Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
« Previous Article | Table of Contents | Next Article »
Arteriosclerosis, Thrombosis, and Vascular Biology. 2000;20:1912-1919

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ellis, P. D.
Right arrow Articles by Kemp, P. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ellis, P. D.
Right arrow Articles by Kemp, P. R.
Related Collections
Right arrow Mechanism of atherosclerosis/growth factors
Right arrow Animal models of human disease
Right arrow Smooth muscle proliferation and differentiation
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2000;20:1912.)
© 2000 American Heart Association, Inc.

Vascular Biology

Nov Gene Encodes Adhesion Factor for Vascular Smooth Muscle Cells and Is Dynamically Regulated in Response to Vascular Injury

Peter D. Ellis; Qin Chen; Patrick J. Barker; James C. Metcalfe; Paul R. Kemp

From the Section of Cardiovascular Biology (P.D.E., J.C.M., P.R.K.), Department of Biochemistry, and the Physiological Laboratory (Q.C.), University of Cambridge, Cambridge, UK, and the Microchemical Facility (P.J.B.), The Babraham Institute, Cambridge, UK. Dr Chen is now at Brigham and Women’s Hospital, Harvard Medical School, Boston, Mass.

Correspondence to Dr Peter D. Ellis, Section of Cardiovascular Biology, Department of Biochemistry, University of Cambridge, Tennis Court Road, Cambridge, CB2 1QW, UK. E-mail pde1001{at}mole.bio.cam.ac.uk


*    Abstract
up arrowTop
 *Abstract
down arrowIntroduction
 down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Abstract—Nephroblastoma overexpressed (NOV) is a member of the CCN family (connective tissue growth factor, CYR61, and NOV) of proteins that are involved in regulating the proliferation, differentiation, and adhesion of a variety of cell types. We have examined the expression of the Nov gene and NOV protein by vascular smooth muscle cells (VSMCs), in vitro and in vivo, and the effects of recombinant NOV on VSMCs. Rat aortic VSMCs were found to express Nov mRNA and NOV protein in vitro and in vivo. Nov expression in adult rat tissues was very high in the aorta and was detected only weakly in the brain and lung by Northern analysis (relative levels 33:3:1). During postnatal development (3 days to 12 weeks), the expression of Nov was correlated with markers of the differentiated smooth muscle cell phenotype (smooth muscle myosin heavy chain and SM22{alpha}). In the rat carotid artery balloon injury model, Nov was detectable by in situ hybridization and was downregulated in the media of the injured artery compared with the uninjured artery at 7 and 14 days after injury. Expression in the developing intima was barely detectable at 7 days after injury except for strong expression at the luminal surface. At 14 days after injury, Nov expression was substantially increased throughout the intima. In vitro studies of the function of NOV protein showed that it promoted VSMC adhesion via a mechanism that was divalent cation and Arg-Gly-Asp independent but that it did not modulate VSMC proliferation or phenotype. The strong expression and dynamic regulation of Nov in the arterial wall, together with its ability to promote VSMC adhesion, suggest that it may be involved in homeostasis and repair.


Key Words: Nov gene • CCN family • gene expression • balloon injury


*    Introduction
up arrowTop
 up arrowAbstract
 *Introduction
down arrowMethods
 down arrowResults
 down arrowDiscussion
 down arrowReferences
 
In experiments designed to screen for basic helix-loop-helix transcription factors potentially involved in controlling vascular smooth muscle cell (VSMC) phenotype, we obtained a set of known factors, including Dermo-1 and Twist.1 2 A number of other clones were also isolated, and among those identified was the Nov gene.3 Nov does not encode a transcription factor but encodes a member of the CCN family of growth regulators (for a recent review, see Reference 4 ). Prototypical members of the CCN family (cysteine-rich [CYR61], connective tissue growth factor [CTGF], and nephroblastoma overexpressed [NOV]) are characterized by a high degree of sequence homology that includes complete conservation of 38 cysteine residues.5 Analysis of each protein revealed 4 distinct protein modules: an insulin-like growth factor binding domain, a von Willebrand factor type C repeat, a thrombospondin type 1 repeat, and a C-terminal module.5 In addition, each of the proteins possesses an amino-terminal signal peptide, indicating that they are secreted proteins.

CYR61 and CTGF are the most extensively studied members of the CCN family. Both proteins have been shown to associate with the extracellular matrix, and the recombinant proteins regulate a diverse array of cellular activities, including adhesion,6 7 8 9 10 migration,6 8 9 11 proliferation,8 9 11 12 differentiation,13 survival,6 matrix gene expression,14 15 and angiogenesis.6 11 16 From their expression patterns in development and disease, it has been suggested that CYR61 and CTGF are involved in the regulation of chondrogenesis8 13 and wound repair17 and in the pathogenesis of cancers15 18 and fibrotic19 20 21 and vascular diseases.22 In contrast to the association of CYR61 and CTGF with tumorigenesis, 2 new members of the CCN family, ELM-1 (expressed in low metastatic type 1 cells) and COP-1, are suggested to inhibit tumorigenesis.23 24

Relatively little is known about the function of NOV.3 4 5 However, NOV is potentially of interest in relation to vascular disease because the data suggest that it is an inhibitor of cell proliferation, first demonstrated for chick embryo fibroblasts (CEFs) grown in soft agar.3 Furthermore, it has been shown that Nov is downregulated in CEFs transformed by tsp60v-src and in proliferating untransformed cells stimulated by serum or phorbol ester.25 These observations prompted us to determine whether expression of the gene was correlated with the differentiated nonproliferating VSMC phenotype in vitro and in vivo. We compared the amount of Nov in RNA extracted from intact rat aortas at different stages of postnatal development with the differentiated status of the VSMCs defined by the expression of smooth muscle myosin heavy chain (SM-MHC) and SM22{alpha} genes. In the rat carotid balloon injury model, significant VSMC migration, proliferation, and dedifferentiation occur in response to arterial injury.26 27 28 Therefore, we compared the expression of Nov in the media of the uninjured carotid artery with the expression of Nov in the media and intima of the injured artery. The effect of recombinant NOV protein on the proliferation, differentiation, and adhesion of VSMCs was also determined.


*    Methods
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 *Methods
down arrowResults
 down arrowDiscussion
 down arrowReferences
 
Cell Culture
Rat aortic VSMCs from adult (12-week-old) Wistar rats, derived previously as described,44 were maintained in DMEM supplemented with 10% (vol/vol) FCS.

Proteins, Peptides, and NOV Antibody
NOV antibody was raised by immunizing rabbits with synthetic peptides corresponding to the 21 C-terminal residues (334 to 354) of mouse NOV. This region bears little sequence homology to other CCN family proteins. The NOV antibody did not cross-react with recombinant CYR61 or CTGF, CCN proteins previously shown to be expressed by VSMCs (References 9 22 , data not shown). IgG fractions were prepared from crude serum samples by using a commercial IgG purification kit (Pierce) and following the manufacturer’s instructions. Rat platelet-derived growth factor and human basic fibroblast growth factor were from R & D systems. Vitronectin was from Sigma Chemical Co. GRGDS and GRGES peptides were purchased from Bachem.

