1, 2008; 149(6): 3215 - 3223.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
L. Shelly, L. Royer, T. Sand, H. Jensen, and Y. Luo
Phospholipid transfer protein deficiency ameliorates diet-induced hypercholesterolemia and inflammation in mice
J. Lipid Res., April 1, 2008; 49(4): 773 - 781.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S. Wolfrum, D. Teupser, M. Tan, K. Y. Chen, and J. L. Breslow
The protective effect of A20 on atherosclerosis in apolipoprotein E-deficient mice is associated with reduced expression of NF-{kappa}B target genes
PNAS, November 20, 2007; 104(47): 18601 - 18606.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
E. Galkina and K. Ley
Vascular Adhesion Molecules in Atherosclerosis
Arterioscler Thromb Vasc Biol, November 1, 2007; 27(11): 2292 - 2301.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. K. Stannard, R. Khurana, I. M. Evans, V. Sofra, D. I.R. Holmes, and I. Zachary
Vascular Endothelial Growth Factor Synergistically Enhances Induction of E-Selectin by Tumor Necrosis Factor-{alpha}
Arterioscler Thromb Vasc Biol, March 1, 2007; 27(3): 494 - 502.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
H. Pei, Y. Wang, T. Miyoshi, Z. Zhang, A. H. Matsumoto, G. A. Helm, G. Tellides, and W. Shi
Direct Evidence for a Crucial Role of the Arterial Wall in Control of Atherosclerosis Susceptibility
Circulation, November 28, 2006; 114(22): 2382 - 2389.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. Jongstra-Bilen, M. Haidari, S.-N. Zhu, M. Chen, D. Guha, and M. I. Cybulsky
Low-grade chronic inflammation in regions of the normal mouse arterial intima predisposed to atherosclerosis
J. Exp. Med., September 4, 2006; 203(9): 2073 - 2083.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
D. T. Bolick, S. Srinivasan, A. Whetzel, L. C. Fuller, and C. C. Hedrick
12/15 Lipoxygenase Mediates Monocyte Adhesion to Aortic Endothelium in Apolipoprotein E-Deficient Mice Through Activation of RhoA and NF-{kappa}B
Arterioscler Thromb Vasc Biol, June 1, 2006; 26(6): 1260 - 1266.
[Abstract] [Full Text] [PDF]


Home page
Psychosom. Med.Home page
J. M. McCaffery, N. Frasure-Smith, M.-P. Dube, P. Theroux, G. A. Rouleau, Q. Duan, and F. Lesperance
Common genetic vulnerability to depressive symptoms and coronary artery disease: a review and development of candidate genes related to inflammation and serotonin.
Psychosom Med, March 1, 2006; 68(2): 187 - 200.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. I. van Leuven, J. J.P. Kastelein, A. C. Allison, M. R. Hayden, and E. S.G. Stroes
Mycophenolate mofetil (MMF): Firing at the atherosclerotic plaque from different angles?
Cardiovasc Res, February 1, 2006; 69(2): 341 - 347.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
C. S. Kim, S. J. Son, E. K. Kim, S. N. Kim, D. G. Yoo, H. S. Kim, S. W. Ryoo, S. D. Lee, K. Irani, and B. H. Jeon
Apurinic/apyrimidinic endonuclease1/redox factor-1 inhibits monocyte adhesion in endothelial cells
Cardiovasc Res, February 1, 2006; 69(2): 520 - 526.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Ulyanova, L. M. Scott, G. V. Priestley, Y. Jiang, B. Nakamoto, P. A. Koni, and T. Papayannopoulou
VCAM-1 expression in adult hematopoietic and nonhematopoietic cells is controlled by tissue-inductive signals and reflects their developmental origin
Blood, July 1, 2005; 106(1): 86 - 94.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Khurana, L. Moons, S. Shafi, A. Luttun, D. Collen, J. F. Martin, P. Carmeliet, and I. C. Zachary
Placental Growth Factor Promotes Atherosclerotic Intimal Thickening and Macrophage Accumulation
Circulation, May 31, 2005; 111(21): 2828 - 2836.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Teupser, S. Pavlides, M. Tan, J.-C. Gutierrez-Ramos, R. Kolbeck, and J. L. Breslow
