© 2000 American Heart Association, Inc.
Atherosclerosis and Lipoproteins |
Polymerase Chain Reaction–Based Method for Quantifying Recruitment of Monocytes to Mouse Atherosclerotic Lesions In Vivo
Enhancement by Tumor Necrosis Factor-
and Interleukin-1ß
From the University of California, San Diego, La Jolla, Calif. Dr Kim is now at the Division of Cardiology, Department of Internal Medicine, Chung-Ang University Hospital, Seoul, Korea.
Correspondence to Daniel Steinberg, MD, PhD, Department of Medicine 0682, University of California, San Diego, 9500 Gilman Dr, La Jolla, CA 92093. E-mail dsteinberg{at}ucsd.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—The critical role of monocyte recruitment in atherogenesis has been appreciated for some time. However, until recently, there have been no sufficiently sensitive methods for measuring rates of monocyte recruitment to the arterial wall in vivo. We have developed a novel highly sensitive method, based on the polymerase chain reaction, for quantitatively tracking DNA-marked monocytes and have adapted it for use in mice. We use the uniquely male gene, Sry, on the Y chromosome as a gene marker. We transfuse monocytes from a male donor into a congenic female mouse, euthanize the mouse after 24 to 48 hours, and then quantify the arterial uptake of monocytes by quantitative polymerase chain reaction. This study describes the techniques used and their sensitivity and reproducibility and demonstrates the approach by assessing the effects of cytokines. In control low density lipoprotein receptor–negative mice, monocyte recruitment decreased slightly but significantly as lesions progressed. Intraperitoneal injection of a combination of tumor necrosis factor-
and interleukin-1ß more than doubled the rate of
monocyte recruitment into developing lesions. However, the response to
the cytokines was much greater in younger mice with less
advanced lesions than in older animals with more advanced lesions.
Key Words: tumor necrosis factor- • interleukin-1ß • monocytes • atherogenesis
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
One of the earliest responses to hypercholesterolemia is an increase in the adherence of monocytes to aortic endothelium and their penetration into the intima.1 2 These monocytes are the precursors of most of the foam cells of the fatty streak, the earliest well-characterized lesion of atherosclerosis.3 The central importance of monocyte recruitment in atherogenesis is underscored by recent studies showing that targeted deletion of either the gene for monocyte chemoattractant protein-14 5 or its receptor6 markedly inhibits the rate of lesion progression in mouse models of atherosclerosis. Overexpression of monocyte chemoattractant protein-1, on the other hand, accelerates the disease.7 The monocyte/macrophage, along with T lymphocytes and smooth muscle cells, undoubtedly also plays an important role in the later stages of lesion development.8 9
The factors involved in monocyte adhesion and recruitment have been extensively studied in cell culture systems, and a large number of adhesion molecules and chemokines have been implicated as having a potential role.10 However, a number of factors could confound the extrapolation from in vitro static systems to the in vivo system. Certainly the shear stress and/or turbulent flow in vivo can importantly alter the expression and the effectiveness of selectins and integrins at the aortic endothelial surface and on the monocyte.11 For the same reasons, it may not be legitimate to extrapolate results from the microcirculation to predict the relevant factors in large arteries. On the other hand, there are almost no data on the rates of monocyte recruitment under in vivo conditions, simply because a suitable method has not been available.
We have previously reported preliminary studies establishing the feasibility of tracking monocytes in rabbits by capitalizing on the exquisite sensitivity of the polymerase chain reaction (PCR).12 Monocytes from wild-type rabbits were isolated and injected intravenously into recipient rabbits having a large deletion mutation in the gene for arylamine N-acetyltransferase. The recipients had been on a cholesterol-rich diet long enough to have developed early fatty streak lesions. DNA was extracted from the aortic samples and subjected to PCR using a pair of primers that yielded product from the wild-type N-acetyltransferase gene but no product at all from the mutant cells. Those preliminary experiments established that the sensitivity of the approach was adequate and that the reproducibility was satisfactory. However, because highly inbred strains of rabbits are not available, it was necessary to transfuse monocytes between allogeneic animals, and this left open the possibility that results might be perturbed by an immune response mounted by the recipient, even in short-term experiments.
We now report an adaptation of this method in mice that is used in such a way that immune response is no longer an issue. In the present study, we transfuse monocytes from a male donor into a female recipient and then use PCR to amplify the testis-determining gene (Sry) on the Y chromosome.13 In this way, no signal is generated from the tissues of the female recipient. Males and females from the same highly inbred strain can now be used as donors and recipients, respectively, so that no significant immune response will occur. In principle, any single-gene difference between donor and recipient could be used to the same purpose and with the same freedom from immune responses. The preliminary experiments reported below establish the feasibility of the approach by use of monocytes, but obviously, this approach could be applied in the same way to the study of any leukocytes.