Reverse Transcription–PCR and Cloning
Reverse transcription was performed on total RNA isolated from cultured rat aortic VSMCs as described.40 Degenerate primed PCR was performed in a 50-µL PCR reaction containing 5 µL cDNA, Taq reaction buffer, 200 µmol/L dNTPs, 125 pmol primer A [CGC (A/C/T)TT (C/T)CG NGA (A/G)CT (A/C/G)CG, corresponding to amino acids 113 to 118 (AFAELR) of Thing-1, now known as eHAND45 ], 125 pmol primer B [(A/G)TA NC(A/T) NGT NGC (C/G)AG (C/G/T)G(G/T) (C/G)AG, reverse and complement of the sequence corresponding to amino acids 136 to 142 (LRLATSY) of eHAND45 ], and 2.5 U Taq polymerase. Reactions were performed by using 35 cycles of 1 minute at 95°C, 1 minute at 52°C, and 1 minute at 72°C. Amplification products of {approx}90 bp were purified and cloned into pCRII (Invitrogen). Clones were sequenced by use of T7 polymerase (Pharmacia) or automatically on an ABI 373 sequencer.

PCR amplification of Nov coding sequences was performed as described above by using 12.5 pmol upstream primer (CGAAAGCGATGCCTCTGCCTAGGCTTC, nucleotides 42 to 74 of MMNOVR), 12.5 pmol downstream primer (GCACCTGTTAAATTTCTCCTCTGCTTG, nucleotides 1104 to 1078 of MMNOVR), and an annealing temperature of 57°C. PCR products were cloned in the pGEM-T-Easy vector (Promega) and sequenced as described above.

Northern Blot Analysis
Total RNA was prepared from cell cultures and tissues by using the acid guanidinium thiocyanate–phenol-chloroform method.46 RNA samples (10 µg per lane) were subjected to Northern blot analysis as previously described.47 The Nov cDNA probe that was used spanned the entire coding cDNA for Nov. SM-MHC, SM22{alpha}, and ß-actin cDNA probes have been described previously.40 48 49 After hybridization, blots were washed to high stringency (0.1x SSC and 0.1% SDS at 65°C) and analyzed by use of a PhosphorImager and ImageQuant software (Molecular Dynamics).

[35S]Methionine Labeling and Immunoprecipitation of NOV
Subconfluent dishes of rat aortic VSMCs were incubated with DMEM deficient in methionine and cysteine (DMEM*) for 1 hour at 37°C before labeling. Cells were then labeled for 4 hours with 100 µCi/mL ProMix ([35S]methionine and [35S]cysteine, Amersham International) in 2 mL DMEM* containing 10% (vol/vol) FCS. The culture medium from the dishes of labeled cells was removed and pooled, and a protease inhibitor cocktail (Sigma) was added to 1% (vol/vol) before freezing at -85°C. Cells were washed in ice-cold PBS and lysed in 800 µL (per dish) RIPA buffer (150 mmol/L NaCl, 50 mmol/L Tris-HCl, pH 8.0, 1% [vol/vol] Nonidet P-40, 0.5% sodium deoxycholate, and 0.1% SDS) containing 1% (vol/vol) protease inhibitor cocktail (Sigma) for 20 minutes on ice. Lysates were clarified by centrifugation at 12 000g for 10 minutes at 4°C, pooled, and frozen at -85°C. After they were thawed, lysates and medium samples were divided into aliquot portions (800 µL lysate and 2 mL medium), and each sample was precleared by incubation with 25 µL of protein A–agarose (Sigma) for 1 hour at 4°C. Samples were incubated for 2 hours on ice with either 2.5 µg/mL preimmune IgG or 2.5 µg/mL relevant IgG in the presence or absence of 15 µg/mL competing peptide used as the immunogen. Immune complexes were precipitated by incubating the samples with 25 µL protein A–agarose for 2 hours at 4°C. Protein A beads were washed 4 times with ice-cold RIPA buffer, and bound proteins were solubilized in SDS-PAGE sample buffer. Protein samples were separated on 12% SDS-PAGE gels, which were incubated in fluorographic reagent (Amplify, Amersham), dried, and exposed to Fuji RX film at -85°C.

Western Blot Analysis
For the analysis of NOV protein, the aorta of a female adult Wistar rat was dissected, stripped of surrounding tissue, and snap-frozen in liquid nitrogen. After reducing the tissue to powder at -80°C, total protein was extracted into 500 µL 2x sample buffer (1x sample buffer consists of 125 mmol/L Tris-HCl, pH 6.8, 10% [vol/vol] glycerol, 2% [wt/vol] SDS, 0.1 mg/mL bromophenol blue, and 2% [vol/vol] ß-mercaptoethanol). Forty microliters of the protein extract (per lane) was separated on a 13% SDS-PAGE gel and blotted onto a PVDF membrane (Immobilon-P, Millipore). Blots were incubated overnight at 4°C in PBS containing 5% (wt/vol) nonfat milk, 0.1% (vol/vol) Tween 20, and either 0.4 µg/mL preimmune IgG or 0.4 µg/mL anti-NOV IgG in the absence or presence of 20 µg/mL NOV blocking peptide. Blots were incubated with an anti-rabbit IgG conjugated to horseradish peroxidase, and immunoreactive bands were visualized by using the enhanced chemiluminescence detection system (Pierce) and following the manufacturer’s recommendations.

For the analysis of SM-MHC expression, adult rat aortic VSMCs were isolated as described44 and seeded into 24-well plates that had been coated with NOV (100 µg/mL) overnight at 4°C or left uncoated. Cells were harvested after 0, 72, and 144 hours in primary culture in the presence of serum. Cells were trypsinized and counted before being lysed in 1x sample buffer without bromophenol blue and ß-mercaptoethanol. The protein concentration was determined by using the bicinchoninic acid method (Sigma). Total protein (2.5 µg per lane) was separated onto a 4% to 12% SDS-PAGE gel (Novex) and analyzed by Western blotting as described above with use of an anti–SM-MHC polyclonal antibody (1:10 00050 ).

Balloon Catheter Injury of the Rat Carotid Artery
Twelve-week-old female Wistar rats (n=6), weighing {approx}300 g, were subjected to balloon catheter injury of the carotid artery according to the protocol of Brown et al.51 Animals were euthanized either 7 days (n=3) or 14 days (n=3) after surgery by CO2 asphyxiation, and the left and right common carotid arteries were excised. Loose surrounding tissue was carefully removed, and both arteries were immersed together in a 10-mL syringe filled with Cryo-M-Bed (Bright Instruments), snap-frozen in liquid nitrogen, and stored at -85°C.