Major reduction of atherosclerosis in fractalkine (CX3CL1)-deficient mice is at the brachiocephalic artery, not the aortic root
PNAS, December 21, 2004; 101(51): 17795 - 17800.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
L. Zhang, K. Peppel, L. Brian, L. Chien, and N. J. Freedman
Vein Graft Neointimal Hyperplasia Is Exacerbated by Tumor Necrosis Factor Receptor-1 Signaling in Graft-Intrinsic Cells
Arterioscler Thromb Vasc Biol, December 1, 2004; 24(12): 2277 - 2283.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
P. J. Barter, S. Nicholls, K.-A. Rye, G.M. Anantharamaiah, M. Navab, and A. M. Fogelman
Antiinflammatory Properties of HDL
Circ. Res., October 15, 2004; 95(8): 764 - 772.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. Liu, G. K. Sukhova, J.-S. Sun, W.-H. Xu, P. Libby, and G.-P. Shi
Lysosomal Cysteine Proteases in Atherosclerosis
Arterioscler Thromb Vasc Biol, August 1, 2004; 24(8): 1359 - 1366.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
R. Khurana, S. Shafi, J. Martin, and I. Zachary
Vascular Endothelial Growth Factor Gene Transfer Inhibits Neointimal Macrophage Accumulation in Hypercholesterolemic Rabbits
Arterioscler Thromb Vasc Biol, June 1, 2004; 24(6): 1074 - 1080.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. K. Death, K. C. Y. McGrath, M. A. Sader, S. Nakhla, W. Jessup, D. J. Handelsman, and D. S. Celermajer
Dihydrotestosterone Promotes Vascular Cell Adhesion Molecule-1 Expression in Male Human Endothelial Cells via a Nuclear Factor-{kappa}B-Dependent Pathway
Endocrinology, April 1, 2004; 145(4): 1889 - 1897.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Candido, T. J. Allen, M. Lassila, Z. Cao, V. Thallas, M. E. Cooper, and K. A. Jandeleit-Dahm
Irbesartan but Not Amlodipine Suppresses Diabetes-Associated Atherosclerosis
Circulation, March 30, 2004; 109(12): 1536 - 1542.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. Kunsch, J. Luchoomun, J. Y. Grey, L. K. Olliff, L. B. Saint, R. F. Arrendale, M. A. Wasserman, U. Saxena, and R. M. Medford
Selective Inhibition of Endothelial and Monocyte Redox-Sensitive Genes by AGI-1067: A Novel Antioxidant and Anti-Inflammatory Agent
J. Pharmacol. Exp. Ther., March 1, 2004; 308(3): 820 - 829.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
P. G. Frank, H. Lee, D. S. Park, N. N. Tandon, P. E. Scherer, and M. P. Lisanti
Genetic Ablation of Caveolin-1 Confers Protection Against Atherosclerosis
Arterioscler Thromb Vasc Biol, January 1, 2004; 24(1): 98 - 105.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
C. L. Sundell, P. K. Somers, C. Q. Meng, L. K. Hoong, K.-L. Suen, R. R. Hill, L. K. Landers, A. Chapman, D. Butteiger, M. Jones, et al.
AGI-1067: A Multifunctional Phenolic Antioxidant, Lipid Modulator, Anti-Inflammatory and Antiatherosclerotic Agent
J. Pharmacol. Exp. Ther., June 1, 2003; 305(3): 1116 - 1123.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Z. Han, Q. A. Truong, S. Park, and J. L. Breslow
Two Hsp70 family members expressed in atherosclerotic lesions
PNAS, February 4, 2003; 100(3): 1256 - 1261.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
R. Candido, K. A. Jandeleit-Dahm, Z. Cao, S. P. Nesteroff;, W. C. Burns, S. M. Twigg, R. J. Dilley, M. E. Cooper, and T. J. Allen
Prevention of Accelerated Atherosclerosis by Angiotensin-Converting Enzyme Inhibition in Diabetic Apolipoprotein E-Deficient Mice
Circulation, July 9, 2002; 106(2): 246 - 253.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dansky, H. M.
Right arrow Articles by Smith, J. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dansky, H. M.
Right arrow Articles by Smith, J. D.