There are several methods to quantify DNA by PCR. Among them, competitive PCR that uses an internal standard is probably the most accurate.14 We used this method in the first phases of the present study. However, this method is labor intensive and time-consuming. Recently, real-time PCR, which combines amplification and product detection in 1 step, was introduced.15 16 Post-PCR procedures, such as gel separations and detection by radioactive or nonradioactive probes, are not necessary, thus saving considerable time and effort. This method also has the advantage of less variation because it measures the PCR product generated during the exponential phase. We repeated assays of our tissue samples by use of this method and found that it gave similar results.
We show that the administration of tumor necrosis factor (TNF)- and
interleukin (IL)-1ß, 2 proinflammatory cytokines known to
increase monocyte adherence to endothelium in vitro and
to play a role in fatty streak formation,17 18 19 doubles
monocyte recruitment to aortic arch lesions in vivo in the LDL
receptor–negative mouse.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Animals
LDL receptor–negative mice, backcrossed for 5 generations into a C57BL/6 genetic background, were obtained from Jackson Laboratories (Bar Harbor, Me). Females who were to be monocyte recipients were fed an atherogenic diet (1.25% cholesterol, 21% milk fat, Harlan Teklad) for 3 to 6 months beginning at 6 to 9 months of age. All animals showed lesions in the aortic arch covering 13% to 49% of the total surface area of the arch. Male LDL receptor–negative mice were fed a regular chow diet and were used as monocyte donors.
On each experimental day, monocytes were isolated from 18 male donors
by using the methods described below. Between 100 000 and 140 000
recovered monocytes were then injected via tail vein into each of 3
control female recipients and 3 cytokine-treated female
recipients. Twenty-four hours after the monocyte transfusion, the
recipients were euthanized and perfused under
physiological pressure with PBS containing 2
mmol/L EDTA, pH 7.4, via a needle inserted into the apex of the left
ventricle. Perfusion was continued until the effluent from the vena
cava became clear. To evaluate the effects of cytokines, 0.2
µg each of mouse recombinant TNF- and IL-1ß (Sigma Chemical Co)
was injected intraperitoneally in a total volume of
0.5 mL saline containing 1% BSA 30 minutes after the injection of
monocytes; saline carrier was injected into control animals.
Measurement of Aortic Lesion Area
After euthanasia and perfusion, the aortic arch was dissected
from just above the aortic valve to just above the origin of the first
intercostal artery using a stereomicroscope. The aorta was thoroughly
cleansed of adventitial tissue, and wet weight was determined. The
aortic arch was opened longitudinally and pinned out on a black wax
surface for imaging. The image was captured by a Sony DXC-960 MD color
video camera. Lesions in this mouse model are readily identified by
their white opacity without the need for staining.20 Total
surface area and total surface area of lesions were measured by using
Optimas 4.0 image analysis software (Bioscan) as previously
described.20
Monocyte Preparation
Monocytes were prepared from blood of
normocholesterolemic LDL receptor–negative male donors
drawn under anesthesia from the inferior cava
with use of a syringe containing enough EDTA to make the final
concentration 12 mmol/L. We obtained 
0.8 mL of blood per mouse.
After centrifugation of the whole blood, the buffy coat
was aspirated, mixed with the plasma, and layered over 3 mL of NycoPrep
1.068 (Nycomed Pharma) in a siliconized 15-mL conical
centrifuge tube.21 After
centrifugation for 15 minutes at 600g (no
brake) and 22°C to sediment granulocytes and most of the lymphocytes,
the plasma layer at the top was aspirated down to 3 mm above
the interface and discarded; the upper layer of the supernatant
Nycodenz (Nycomed Pharma), containing the monocytes, was
aspirated down to 5 mm above the cell pellet, diluted with cold
PBS containing 0.02% EDTA, pH 7.4, and centrifuged for 15
minutes. The pelleted cells were washed 3 times with PBS containing
0.02% EDTA, pH 7.4.
The purity of the monocytes was checked in several ways. First, a
sample was centrifuged in Cytospin (Shandon) and stained with
Wright-Giemsa. Monocyte recovery was only 20%; however, purity
based on morphology was >85%, but residual platelet contamination
was evident. Purity was also assessed by using
fluorescence-activated cell sorter (FACS)
analysis. The final preparation was incubated with 1 µg of Fc
fragment block per million cells in 1% BSA-PBS for 30 minutes at 4°C
and then with either FITC-conjugated antibody against CD3 or antibody
against CD45R/B220 (PharMingen, Becton Dickinson Co). Only 12.3% of
the cells were positive for CD3 (T cells), and only 3.5% of the cells
were positive for CD45R/B220 (B cells). To test whether activation had
occurred during purification, we performed FACS analysis with
the use of antibody against L-selectin (PharMingen). Over 85% of the
cells were positive for L-selectin, suggesting limited
activation.22 However, we were not able to determine
whether the level of expression was less than that of circulating
monocytes because of the very low monocyte count in mouse blood (3%
of total leukocytes). Finally, we tested for the presence of CD11b. To
increase the expression of CD11b, the purified monocytes were plated at
300 000 cells per well in a 6-well plate in the presence of
12-O-tetradecanoylphorbol 13-acetate
(100 nmol/L) to maximize the expression of CD11b and were incubated at
37°C overnight. Cells were transferred to FACS tubes and were
pelleted and washed twice with 1% BSA-PBS. The cells were then
incubated with phycoerythrin (PE)-conjugated antibody to CD11b
(at 0.25 µg per 300 000 cells) for 30 minutes at 4°C. Cells were
pelleted, washed twice with 1% BSA-PBS, and resuspended in FACS buffer
(0.1% BSA-PBS and 0.01% NaN3). Samples were
analyzed by flow cytometry with use of a FACScan (Becton
Dickinson) and analyzed by Cell Quest software. As shown in
Figure 1
, over 90% of the cells
in this preparation were CD11b positive. This activation step was of
course not a part of the routine preparations made for the studies
described below.