In Situ Hybridization
Sense and antisense riboprobes were synthesized in the presence of [{alpha}-35S]UTP ({approx}1500 Ci/mmol, 20 mCi/mL; Amersham) from pBluescript vector containing bases 388 to 1004 of the Nov cDNA by using an in vitro transcription kit (Maxi-Script, Ambion). Sections (12 µm) were cut, thaw-mounted onto microscope slides (SuperFrost Plus, BDH), and refrozen at -85°C. Sections were thawed into PBS containing 4% (wt/vol) paraformaldehyde for 30 minutes at room temperature. Section pretreatments, hybridization, and washing were carried out according to the method of Trezise et al.52 Sections were exposed to autoradiographic emulsion (NK2B, Kodak) for 4 days at 4°C. After development, sections were stained with Harris’ hematoxylin (Sigma) and mounted. Photomicrography was carried out by using a Nikon microscope (Eclipse E600) with Nikon photographic equipment (H-III).

Production and Purification of Recombinant NOV Protein
The entire open reading frame of the rat NOV cDNA was cloned into the baculovirus transfer vector, pBlueBac 4.5 (Invitrogen). A purified high-titer stock of recombinant NOV baculovirus (NovBac.4) was generated with use of the MaxBac 2.0 kit (Invitrogen) according to the manufacturer’s instructions, except that Sf9 cells were grown in SF900II medium, and BSA (Sigma) was added to 0.5% (wt/vol) for storage of the virus. Log-phase Sf9 cells in shaker culture were infected with NovBac.4 at an approximate multiplicity of infection of 10. After 60 hours, the conditioned medium was harvested by centrifugation at 5000 rpm for 10 minutes at 4°C and further clarified by filtration through a 1.6-µm glass-fiber filter (Millipore). The medium was adjusted to 10 mmol/L Tris-HCl, pH 7.0, and 1 mmol/L EDTA and applied to a 5-mL heparin-Sepharose column (Amersham-Pharmacia Biotech) at 2.5 mL/min at 4°C. The column was washed with 80 column volumes of buffer A (10 mmol/L Tris-HCl, pH 7.0, and 1 mmol/L EDTA) containing 0.15 mol/L NaCl, and bound proteins were eluted with a 50 mL linear NaCl gradient (0.15 to 1 mol/L in buffer A). Fractions containing partially purified NOV were gel-filtered with use of a Superdex-75 gel filtration column (Amersham-Pharmacia Biotech) equilibrated in buffer A containing 0.5 mol/L NaCl. The eluate was diluted at a ratio of 1:4 with buffer B (50 mmol/L MES-NaOH, pH 6.0, and 1 mmol/L EDTA) and applied to a 5-mL Sepharose-SP column (Amersham-Pharmacia Biotech) at 1 mL/min at 4°C. The column was washed with 5 column volumes of buffer B containing 0.1 mol/L NaCl, and bound proteins were eluted with a linear NaCl gradient (0.1 to 1 mol/L NaCl, in buffer B). Fractions containing purified NOV were pooled and dialyzed extensively against Dulbecco’s PBS (GIBCO). The protein concentration was determined by using Bradford assay reagent (Sigma) with BSA as the protein standard. The protein was stored in 100 µL aliquots at -20°C.

DNA Synthesis Assays
VSMCs were seeded into 24-well plates at 1.5x104 cells per well and grown for 2 days. The cells were made quiescent by serum starvation for 48 hours and then stimulated with DMEM supplemented with platelet-derived growth factor (100 ng/mL), basic fibroblast growth factor (100 ng/mL), or serum (10% [vol/vol]) in the presence or absence of NOV (5 µg/mL). Eighteen hours after stimulation [3H]thymidine (5 µCi/mmol, Amersham Pharmacia) was added to 1 µCi/mL, and after a further 6 hours, cells were harvested, and incorporation of [3H]thymidine was determined as described.53

Cell Adhesion
Immunologic microtiter wells (Maxi-Sorp, GIBCO) were coated in Dulbecco’s PBS (GIBCO) containing protease-free BSA (Sigma), NOV (15 µg/mL), or vitronectin (1 µg/mL) for 16 to 20 hours at 4°C. Wells were blocked with PBS containing 1% (wt/vol) BSA for 1 hour at room temperature before the addition of cells. VSMCs were grown to confluence and then harvested by trypsinization. The cells were washed in DMEM+10% FCS, centrifuged, resuspended in serum-free DMEM, and adjusted to {approx}3x105 cells per milliliter. One hundred microliters of this suspension was added to each test well, and after incubation at 37°C for 1 hour, adhered cells were fixed in saline containing 4% (vol/vol) formaldehyde. Cells were stained with methylene blue and quantified by measuring the absorbance of the extracted dye at 650 nm. The absorbance of the extracted dye at 650 nm was directly proportional to the number of attached cells up to a plating density of 7.5x104 cells per well (data not shown).


*    Results
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 *Results
down arrowDiscussion
 down arrowReferences
 
Identification and Cloning of the Rat Nov Gene
Expression of the Nov gene in adult rat aortic VSMCs in vitro was detected as a 90-bp polymerase chain reaction (PCR) product amplified as part of a degenerate primed PCR screen for basic helix-loop-helix proteins by use of primers to the helix-loop-helix domain of eHAND (see Methods). To isolate the complete rat Nov coding sequence, primers (see Methods) based on the mouse and human Nov sequences were made, and a full coding sequence for Nov was amplified from rat aortic cDNA. The resultant PCR product was cloned into pTAG and sequenced. This sequence was 99.8% identical to that recently reported for rat Nov29 (accession number AF171936). The nucleotide sequence of rat Nov was 91% and 79.4% homologous to mouse Nov and human Nov, respectively, and the corresponding predicted protein sequence was 92% and 81.1% homologous, respectively.

Nov Expression by Rat Aortic VSMCs in Culture
Previous studies have shown that Nov expression in CEF cells was increased when the cells became quiescent.25 To determine whether Nov expression by VSMCs was affected by proliferation, RNA was extracted from proliferating and stationary-phase adult rat aortic VSMCs and analyzed by Northern blotting. Nov mRNA was detected as a major transcript of 2.5 kb and a minor transcript of {approx}2.0 kb (Figure 1aDown). The level of Nov mRNA in adult rat aortic VSMCs in vitro was very similar in subconfluent proliferating cells and in the same cell cultures after the stationary phase was reached (Figure 1aDown; see Methods). However, withdrawal of serum from either cell culture for 24 hours resulted in a 2- to 3-fold increase in Nov expression (Figure 1aDown). These observations suggest that Nov expression in rat aortic VSMCs is downregulated by growth factors and/or mitogens present in FCS irrespective of whether the cells are proliferating or not.



View larger version (44K):
[in this window]
[in a new window]
  		Figure 1. Nov mRNA and protein expression in vitro and in vivo. a, Total RNA (10 µg per lane) isolated from log-phase or stationary-phase VSMCs (as determined by cell counting after trypsinization) cultured for 24 hours in the absence (-) or presence (+) of serum was analyzed by Northern blotting with use of a 32P-labeled Nov cDNA probe. The blot was also probed with a ß-actin cDNA (not shown) to normalize for differences in RNA loading. b, Subconfluent dishes of VSMCs were labeled for 4 hours with a mixture of 35S-labeled methionine and cysteine. Aliquots of cell lysates or culture medium were subjected to immunoprecipitation (see Methods) with use of preimmune IgG (lanes 1 and 4) or anti-NOV IgG in the presence (lanes 2 and 5) or absence (lanes 3 and 6) of a NOV-competing peptide. Recovered proteins were analyzed by SDS-PAGE (12%) and fluorography and compared with the molecular mass markers indicated. c, Total RNA (10 µg per lane) isolated from various adult rat tissues was analyzed by Northern blotting with use of 32P-labeled Nov and ß-actin cDNA probes. d, Total protein was extracted from adult rat aorta (see Methods) and analyzed by Western blotting with use of preimmune IgG (lane 1) or anti-NOV IgG in the presence (lane 2) or absence (lane 3) of a NOV-competing peptide. The positions of molecular mass markers (in kilodaltons) are indicated. The arrow indicates the position of an unknown protein ({approx}60 kDa) that cross-reacted with the NOV antibody.

The CCN proteins identified to date all contain a leader peptide and are secreted proteins. To determine whether rat aortic VSMCs synthesized and secreted NOV, cells were cultured in cysteine- and methionine-free medium that had been supplemented with 35S-labeled cysteine and methionine. The cells and medium were harvested after 4 hours, and NOV was immunoprecipitated from both samples. NOV was detected as 2 forms that migrated at {approx}46 kDa and 48 kDa in the cell lysates (Figure 1bUp) and as at least 1 form of 48 kDa in the medium. These forms of NOV are larger than the predicted primary NOV translation product (40 kDa), and this difference in size is likely to reflect N-glycosylation of the protein as previously described.30

Nov Expression In Vivo
Previous data have shown that Nov is expressed in a range of tissues in rats, humans, and chickens.3 29 31 To determine whether vascular smooth muscle expressed Nov in vivo, RNA was isolated from a variety of adult rat tissues, and Nov expression was determined by Northern analysis. By far the strongest expression of Nov was in the aorta, and it was also detected weakly in the brain and lung (Figure 1cUp). The relative amounts of Nov mRNA in the 3 tissues normalized to lung were 33:3:1, respectively. Western analysis of protein isolated from the rat aorta showed that the RNA was translated into protein. NOV was detected as a doublet of {approx}46 to 48 kDa and an additional doublet of {approx}28 to 30 kDa (Figure 1dUp). The lower molecular mass forms of NOV are likely to reflect proteolysis of NOV at the hinge region of the protein,5 as previously observed for insect cell– and mammalian cell–derived NOV.32

In situ hybridization of a 35S-labeled antisense Nov probe in rat aortic sections showed that Nov mRNA was highly expressed by the smooth muscle cells of the aorta (Figure 2aDown through 2d). Similar analysis of adult rat lung sections showed that Nov mRNA expression was also restricted to the smooth muscle cells of the lung (Figure 2eDown through 2h).



View larger version (81K):
[in this window]
[in a new window]
  		Figure 2. Nov mRNA localization in adult aorta and lung. Sections of adult aorta (a through d) and lung (e through h) were hybridized to 35S-labeled sense (a, b, e, and g) or antisense (c, d, f, and h) Nov riboprobes. Shown are bright-field images with the corresponding dark-field image underneath. L indicates lumen; M, media; A, adventitia; V, arteriole; and B, bronchiole. Original magnification x200.

Nov Expression in the Aorta During Postnatal Development
Experiments were performed to determine whether Nov expression was correlated with the differentiated status of rat aortic smooth muscle cells. Compared with adult aortic VSMCs, the VSMCs of the neonatal aorta have previously been shown to express less mRNA for several markers of the fully differentiated VSMC phenotype.33 Nov expression was compared with the expression of SM-MHC and SM22{alpha} in RNA isolated from the aorta of 3- and 14-day-old neonatal rats and adult rats (Figure 3aDown). Nov mRNA was detectable by Northern analysis in all 3 samples and was {approx}10-fold higher in the aortas of the adult rats than in the aortas of the neonatal rats (Figure 3bDown). These data show that Nov expression was correlated with the expression of VSMC differentiation markers during postnatal development. A similar correlation of Nov expression with markers of VSMC differentiation was observed in passaged rat aortic VSMCs that had dedifferentiated in vitro (FigureUp 3a and 3b).



View larger version (28K):
[in this window]
[in a new window]
  		Figure 3. Nov mRNA expression during postnatal development of the rat aorta. a, Total RNA (10 µg per lane) isolated from adult rat aorta (lane 1), from cultured adult rat aortic VSMCs (lane 2), and from 14-day-old and 3-day-old neonatal rat aortas (lanes 3 and 4, respectively) was analyzed by Northern blotting. The blot was probed with a 32P-labeled Nov cDNA probe as described in Methods. The same blot was also probed by using SM-MHC, SM22{alpha}, and ß-actin cDNAs. b, Bar graph shows the relative levels of Nov, SM-MHC, and SM22{alpha} mRNAs from Northern blot analysis (shown in panel a) after normalizing against ß-actin mRNA levels. Signal intensities were determined by ImageQuant software.

Expression of Nov in the Rat Carotid Injury Model
Dedifferentiated arterial VSMCs are generated in response to arterial injury.27 For example, in the rat carotid injury model, VSMCs are the only type of cells that have been detected in the neointima and are dedifferentiated compared with the uninjured medial cells, as defined by their levels of smooth muscle–specific contractile proteins.34 35 Therefore, it was of interest to determine whether Nov expression was correlated with the differentiated phenotype of the VSMCs in this model. In situ hybridization showed that Nov was easily detectable and uniformly expressed in the uninjured left carotid artery at 7 and 14 days after injury of the right carotid artery and was similar to the expression of Nov in the aorta (Figure 4Down). At 7 days after balloon injury, Nov expression in the media of the injured carotid artery was substantially reduced, and expression was very low in the developing intima compared with the media of the uninjured artery except at the luminal edge of the intima, where expression was high. At 14 days after injury, expression of Nov in the media of the injured artery remained low but was substantially increased in the VSMCs throughout the intima.



View larger version (83K):
[in this window]
[in a new window]
  		Figure 4. Nov mRNA expression in balloon-injured rat carotid arteries. Sections of the uninjured left or balloon-injured right carotid arteries of adult rats, 7 days and 14 days after injury, were hybridized to a 35S-labeled Nov antisense riboprobe and washed as described in Methods. Hybridization of the probe is shown as a dark-field image. A bright-field image of an adjacent section, stained with hematoxylin, is shown above. L indicates lumen; M, media; I, neointima; and A, adventitia. Original magnification x200. No signals were detected when the Nov sense riboprobe was used (not shown).