|
Measurement of Monocyte Recruitment Into Aortic Arch by
Competitive PCR
The aortic arch was pulverized in a methanol–dry ice bath. DNA
was extracted by using a QIAamp Tissue Kit (Qiagen) with some
modifications. DNA was quantified by a fluorescence
assay23 with the use of Hoechst dye 33258 (Pharmacia
Biotech) and a luminescence spectrophotometer (Perkin Elmer).
Primers for PCR of the Sry gene were based on the published sequence.13 The sense primer corresponds to nucleotides 66 to 87 (5'GTTTTGGGACTGGTGACAATTG3'), and the antisense primer corresponds to nucleotides 426 to 445 (5'GTCTTGCCTGTATGTGATGG3'). These primers amplify a 380-bp product.
An internal standard was constructed by the insertion of a 222-bp length of foreign DNA into the XbaI restriction site of the segment amplified by PCR. This fragment was ligated into pGEM-T vector (Promega). The vector was transformed to JM109 competent cells (Promega), amplified, and purified. Amplification of internal standard with use of the same primers produced a 602-bp band, easily separated from the Sry gene product.
Competitive PCR was carried out in a 25-µL volume by use of a Qiagen PCR kit with 20 pmol of each primer, 400 µmol of each of the dNTPs, 1.25 U of Taq DNA polymerase, 10 to 40 ng of genomic DNA extracted from female aortic arch, and an adequate range of internal standard. The PCR reaction was carried out in a TwinBlock System with a heated lid (Ericomp Inc). The first denaturing cycle was at 95°C for 3 minutes, followed by 30 cycles of denaturation at 94°C for 1 minute, annealing at 60°C for 1 minute, and extension at 72°C for 2 minutes. Cycling was concluded at 72°C for 10 minutes.
Electrophoresis was performed in 1.5% agarose gel, and the DNA was denatured by alkali (0.15 mol/L NaOH and 0.5 mol/L NaCl). The product of PCR was transferred to a nylon membrane overnight by use of the Turboblotter Transfer System (Schleicher & Schuell) and was cross-linked by UV radiation. The membrane was prehybridized in 20 mL of a solution containing 5x SSC, 0.1% SDS, 0.1% N-laurylsarcosine, and 1% blocking reagent. Hybridization was carried out for at least 3 hours at 47°C with 4 pmol of digoxigenin-tailed oligo probe in 10 mL of the same solution. This probe corresponds to nucleotides 151 to 168 (5'TGAGAGGCACAAGTTGGC3') of the Sry gene.
A digoxigenin-tailed internal probe was prepared by use of the DIG Oligonucleotide Tailing Kit (Boehringer-Mannheim). Detection was carried out by use of the DIG Luminescence Detection Kit (Boehringer-Mannheim) and by exposure to x-ray film for 1 to 5 minutes. Images of the bands were captured by a black-and-white video camera, and band intensity was measured by use of Optimas 4.0 image analysis software (Bioscan).
Quantification for male DNA in the recipient female aortic arch was
achieved by competitive PCR, with titration of a constant amount of
female aortic arch sample against an appropriate range of successive
dilutions of the internal standard.14 The amount of
internal standard yielding the same amount of PCR product as
derived from the unknown sample was calculated (Figure 2). The amount of internal standard was
converted to male DNA equivalents on the basis of the results of
competitive PCR with known concentrations of male DNA and internal
standard. One microgram of total male DNA was found to yield the same
amount of PCR product as 1.35 pg of internal standard (3605-bp
plasmid).
|
Measurement of Monocyte Recruitment Into Aortic Arch by Using
Real-Time PCR
Real-time PCR was carried out by using an ABI Prism 7700
Sequence Detector (TaqMan, Perkin-Elmer Applied
Biosystems).15 16 This method uses a probe with a
fluorescent dye covalently attached at the 5' end and a
quencher at the 3' end. The probe does not emit fluorescence as
long as it is intact. During the annealing phase, the probe is
hybridized to target DNA. During the extension phase,
fluorescence is emitted when the fluorescent dye and
its quencher are split by the 5' exonuclease activity of Taq
polymerase.15 16 Fluorescence is measured
after each cycle. The sense primer for the Sry gene
corresponded to nucleotides 173 to 195
(5'CAGAATCCCAGCATGCAAAATAC3'), and the antisense primer corresponded to
nucleotides 225 to 245 (5'CGGCTTCTGTAAGGCTTTTCC3'). The
probe corresponded to nucleotides 198 to 221
(5'AGATCAGCAAGCAGCTGGGATGCA3') and was labeled with fluorescent
dye, 6-carboxyfluorescein, on the 5' end and with quencher,
tetramethyl-6-carboxyrhodamine, on the 3' end.