Effects of NOV Protein on VSMCs In Vitro
Other members of the CCN family of proteins have been shown to modulate the growth, differentiation, and adhesion of a variety of cell types. To determine the function of NOV protein on arterial VSMCs, we generated purified recombinant NOV protein (Figure 5aDown) by using the baculoviral expression system (see Methods). Addition of NOV to serum-starved VSMCs did not cause the cells to synthesize DNA in the absence of added mitogen nor did it affect serum- or growth factor–stimulated DNA synthesis in the same cells (Figure 5bDown). Furthermore, plating primary VSMCs onto NOV-coated wells also had no effect on the rate of cell proliferation (Figure 5cDown).



View larger version (24K):
[in this window]
[in a new window]
  		Figure 5. Effects of recombinant NOV protein on VSMC phenotype. a, Recombinant NOV protein was produced in insect cells, purified to homogeneity (see Methods), electrophoresed on a 12.5% SDS-PAGE, and detected by silver staining (lane 1, 2.5 µg) or by Western blotting (lane 2, 50 ng). b, Quiescent cultures of VSMCs were incubated in DMEM containing platelet-derived growth factor (PDGF, 100 ng/mL), basic fibroblast growth factor (bFGF, 100 ng/mL), or serum (10% [vol/vol]) in the absence (open bars) or presence (shaded bars) of NOV (5 µg/mL). DNA synthesis was determined by measuring the incorporation of [3H]thymidine (see Methods). c and d, Primary VSMCs were seeded onto uncoated plates or plates coated with NOV (100 µg/mL). The cell counts obtained during a 144-hour culture period are shown in panel c. After counting, cells were lysed, and equal amounts of protein (2.5 µg per lane) were analyzed for SM-MHC content by Western blotting with an SM-MHC antibody (panel d).

VSMCs dispersed into primary culture dedifferentiate, as marked by the loss of expression of smooth muscle–specific proteins (eg, SM-MHC36 ). To determine whether NOV affected the differentiation of VSMCs, primary cells were plated onto NOV-coated wells and cultured for 48, 96, or 144 hours. Western analysis of the SM-MHC content of these cells showed that the cells dedifferentiated whether they were plated onto NOV protein or onto untreated culture plastic (Figure 5dUp). Similar analysis showed that the addition of soluble NOV protein to primary VSMCs also had no effect on the SM-MHC protein content of the cells (results not shown). Taken together, these data indicate that NOV does not affect VSMC proliferation or differentiation, at least under these culture conditions. However, it was noted from these studies that the primary cells could adhere to NOV protein.

To analyze the adhesion of arterial VSMCs to NOV, immunologic microtiter plates were coated with NOV, vitronectin, or BSA. VSMCs were added to the wells and incubated for 60 minutes at 37°C. These experiments showed that VSMCs adhered to NOV or vitronectin but not to BSA (Figure 6aDown). The adhesion of VSMCs to NOV, but not to vitronectin, was inhibited by preincubating the wells with the anti-NOV antibody before cell plating (FigureUp 6a). The inhibitory action of the anti-NOV antibody was reversed if an excess of the C-terminal peptide was present (Figure 6aDown). These data indicate that NOV can specifically promote VSMC adhesion and suggest the existence of a VSMC surface NOV receptor.



View larger version (63K):
[in this window]
[in a new window]
  		Figure 6. Adhesion of cultured VSMCs to NOV. Immunologic plates were coated overnight at 4°C with NOV (15 µg/mL) or vitronectin (VN, 1 µg/mL) and blocked for 1 hour with PBS containing 1% (wt/vol) BSA. VSMCs (100 µL per well, 3x105 cells per milliliter) were added to the wells, and the plates were incubated for 60 minutes at 37°C. Cells were washed 3 times with DMEM, fixed, and quantified with the use of methylene blue (see Methods). a, During the blocking step, some wells were incubated with BSA containing preimmune IgG (150 µg/mL) or anti-NOV IgG (150 µg/mL) in the absence or presence of a NOV-competing peptide (50 µg/mL). b and c, Before they were plated, cells were preincubated for 15 minutes at room temperature in the presence of EDTA (20 mmol/L), GRGES (0.5 mmol/L), GRGDS (0.5 mmol/L), or a NOV-competing peptide (50 µg/mL), which remained present throughout the assay. All assays were performed in triplicate in at least 3 different experiments. Data presented are mean±SEM for a representative experiment. Adhesion of cells to VN varied up to 2-fold relative to NOV (compare panels b and c).

CYR61 and CTGF have been shown to be ligands for the integrin receptor {alpha}vß3.6 10 To determine whether the adhesion of VSMCs to NOV occurred through an integrin-dependent mechanism, cell adhesion assays were performed in the presence of EDTA or the Arg-Gly-Asp (RGD)-containing peptide, GRGDS. Adhesion of VSMCs to vitronectin was abolished by the addition of 20 mmol/L EDTA or 0.5 mmol/L GRGDS but not by the control peptide GRGES (Figure 6bUp and 6cUp). However, neither agent inhibited the adhesion of VSMCs to NOV (Figure 6bUp and 6cUp). The C-terminal peptide of NOV also did not prevent VSMC adhesion to NOV (Figure 6bUp). These data suggest that inhibition of VSMC adhesion to NOV by the NOV antibody is not due to direct interaction with the binding site for the NOV receptor but is presumably due to indirect steric effects. These data indicate that adhesion of VSMCs to NOV is independent of divalent metal ion- and RGD-binding sites, implying that adhesion is not integrin dependent.


*    Discussion
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 *Discussion
down arrowReferences
 
The striking observation described in the present study is the very high level of Nov mRNA expression in the rat aorta and carotid arteries, substantially higher (by at least an order of magnitude) than in the brain and lung tissues previously shown to express this gene.29 Furthermore, Nov expression in the lung was also restricted to the smooth muscle components of the tissue. Very strong expression of Nov is limited to the aorta, which contrasts with expression of CTGF and CYR61, members of the CCN family that are strongly expressed in a wide range of tissues,31 37 38 and therefore suggests a tissue-specific role for Nov in the arterial wall.

The high levels of arterial Nov mRNA expression are correlated with protein expression that is readily detectable by Western blot, and the protein is processed as described previously for NOV.30 However, it was not possible to use the antibody to the C-terminal peptide of NOV for detection by immunofluorescence in the vessel wall because no staining could be detected in sections prepared under a variety of conditions. The native form of the protein was immunoprecipitated by the antibody after secretion from VSMCs in vitro; therefore, it is likely that the antigenic determinant is inaccessible in the arterial sections through interactions of the protein with components of the vessel wall, including VSMCs. The multidomain structure of the protein suggests that it is likely to bind to components of the matrix, including heparin-like oligomers.5

The strong expression of Nov in the intact aorta and smooth muscle cells in the lung suggested that it might be a marker of the fully differentiated smooth muscle phenotype. Expression of Nov was correlated with the expression of genes for smooth muscle–specific contractile proteins in postnatal development and in VSMCs in vitro. Recent immunohistochemical studies have revealed that NOV protein expression is tightly associated with sites of heterotypic blastemal differentiation in Wilms’ tumors30 and that its accumulation in fully differentiated structures of the developing kidney and nervous system is consistent with a role in promoting mesenchymal cell differentiation. However, the data from the carotid balloon injury model suggest that Nov expression is not tightly coupled to the expression of smooth muscle–specific contractile proteins in the complex changes in the vessel wall that occur after injury, including smooth muscle cell dedifferentiation. For example, the levels of SM-MHC and SM-{alpha}-actin proteins are reduced in the intima compared with the media at 14 days after injury,34 whereas the levels of Nov mRNA are increased. This conclusion is consistent with the data showing that although genes for smooth muscle–specific contractile proteins have CArG elements in their promoters and are strongly regulated by serum response factor,39 40 41 42 no CArG elements in the Nov promoter have been identified.43 The data also imply that NOV is unlikely to control smooth muscle phenotype, which is consistent with the inability of recombinant NOV protein to inhibit the dedifferentiation of primary VSMC cultures. It should be noted, however, that there are no data reported for mRNA levels for smooth muscle–specific contractile proteins in the carotid balloon injury model that enable direct comparison with the changes in Nov mRNA levels reported in the present study.

The data for expression of Nov in vivo and the analysis of the effects of NOV protein in vitro provide some insight into functions that NOV may exert in the arterial wall. The pattern of changes in Nov mRNA expression in response to injury and the ability of NOV to promote the adhesion of VSMCs in vitro are consistent with a role in regulating the migration of smooth muscle cells. For example, reduced Nov expression in the media might be involved in releasing VSMCs for migration and proliferation to form the intima, and reexpression of Nov may occur as the migration and proliferation slow down in the later stages of intimal development at day 14. It should also be noted that dedifferentiated proliferating VSMCs express Nov RNA and protein in vitro. Furthermore, the addition of NOV protein to cultured VSMCs did not affect the rate of proliferation in serum or DNA synthesis in response to serum or single mitogens. These data indicate that NOV is not an effective inhibitor of proliferation, at least in vitro. However, the expression of Nov RNA is enhanced when serum is withdrawn, consistent with the strong expression of Nov by quiescent VSMCs in the uninjured media.

Although the structure of NOV has yet to be determined, it is thought that the protein has a multidomain structure. The adhesion of VSMCs to NOV was inhibited by an antibody to the C-terminal 21 amino acids of NOV, suggesting that the cells adhere to the CT domain of the protein. The integrin-independent adhesion of VSMCs to NOV, as evidenced by the absence of inhibition by RGD peptide and EDTA, is in contrast to the adhesion of other cells to CYR61 and CTGF, which have been shown to bind to the integrins {alpha}vß3 and {alpha}iibß3.6 7 10 It remains possible that NOV can also bind to integrins but that binding is masked in our assays through the strong interaction of NOV with other receptors on the VSMC surface. The effects of CYR61 and CTGF on the adhesion of VSMCs have yet to be assayed to determine whether these proteins promote adhesion through an integrin-independent mechanism. Further analysis of the potential functions of NOV in vascular development and response to injury will be facilitated by the development in progress of mice in which the expression of Nov is genetically modified.


*    Acknowledgments
 
This work was funded by a British Heart Foundation project grant (PG96181). P.R.K. is a British Heart Foundation Basic Sciences Lecturer. We are grateful to Rahmi Öklü and Christine Witchell for expert technical assistance.

Received November 23, 1999; accepted March 13, 2000.


*    References
up arrowTop
 up arrowAbstract
 up arrowIntroduction
 up arrowMethods
 up arrowResults
 up arrowDiscussion
 *References
 