PCR was carried out in a 25-µL volume with TaqMan Universal Master Mix (Perkin-Elmer), 900 nmol/L of each primer, 450 nmol/L of probe, and 5 µL (50 ng) of the sample in triplicate. The thermal cycling condition involved 2 minutes at 50°C and 10 minutes at 95°C and was followed by 45 cycles of denaturation at 95°C for 15 seconds and annealing and extension at 60°C for 1 minute.
The threshold for fluorescence was set above the baseline
emission and as low as possible to stay within the exponential phase of
PCR amplification. Fractional cycle number for fluorescence to
reach the threshold was defined as cycle threshold. On the basis of
standard curves from cycle threshold of external standard (serial
dilutions of male DNA from 50 ng to 0.05 ng, Figure 3), the amount of male DNA in the female
aortic arch was calculated.
|
Data Analysis
To correct for variance from one monocyte preparation to the
next, the results on each experimental day were expressed relative to
the values in the 3 control mice studied that same day. All data were
expressed as mean±SD. Data were analyzed by an unpaired
Student t test and linear regression analysis.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Validation of Method for Quantifying Recruitment of Monocytes to Mouse Atherosclerotic Lesions
To test whether the perfusion protocol was adequate to remove all residual blood, including that in the vasa vasorum, and to test whether the EDTA in the perfusion buffer stripped away any monocytes adhering to the endothelium, isolated male monocytes were injected into normal female C57BL/6 mice on a chow diet. In these mice, we found no detectable male DNA signal in the aortas even with nested PCR.
Under the conditions described in Methods, competitive PCR was able to
detect the presence of as little as 20 pg of male DNA (5 to 10 cells).
The intra-assay and interassay coefficients of variation were 5.5% and
12.4%, respectively. In a typical experiment with aortic lesions
covering 12.4% to 49.6% of the surface of the aortic arch,
satisfactory quantification could be obtained by using 1% of the
total DNA extracted from the recipient’s tissue. Amplification
coefficients during the exponential phase were quite similar for the
internal standard and for the donor male DNA. Real-time PCR was able to
detect as little as 10 pg of male DNA. The intra-assay coefficient of
variation was variable from 4.5% to 27.7%, depending on the
amounts of standard male DNA.
Effects of Simultaneous Injection of TNF- and
IL-1ß on Rate of Recruitment of Monocytes Into Aortic Arch
Female recipients that had been on the atherogenic diet for 3 to 6
months were given intraperitoneal injections of 0.2
µg each of TNF- and IL-1ß 30 minutes after the injection of
donor monocytes. The characteristics of the 2 groups are summarized in
the Table. Note particularly that
the extent of lesions was identical in the 2 groups.
|
The animals pretreated with the cytokines showed a clear
increase in monocyte recruitment. When expressed in terms of the
micrograms of male DNA per microgram of recipient female DNA, there was
an increase of 133% (P<0.05) by competitive PCR and
105.5% by real-time PCR (Figure 3
). To take into account
possible variation in the monocytes from one preparation to the next,
the data were also calculated separately for each experimental day,
defining the mean of the control values for that day as 100% and
expressing the data in the cytokine-treated group relative to
that control value. As shown in Figure 4, the results calculated in this manner were not very different, showing
an increase of 117.5% that was due to the cytokines
(100.0±28.3% versus 217.5±57.6%, P<0.0005) by
competitive PCR and an increase of 95.5% (100.0±29.5% versus
195.5±76.2%, P<0.01) by real-time PCR.
|
The data were also calculated in terms of the number of male monocytes per square millimeter of atherosclerotic lesions. The value for the cytokine-treated animals was higher by 119% than that for the control animals (100.0±41.1 versus 219.1±89.1, P<0.005).
As shown in Figure 5, the recruitment of
monocytes in the control animals showed a weak negative correlation
with the extent of atherosclerosis
(R2=0.45, P<0.05). This
negative correlation was much more striking in the
cytokine-treated group
(R2=0.81, P<0.001). The
results imply that monocyte recruitment decreases slightly in the
unstimulated animals as the lesions become larger and that the ability
of the cytokines to stimulate recruitment is much greater in
the earlier lesions. In fact, there was no detectable cytokine
effect in the animals with >40% of the aortic arch covered by
lesions. These animals had been on the atherogenic diet for 6 months,
whereas the rest had been on the diet for only 3 months.
|
) are
separately plotted. Values for cytokine-treated animals are
expressed relative to the mean value in control animals set to 100%.