  1. Li L, Cserjesi P, Olson EN. Dermo-1: a novel twist-related bHLH protein expressed in the developing dermis. Dev Biol. 1995;172:280–292.[Medline] [Order article via Infotrieve]
  2. Wolf C, Thisse C, Stoetzel C, Thisse B, Gerlinger P, Perrin-Schmitt F. The M-Twist gene of mus is expressed in subsets of mesodermal cells and is closely related to the Xenopus X-Twi and the Drosophila-Twist genes. Dev Biol. 1991;143:363–373.[Medline] [Order article via Infotrieve]
  3. Joliot V, Martinerie C, Dambrine G, Plassiart G, Brisac M, Crochet J, Perbal B. Proviral rearrangements and overexpression of a new cellular gene (nov) in myeloblastosis-associated virus type 1-induced nephroblastomas. Mol Cell Biol. 1992;12:10–21.[Abstract/Free Full Text]
  4. Lau LF, Lam SC. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 1999;248:44–57.[Medline] [Order article via Infotrieve]
  5. Bork P. The modular architecture of a new family of growth regulators related to connective tissue growth factor. FEBS Lett. 1993;327:125–130.[Medline] [Order article via Infotrieve]
  6. Babic AM, Chen CC, Lau LF. Fisp12/mouse connective tissue growth factor mediates endothelial cell adhesion and migration through integrin {alpha}vß3, promotes endothelial cell survival, and induces angiogenesis in vivo. Mol Cell Biol. 1999;19:2958–2966.[Abstract/Free Full Text]
  7. Jedsadayanmata A, Chen CC, Kireeva ML, Lau LF, Lam SC. Activation-dependent adhesion of human platelets to Cyr61 and Fisp12/mouse connective tissue growth factor is mediated through integrin {alpha}IIbß3. J Biol Chem. 1999;274:24321–24327.[Abstract/Free Full Text]
  8. Kireeva ML, Mo FE, Yang GP, Lau LF. Cyr61, a product of a growth factor-inducible immediate-early gene, promotes cell proliferation, migration, and adhesion. Mol Cell Biol. 1996;16:1326–1334.[Abstract]
  9. Kireeva ML, Latinkic BV, Kolesnikova TV, Chen CC, Yang GP, Abler AS, Lau LF. Cyr61 and Fisp12 are both ECM-associated signaling molecules: activities, metabolism, and localization during development. Exp Cell Res. 1997;233:63–77.[Medline] [Order article via Infotrieve]
  10. Kireeva ML, Lam SC, Lau LF. Adhesion of human umbilical vein endothelial cells to the immediate-early gene product Cyr61 is mediated through integrin {alpha}vß3. J Biol Chem. 1998;273:3090–3096.[Abstract/Free Full Text]
  11. Shimo T, Nakanishi T, Nishida T, Asano R, Kanyama M, Kuboki T, Tamatani T, Tezuka K, Takemura M, Matsumura T, et al. Connective tissue growth factor induces the proliferation, migration, and tube formation of vascular endothelial cells in vitro, and angiogenesis in vivo. J Biochem.. 1999;126:137–145.
  12. Frazier K, Williams S, Kothapalli D, Klapper H, Grotendorst GR. Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J Invest Dermatol. 1996;107:404–411.[Medline] [Order article via Infotrieve]
  13. Wong M, Kireeva ML, Kolesnikova TV, Lau LF. Cyr61, product of a growth factor-inducible immediate-early gene, regulates chondrogenesis in mouse limb bud mesenchymal cells. Dev Biol. 1997;192:492–508.[Medline] [Order article via Infotrieve]
  14. Duncan MR, Frazier KS, Abramson S, Williams S, Klapper H, Huang XF, Grotendorst GR. Connective tissue growth factor mediates transforming growth factor ß-induced collagen synthesis: downregulation by cAMP. FASEB J. 1999;13:1774–1786.[Abstract/Free Full Text]
  15. Frazier KS, Grotendorst GR. Expression of connective tissue growth factor mRNA in the fibrous stroma of mammary tumors. Int J Biochem Cell Biol. 1997;29:153–161.[Medline] [Order article via Infotrieve]
  16. Babic AM, Kireeva ML, Kolesnikova TV, Lau LF. CYR61, a product of a growth factor-inducible immediate early gene, promotes angiogenesis and tumor growth. Proc Natl Acad Sci U S A. 1998;95:6355–6360.[Abstract/Free Full Text]
  17. Igarashi A, Okochi H, Bradham DM, Grotendorst GR. Regulation of connective tissue growth factor gene expression in human skin fibroblasts and during wound repair. Mol Biol Cell. 1993;4:637–645.[Abstract]
  18. Igarashi A, Hayashi N, Nashiro K, Takehara K. Differential expression of connective tissue growth factor gene in cutaneous fibrohistiocytic and vascular tumors. J Cutan Pathol. 1998;25:143–148.[Medline] [Order article via Infotrieve]
  19. Igarashi A, Nashiro K, Kikuchi K, Sato S, Ihn H, Fujimoto M, Grotendorst GR, Takehara K. Connective tissue growth factor gene expression in tissue sections from localized scleroderma, keloid, and other fibrotic skin disorders. J Invest Dermatol. 1996;106:729–733.[Medline] [Order article via Infotrieve]
  20. Ito Y, Aten J, Bende RJ, Oemar BS, Rabelink TJ, Weening JJ, Goldschmeding R. Expression of connective tissue growth factor in human renal fibrosis. Kidney Int. 1998;53:853–861.[Medline] [Order article via Infotrieve]
  21. Lasky JA, Ortiz LA, Tonthat B, Hoyle GW, Corti M, Athas G, Lungarella G, Brody A, Friedman M. Connective tissue growth factor mRNA expression is upregulated in bleomycin-induced lung fibrosis. Am J Physiol. 1998;19:L365–L371.
  22. Oemar BS, Werner A, Garnier JM, Do DD, Godoy N, Nauck M, Marz W, Rupp J, Pech M, Luscher TF. Human connective tissue growth factor is expressed in advanced atherosclerotic lesions. Circulation. 1997;95:831–839.[Abstract/Free Full Text]
  23. Hashimoto Y, Shindo-Okada N, Tani M, Nagamachi Y, Takeuchi K, Shiroishi T, Toma H, Yokota J. Expression of the Elm1 gene, a novel gene of the CCN (connective tissue growth factor, Cyr61/Cef10, and neuroblastoma overexpressed gene) family, suppresses in vivo tumor growth and metastasis of K-1735 murine melanoma cells. J Exp Med. 1998;187:289–296.[Abstract/Free Full Text]
  24. Zhang R, Averboukh L, Zhu WM, Zhang H, Jo H, Dempsey PJ, Coffey RJ, Pardee AB, Liang P. Identification of rCop-1, a new member of the CCN protein family, as a negative regulator for cell transformation. Mol Cell Biol. 1998;18:6131–6141.[Abstract/Free Full Text]
  25. Scholz G, Martinerie C, Perbal B, Hanafusa H. Transcriptional down regulation of the nov proto-oncogene in fibroblasts transformed by p60v-src. Mol Cell Biol. 1996;16:481–486.[Abstract]
  26. Clowes AW, Reidy MA, Clowes MM. Mechanisms of stenosis after arterial injury. Lab Invest. 1983;49:208–215.[Medline] [Order article via Infotrieve]
  27. Clowes AW, Clowes MM, Kocher O, Ropraz P, Chaponnier C, Gabbiani G. Arterial smooth muscle cells in vivo: relationship between actin isoform expression and mitogenesis and their modulation by heparin. J Cell Biol. 1988;107:1939–1945.[Abstract/Free Full Text]
  28. Kocher O, Gabbiani F, Gabbiani G, Reidy MA, Cokay MS, Peters H, Huttner I. Phenotypic features of smooth muscle cells during the evolution of experimental carotid artery intimal thickening: biochemical and morphological studies. Lab Invest. 1991;65:459–470.[Medline] [Order article via Infotrieve]
  29. Liu C, Liu X-J, Crowe PD, Kelner GS, Fan J, Barry G, Manu F, Ling N, De Souza EB, Maki RA. Nephroblastoma overexpressed gene (NOV) codes for a growth factor that induces protein tyrosine phosphorylation. Gene. 1999;238:471–478.[Medline] [Order article via Infotrieve]
  30. Chevalier G, Yeger H, Martinerie C, Laurent M, Alami J, Schofield PN, Perbal B. novH: differential expression in developing kidney and Wilms’ tumors. Am J Pathol. 1998;152:1563–1575.[Abstract]
  31. Jay P, BergeLefranc JL, Marsollier C, Mejean C, Taviaux S, Berta P. The human growth factor-inducible immediate early gene, CYR61, maps to chromosome 1p. Oncogene. 1997;14:1753–1757.[Medline] [Order article via Infotrieve]
  32. Perbal B, Martinerie C, Sainson R, Werner M, He B, Roizman B. The C-terminal domain of the regulatory protein NOVH is sufficient to promote interaction with fibulin 1C: a clue for a role of NOVH in cell-adhesion signaling. Proc Natl Acad Sci U S A. 1999;96:869–874.[Abstract/Free Full Text]
  33. Shanahan CM, Weissberg PL. Smooth muscle cell heterogeneity: patterns of gene expression in vascular smooth muscle cells in vitro and in vivo. Arterioscler Thromb Vasc Biol.. 1998;18:333–338.[Abstract/Free Full Text]
  34. Grainger DJ, Metcalfe JC, Grace AA, Mosedale DE. Transforming growth factor-beta dynamically regulates vascular smooth muscle differentiation in vivo. J Cell Sci. 1998;111:2977–2988.[Abstract]
  35. Mano T, Luo Z, Malendowicz SL, Evans T, Walsh K. Reversal of GATA-6 downregulation promotes smooth muscle differentiation and inhibits intimal hyperplasia in balloon-injured rat carotid artery. Circ Res. 1999;84:647–654.[Abstract/Free Full Text]
  36. Kemp PR, Grainger DJ, Shanahan CM, Weissberg PL, Metcalfe JC. The Id gene is activated by serum but is not required for dedifferentiation in rat vascular smooth muscle cells. Biochem J. 1991;277:285–288.
  37. Ryseck RP, Macdonald Bravo H, Mattei MG, Bravo R. Structure, mapping, and expression of fisp-12, a growth factor-inducible gene encoding a secreted cysteine-rich protein. Cell Growth Differ. 1991;2:225–233.[Abstract]
  38. Kolesnikova TV, Lau LF. Cloning of human homolog of Cyr61 and characterization of its biological activities. Mol Biol Cell. 1996;7:2412. Abstract.
  39. Li L, Liu Z, Mercer B, Overbeek P, Olson EN. Evidence for serum response factor-mediated regulatory networks governing SM22{alpha} transcription in smooth, skeletal, and cardiac muscle cells. Dev Biol. 1997;187:311–321.[Medline] [Order article via Infotrieve]
  40. Kemp PR, Osbourn JK, Grainger DJ, Metcalfe JC. Cloning and analysis of the promoter region of the rat SM22-alpha gene. Biochem J. 1995;310:1037–1043.
  41. Blank RS, McQuinn TC, Yin KC, Thompson MM, Takeyasu K, Schwartz RJ, Owens GK. Elements of the smooth muscle {alpha}-actin promoter required in cis for transcriptional activation in smooth muscle. Evidence for cell type-specific regulation. J Biol Chem. 1992;267:984–989.[Abstract/Free Full Text]
  42. Kemp PR, Metcalfe JC. Four isoforms of serum response factor that activate or inhibit the SM22{alpha} promoter. Biochem J.. 2000;345:445–451.
  43. Martinerie C, Chevalier G, Rauscher FJ, Perbal B. Regulation of nov by WT1: a potential role for nov in nephrogenesis. Oncogene. 1996;12:1479–1492.[Medline] [Order article via Infotrieve]
  44. Grainger DJ, Hesketh TR, Metcalfe JC, Weissberg PL. A large accumulation of non-muscle myosin occurs at 1st entry into M-phase in rat vascular smooth muscle cells. Biochem J. 1991;277:145–151.
  45. Hollenberg SM, Sternglanz R, Cheng PF, Weintraub H. Identification of a new family of tissue-specific basic helix-loop-helix proteins with a 2-hybrid system. Mol Cell Biol. 1995;15:3813–3822.[Abstract]
  46. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159.[Medline] [Order article via Infotrieve]
  47. Pascall JC, Brown KD. Identification of a minimal promoter element of the mouse epidermal growth factor gene. Biochem J. 1997;324:869–875.
  48. Shanahan CM, Weissberg PL, Metcalfe JC. Isolation of gene markers of differentiated and proliferating vascular smooth muscle cells. Circ Res. 1993;73:193–204.[Abstract]
  49. Lacy-Hulbert A. EMFs and gene activation [dissertation]. Cambridge, UK: University of Cambridge; 1994.
  50. Groschel-Stewart U, Magel E, Paul E, Neidlinger AC. Pig brain homogenates contain smooth muscle myosin and cytoplasmic myosin isoforms. Cell Tissue Res. 1989;257:137–139.[Medline] [Order article via Infotrieve]
  51. Brown J, Chen Q, Hong G. An autocrine system for C-type natriuretic peptide within rat carotid neointima during arterial repair. Am J Physiol. 1997;272:H2919–H2931.[Abstract/Free Full Text]
  52. Trezise AE, Linder CC, Grieger D, Thompson EW, Meunier H, Griswold MD, Buchwald M. CFTR expression is regulated during both the cycle of the seminiferous epithelium and the oestrous cycle of rodents. Nat Genet. 1993;3:157–164.[Medline] [Order article via Infotrieve]
  53. Corps AN, Brown KD. In: McKay I, Leigh I, eds. Growth Factors: A Practical Approach. Oxford, UK: Oxford University Press; 1993.