Note that there was almost no detectable cytokine effect in the
animals with the more extensive lesions, whereas monocyte recruitment
was doubled or tripled in the animals with less extensive
lesions.The data in the control animals show that monocyte recruitment continues even when 30% to 50% of the aortic surface is covered by lesions but that the rate of recruitment is somewhat slower than it is in the earlier stages of the disease. The lack of response to the cytokines in the older lesions might suggest that the endothelial response to the cytokines decreases in the endothelium overlying the older lesions and/or that the expression of adhesion molecules on the endothelial surface is no longer a rate-limiting factor in monocyte recruitment in the older lesions.
Comparison of Results Between Competitive PCR and Real-Time
PCR
As mentioned above, competitive and real-time PCR showed similar
results with respect to the increase in monocyte recruitment on
simultaneous injection of TNF- and IL-1ß. There was
excellent correlation between the results by the 2 methods
(R2=0.82, P<0.000001;
Figure 6).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The novel approach to quantification of leukocyte trafficking described in the present study is shown to have the sensitivity and reproducibility to permit measurements of the recruitment of circulating monocytes into atherosclerotic lesions of the mouse. The same approach should in principle be applicable to the tracking of any other cell type and to tracking into other tissues. In the present study, we capitalized on the uniqueness of the Sry gene on the Y chromosome, transfusing monocytes from males into congenic female recipients. In principle, pairs of animals differing by any single mutation readily distinguished from its wild-type counterpart could also be used, and then one would not be limited to donors and recipients of the opposite sex. For example, we have initiated studies that used the LDL receptor–deficient mouse as a recipient, taking donor monocytes from wild-type C57BL/6 donors (of either sex) and transfusing them into LDL receptor–negative mice (of either sex) that had been backcrossed for 10 generations into the C57BL/6 background.
Leukocytes can, in principle, be labeled in many ways, and a number of approaches have been tried. However, some of these, such as labeling with fluorescent markers,24 25 involve significant manipulation of the cells and probably lead to factitious activation (or deactivation). By use of the approach described in the present study, handling of the cells is minimized. We used a simple purification that gave a 20% recovery of 85% pure monocytes. The final preparations were L-selectin positive, suggesting that activation was minimal despite the density gradient separation step,22 but a quantitative comparison with unmanipulated cells was not made. In any case, we used the same preparation of monocytes for transfusion into control and to cytokine-treated recipients, treated as pairs, making it likely that the difference between control and cytokine-treated animals rests on differences in the endothelial expression of adhesion molecules. It should also be noted that monocytes from the normocholesterolemic donors used in the present study would be expected to express fewer CCR2 receptors than those in the hypercholesterolemic recipients.26 Therefore, the absolute rate of disappearance of donor cells, in control and in cytokine-treated mice, may be less than that of endogenous cells. However, control and cytokine-treated animals received the same preparations of "tracer" monocytes, and the relative rates of uptake should still reflect the cytokine effect on monocyte adherence and penetration.
Competitive PCR is the favored method for quantifying DNA. It calls for the construction of an internal standard that uses the same primer sequences that amplify the target but yields a product of different length. This method requires time-consuming post-PCR procedures, and there is a risk of contamination of PCR product. Real-time PCR does not have these limitations. In the present study, both methods were sufficiently sensitive and yielded very similar results. Studies of this kind require analysis of many samples. The availability of real-time PCR makes an important difference, reducing time and energy input markedly. Intra-assay variation of real-time PCR based on the threshold cycle number was 0.2% to 1.0%, similar to previously reported experience.15 16 However, the variation calculated after conversion to actual DNA concentration was 4.5% to 27.7% compared with 5.5% in competitive PCR. Further studies will be needed to check the accuracy and discriminatory power of the method in other settings.
The effects of TNF- and IL-1ß on the adherence of leukocytes to
endothelial cells in culture have been well
documented.17 18 19 27 Some of the adhesion molecules
upregulated by these cytokines have been identified, and the
effects in a static system are clear-cut. However, there is evidence
that under conditions of shear stress, leukocytes themselves can behave
differently28 and that the strength of the bonding to the
endothelial surface may need to be considerably greater
to fix them long enough to permit penetration through the
endothelial lining.11 Furthermore, the
levels of expression of selectins and other adhesion molecules on the
endothelium overlying a developing lesion may be quite
different from those on a normal endothelial cell in
culture. Finally, the production of cytokines by the
cells in an atheroma may alter considerably either adhesion
or penetration or both. For all of these reasons, observations made
under in vivo conditions should be much more meaningful than
observations made in a static cell culture system.
There is evidence that IL-1ß and TNF- play quantitatively
significant roles in atherogenesis in the apoE-deficient
mouse.17 Treatment with the IL-1 receptor
antagonist decreased lesion formation in males and females;
treatment with the TNF binding protein also reduced
atherosclerosis, although to a lesser extent and only
in females. Thus, the observed 2-fold increase in monocyte recruitment
induced by the cytokines in the present study was not
unexpected. The doses of TNF- and IL-1ß were deliberately chosen
on the high side to increase the probability of a definitive result. In
cultured vascular endothelial cells, IL-1 increased the
adhesion of monocytes 2- to 5-fold,17 an effect roughly
equivalent to that observed by us in vivo. However, the apparent 2-fold
increase in monocyte recruitment may either underestimate or
overestimate the importance of these cytokines. The high doses
may, as indicated, have induced exaggerated responses. On the other
hand, the established atherosclerotic lesions in these mice may have
been producing cytokines at an extremely high rate, such that
the further increases due to the administration of TNF- and IL-1ß
represented a small increment. Further studies will be
needed to evaluate the relative importance of the various factors
responsible for monocyte recruitment into atherosclerotic lesions at
different stages in their development. Moreover, these
cytokines may well act in additional ways to affect
atherogenesis, eg, by inducing procoagulant
activity.29
In the present study, the aorta (and the entire vasculature) was perfused with a buffer containing EDTA to disassociate and wash out any loosely adherent monocytes from the endothelial lining. To the extent that this was successful, we would then detect only monocytes that had succeeded in penetrating the endothelial monolayer and had become stably relocated in the subendothelial space (or nestling between endothelial cells). That the EDTA perfusion did in fact remove adherent cells is suggested by the absence of any detectable PCR signal from the aortas of normal animals. Even in the absence of hypercholesterolemia, there are always some monocytes adherent to the aortic endothelium, and their number then rises very substantially in the presence of hypercholesterolemia. However, our preliminary findings suggest that very few, if any, of these penetrate into the intima. The negative results in control animals show that the perfusion protocol and the dissection to remove adventitial tissue successfully reduced any residual blood below the level of detection. These results also suggest that there is very little continuing "surveillance" of the normal subendothelial space by monocytes.
In the present study, the male monocytes transfused into the female recipient represent "tracer cells," analogous to radioactively labeled tracer molecules. Can the fraction of injected tracer cells found in the lesions after 24 to 48 hours be taken as an index of the total number of monocytes delivered over that time interval? If the animals had been euthanized at shorter time intervals after the introduction of the tracer cells, it would have been necessary to know their rates of disappearance from the blood stream. However, at long time intervals after the introduction of tracer, as worked out in careful detail by Carew and Beltz,30 the relative uptake of tracer into various tissues is proportional to the uptake of tracee independent of the shape of the disappearance curve. Their theoretical analysis dealt with so-called "trapped labels," namely, molecules labeled isotopically with a compound that remains trapped in the cells that take up the tagged molecule. The example used by Carew and Beltz was the metabolism of LDL labeled with covalently attached [14C]sucrose. The [14C]sucrose remains trapped in the lysosome even after the LDL itself has been degraded.31 What they showed was that the amount of tracer (in our case, male monocytes) accumulating in any given tissue compartment will be proportional to the number of tracee molecules (in our case, recipient monocytes) entering that same compartment over the time of the experiment independent of the shape of the disappearance curve. If monocytes exiting the bloodstream to enter the subendothelial space remain trapped there for at least 24 to 48 hours, the theoretical analysis of Carew and Beltz would apply. The absolute values calculated by using this approach could be in error if (1) monocytes are in rapid flux between the blood compartment and the subendothelial space or (2) monocytes undergo rapid degradation with destruction of their DNA within 24 hours after entering the subendothelial space. Neither of these seems very likely, particularly in a rapidly growing fatty streak. Note, however, that the theoretical analysis by Carew and Beltz is rigorously exact only if the analysis of tissue distribution is made at "infinite time." However, they show that the tissue distribution in most pools will be within 10% of the asymptotic infinite time value after 1 or 2 half-lives of the tracer. The half-life of monocytes in the circulation of the mouse is <24 hours.32 33 Therefore, we believe that the data in the present study, particularly because they represent a comparison between control and experimental mice of a single highly inbred strain, can be accepted qualitatively and as a reasonable approximation of absolute values. However, additional studies will be needed to test some of the assumptions involved.
|
Acknowledgments |
|---|
This work was supported by funds provided by the Cigarette and Tobacco Surtax Fund of the State of California through the Tobacco-Related Disease Program of the University of California, grant No. 6RT0136. Dr Chee-Jeong Kim was funded by the Korea Science and Engineering Foundation and Chung-Ang University. We thank Felicidad Almazan and Florencia Casanada for their skillful technical assistance. We also thank Jacques Corbeil and Christine Plotkin at the Center for AIDS Research Molecular Biology Core for advice and assistance in performing the real-time PCR quantification analysis.
Received December 22, 1999; accepted May 1, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Gerrity RG. The role of the monocyte in atherogenesis, I: transition of blood-borne monocytes into foam cells in fatty lesions. Am J Pathol. 1981;103:181–190.[Abstract]
2.
Faggiotto A, Ross R, Harker L. Studies of
hypercholesterolemia in the nonhuman primate,
I: changes that lead to fatty streak formation.
Arteriosclerosis. 1984;4:323–340.
3.
Stary HC, Chandler AB, Glagov S, Guyton JR,
Insull W Jr, Rosenfeld ME, Schaffer SA, Schwartz CJ, Wagner WD, Wissler
RW. A definition of initial, fatty streak, and intermediate lesions of
atherosclerosis: a report from the Committee on
Vascular Lesions of the Council on
Arteriosclerosis, American Heart Association.