This article has been cited by other articles:


Home page
 Cancer Res.Home page
V. Vallacchi, M. Daniotti, F. Ratti, D. Di Stasi, P. Deho, A. De Filippo, G. Tragni, A. Balsari, A. Carbone, L. Rivoltini, et al.
CCN3/Nephroblastoma Overexpressed Matricellular Protein Regulates Integrin Expression, Adhesion, and Dissemination in Melanoma
Cancer Res., February 1, 2008; 68(3): 715 - 723.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
L. McCallum, S. Price, N. Planque, B. Perbal, A. Pierce, A. D. Whetton, and A. E. Irvine
A novel mechanism for BCR-ABL action: stimulated secretion of CCN3 is involved in growth and differentiation regulation
Blood, September 1, 2006; 108(5): 1716 - 1723.
[Abstract] [Full Text] [PDF]

Home page
 Mol Hum ReprodHome page
A. Gellhaus, M. Schmidt, C. Dunk, S. J. Lye, R. Kimmig, and E. Winterhager
Decreased expression of the angiogenic regulators CYR61 (CCN1) and NOV (CCN3) in human placenta is associatedwith pre-eclampsia
Mol. Hum. Reprod., June 1, 2006; 12(6): 389 - 399.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. G. Lin, C.-C. Chen, S.-J. Leu, T. M. Grzeszkiewicz, and L. F. Lau
Integrin-dependent Functions of the Angiogenic Inducer NOV (CCN3): IMPLICATION IN WOUND HEALING
J. Biol. Chem., March 4, 2005; 280(9): 8229 - 8237.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
V. Lindner, Q. Wang, B. A. Conley, R. E. Friesel, and C. P.H. Vary
Vascular Injury Induces Expression of Periostin: Implications for Vascular Cell Differentiation and Migration
Arterioscler. Thromb. Vasc. Biol., January 1, 2005; 25(1): 77 - 83.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. T. Fu, J. F. Bechberger, M. A. Ozog, B. Perbal, and C. C. Naus
CCN3 (NOV) Interacts with Connexin43 in C6 Glioma Cells: POSSIBLE MECHANISM OF CONNEXIN-MEDIATED GROWTH SUPPRESSION
J. Biol. Chem., August 27, 2004; 279(35): 36943 - 36950.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. G. Lin, S.-J. Leu, N. Chen, C. M. Tebeau, S.-X. Lin, C.-Y. Yeung, and L. F. Lau
CCN3 (NOV) Is a Novel Angiogenic Regulator of the CCN Protein Family
J. Biol. Chem., June 20, 2003; 278(26): 24200 - 24208.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
C. Gooding, P. Kemp, and C. W. J. Smith
A Novel Polypyrimidine Tract-binding Protein Paralog Expressed in Smooth Muscle Cells
J. Biol. Chem., April 18, 2003; 278(17): 15201 - 15207.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
A. C. Lake, A. Bialik, K. Walsh, and J. J. Castellot Jr
CCN5 Is a Growth Arrest-Specific Gene That Regulates Smooth Muscle Cell Proliferation and Motility
Am. J. P