Arterioscler Thromb. 1994;14:840–856.
4. Gosling J, Slaymaker S, Gu L, Tseng S, Zlot CH, Young SG, Rollins BJ, Charo IF. MCP-1 deficiency reduces susceptibility to atherosclerosis in mice that overexpress human apolipoprotein B. J Clin Invest. 1999;103:773–778.[Medline] [Order article via Infotrieve]
5. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, Rollins BJ. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell. 1998;2:275–281.[Medline] [Order article via Infotrieve]
6. Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion formation in CCR2-/- mice reveals a role for chemokines in the initiation of atherosclerosis. Nature. 1998;394:894–897.[Medline] [Order article via Infotrieve]
7.
Aiello RJ, Bourassa PA, Lindsey S, Weng W, Natoli E,
Rollins BJ, Milos PM. Monocyte chemoattractant protein-1 accelerates
atherosclerosis in apolipoprotein E–deficient mice.
Arterioscler Thromb Vasc Biol. 1999;19:1518–25.
8. Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature. 1993;362:801–809.[Medline] [Order article via Infotrieve]
9.
Libby P. Molecular basis of the acute coronary
syndromes. Circulation. 1995;91:2844–2850.
10. Gimbrone MA Jr, Resnick N, Nagel T, Khachigian LM, Collins T, Topper JN. Hemodynamics, endothelial gene expression, and atherogenesis. Ann N Y Acad Sci. 1997;811:1–10.[Medline] [Order article via Infotrieve]
11. Gerszten RE, Yoshida M, Ding HA, Gimbrone MA Jr, Luscinskas FW, Rosenzweig A. Critical roles for both endothelial and leukocyte activation in monocyte recruitment. Circulation. 1998;96(suppl I):I-591. Abstract.
12.
Steinberg D, Khoo JC, Glass CK, Palinski W, Almazan F.
A new approach to determining the rates of recruitment of circulating
leukocytes into tissues: application to the measurement of leukocyte
recruitment into atherosclerotic lesions. Proc Natl Acad Sci
U S A. 1997;94:4040–4044.
13. Gubbay J, Collignon J, Koopman P, Capel B, Economou A, Münsterberg A, Vivian N, Goodfellow P, Lovell-Badge R. A gene mapping to the sex-determining region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature. 1990;346:245–250.[Medline] [Order article via Infotrieve]
14. Cross NCP. Quantitative PCR techniques and applications. Br J Haematol. 1995;89:693–697.[Medline] [Order article via Infotrieve]
15.
Heid CA, Stevens J, Livab KJ, Williams PM. Real time
quantitative PCR. Genome Res. 1996;6:986–994.
16. Overbergh L, Valckx D, Waer M, Mathieu C. Quantification of murine cytokine mRNA using real time quantitative reverse transcriptase PCR. Cytokine. 1999;11:305–312.[Medline] [Order article via Infotrieve]
17.
Elhage R, Maret A, Pieraggi MT, Thiers JC, Arnal JF,
Bayard F. Differential effects of interleukin-1 receptor
antagonist and tumor necrosis factor binding protein on
fatty-streak formation in apolipoprotein E-deficient mice.
Circulation. 1998;97:242–244.
18. Bevilacqua MP, Pober JS, Wheeler ME, Cotran RS, Gimbrone MA Jr. Interleukin-1 acts on cultural human vascular endothelium to increase the adhesion of polymorphonuclear leukocytes, monocytes and related leukocyte cell lines. J Clin Invest. 1985;76:2003–2011.
19.
Cybulsky MI, Gimbrone MA Jr.
Endothelial expression of a mononuclear leukocyte
adhesion molecule during atherogenesis. Science. 1991;251:788–791.
20.
Palinski W, Ord VA, Plump AS, Breslow JL, Steinberg D,
Witztum JL. ApoE-deficient mice are a model of lipoprotein oxidation in
atherogenesis: demonstration of oxidation-specific epitopes in lesions
and high titers of autoantibodies to malondialdehyde-lysine in serum.
Arterioscler Thromb. 1994;14:605–616.
21. Boyum A. Isolation of human blood monocytes with Nycodenz, a new non-ionic iodinated gradient medium. Scand J Immunol. 1983;17:429–436.[Medline] [Order article via Infotrieve]
22. Stibenz D, Buhrer C. Down-regulation of L-selectin surface expression by various leukocyte isolation procedures. Scand J Immunol. 1994;39:59–63.
23. Labarca C, Paigen K. A simple, rapid, and sensitive DNA assay procedure. Anal Biochem. 1980;102:344–352.[Medline] [Order article via Infotrieve]
24. Bylock AL, Gerrity RG. Visualization of monocyte recruitment into atherosclerotic arteries using fluorescent labelling. Atherosclerosis. 1988;71:17–25.[Medline] [Order article via Infotrieve]
25.
Patel SS, Thiagarajan R, Willerson JT, Yeh ETH.
Inhibition of 4 integrin and ICAM-1
markedly attenuate macrophage homing to atherosclerotic plaques
in apoE-deficient mice. Circulation. 1998;97:75–81.
26.
Han KH, Han KO, Green SR, Quehenberger O. Expression of
the monocyte chemoattractant protein-1 receptor CCR2 is increased in
hypercholesterolemia: differential effects of
plasma lipoproteins on monocyte function. J Lipid Res. 1999;40:1053–1063.
27. Libby P, Sukhova G, Lee RT, Galis ZS. Cytokines regulate vascular functions related to stability of the atherosclerotic plaque. J Cardiovasc Pharmacol. 1995;25(suppl 2):S9–S12.
28.
Moazzam F, Delano FA, Zweifach BW,
Schmid-Schönbein GW. The leukocyte response to fluid stress.
Proc Natl Acad Sci U S A. 1997;94:5338–5343.
29. Pober JS, Bevilacqua MP, Mendrick DL, Lapierre LA, Fiers W, Gimbrone MA Jr. Two distinct monokines, interleukin 1 and tumor necrosis factor, each independently induce biosynthesis and transient expression of the same antigen on the surface of cultured human vascular endothelial cells. J Immunol. 1986;136:1680–1687.[Abstract]
30. Carew TE, Beltz WF. Kinetics of low density lipoprotein labeled with [14C] sucrose: theoretical basis for a method for tracing the sites of apoprotein degradation in vivo. In: Berman M, Grundy SM, Howard BV, eds. Lipoprotein Kinetics and Modelling. New York, NY: Academic Press; 1982;169–179.
31.
Carew TE, Pittman RC, Marchand ER, Steinberg D.
Measurement in vivo of irreversible degradation of low density
lipoprotein in the rabbit aorta.
Arteriosclerosis. 1984;4:214–224.
32. Van Furth R, Cohn ZA. The origin and kinetics of mononuclear phagocytes. J Exp Med. 1968;128:415–433.[Abstract]
33. Van Furth R, Diesselhoff-den Dulk MMC, Mattie H. Quantitative study on the production and kinetics of mononuclear phagocytes during an acute inflammatory reaction. J Exp Med. 1973;138:1314–1330.[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  M. F. Kircher, J. Grimm, F. K. Swirski, P. Libby, R. E. Gerszten, J. R. Allport, and R. Weissleder Noninvasive In Vivo Imaging of Monocyte Trafficking to Atherosclerotic Lesions Circulation, January 22, 2008; 117(3): 388 - 395. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. K. Swirski, M. J. Pittet, M. F. Kircher, E. Aikawa, F. A. Jaffer, P. Libby, and R. Weissleder Monocyte accumulation in mouse atherogenesis is progressive and proportional to extent of disease PNAS, July 5, 2006; 103(27): 10340 - 10345. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. P. Choudhury, J. X. Rong, E. Trogan, V. I. Elmalem, H. M. Dansky, J. L. Breslow, J. L. Witztum, J. T. Fallon, and E. A. Fisher High-Density Lipoproteins Retard the Progression of Atherosclerosis and Favorably Remodel Lesions Without Suppressing Indices of Inflammation or Oxidation Arterioscler Thromb Vasc Biol, October 1, 2004; 24(10): 1904 - 1909. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. R. Portugal, L. R. Fernandes, G. C. Cesar, H. C. Santiago, D. R. Oliveira, N. M. Silva, A. A. Silva, J. Lannes-Vieira, R. M. E. Arantes, R. T. Gazzinelli, et al. Infection with Toxoplasma gondii Increases Atherosclerotic Lesion in ApoE-Deficient Mice Infect. Immun., June 1, 2004; 72(6): 3571 - 3576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Litovsky, M. Madjid, A. Zarrabi, S. W. Casscells, J. T. Willerson, and M. Naghavi Superparamagnetic Iron Oxide-Based Method for Quantifying Recruitment of Monocytes to Mouse Atherosclerotic Lesions In Vivo: Enhancement by Tissue Necrosis Factor-{alpha}, Interleukin-1{beta}, and Interferon-{gamma} Circulation, March 25, 2003; 107(11): 1545 - 1549. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. J. Van Lenten, A. C. Wagner, G.M. Anantharamaiah, D. W. Garber, M. C. Fishbein, L. Adhikary, D. P. Nayak, S. Hama, M. Navab, and A. M. Fogelman Influenza Infection Promotes Macrophage Traffic Into Arteries of Mice That Is Prevented by D-4F, an Apolipoprotein A-I Mimetic Peptide Circulation, August 27, 2002; 106(9): 1127 - 1132. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Lessner, H. L. Prado, E. K. Waller, and Z. S. Galis Atherosclerotic Lesions Grow Through Recruitment and Proliferation of Circulating Monocytes in a Murine Model Am. J. Pathol., June 1, 2002; 160(6): 2145 - 2155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Bobik and N. Kalinina Tumor Necrosis Factor Receptor and Ligand Superfamily Family Members TNFRSF14 and LIGHT: New Players in Human Atherogenesis Arterioscler Thromb Vasc Biol, December 1, 2001; 21(12): 1873 - 1875. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||