Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2000;20:1675-1681

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tabengwa, E. M.
Right arrow Articles by Booyse, F. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tabengwa, E. M.
Right arrow Articles by Booyse, F. M.
Related Collections
Right arrow Fibrinolysis
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2000;20:1675.)
© 2000 American Heart Association, Inc.


Thrombosis

Hypertriglyceridemic VLDL Downregulates Tissue Plasminogen Activator Gene Transcription Through cis-Repressive Region(s) in the Tissue Plasminogen Activator Promoter in Cultured Human Endothelial Cells

Edlue M. Tabengwa; Raymond L. Benza; Hernan E. Grenett; Francois M. Booyse

From the Division of Cardiovascular Disease, University of Alabama at Birmingham.

Correspondence to Edlue M. Tabengwa, PhD, 845 19th St South, BBRB 809 (UAB Station), Birmingham AL 35294-2170. E-mail etabengwa{at}cardio.dom.uab.edu


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—The relationship between tissue plasminogen activator (tPA) levels and the potential regulation by hypertriglyceridemic very low density lipoprotein (HTG-VLDL) was examined in a human umbilical vein endothelial cell (HUVEC) culture model system. HUVEC cultures were incubated in the absence/presence of HTG-VLDL or normal (NTG)-VLDL (0 to 50 µg/mL) at 37°C for various times (0 to 24 hours), followed by analyses of tPA antigen (ELISA), mRNA (reverse transcription–polymerase chain reaction), endothelial cell surface–localized plasmin generation assays, and nuclear transcription run-on assays. Secreted tPA antigen levels decreased {approx}53% (3.3±0.14 versus 6.97±0.42 µg/mL) and mRNA levels decreased {approx}70% in HTG-VLDL–treated HUVECs compared with NTG-VLDL–treated and culture medium control cells. Decreased tPA antigen and mRNA expression was associated with a concomitant {approx}98% decrease in tPA-mediated plasmin generation in HTG-VLDL–treated HUVEC cultures. Nuclear transcription run-on assays demonstrated that HTG-VLDL decreased tPA gene transcription {approx}73% (tPA mRNA/GAPDH mRNA) in cultured HUVECs. To identify and localize the repressive element(s) in the tPA promoter responsive to HTG-VLDL, a tPA promoter/luciferase construct (ptPA222/luc) was generated. HUVECs transiently transfected with this construct were incubated in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL). HTG-VLDL decreased promoter activity {approx}52% to 57% in the ptPA222/luc-transfected cells compared with NTG-VLDL–treated or buffer control cells. These results indicate that the 2.2-kb fragment of the promoter and 5' flanking region of the tPA gene contains the repressive sequences that direct the transcriptional downregulation of the tPA promoter. Data from these studies suggest that the repression of tPA gene expression by HTG-VLDL may contribute to the impaired fibrinolysis often associated with hypertriglyceridemia.


Key Words: tissue plasminogen activator • gene regulation • hypertriglyceridemic VLDL • fibrinolysis • tissue plasminogen activator promoter • cis-repressive elements


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Impaired fibrinolysis plays an important role in the early pathogenesis of atherosclerosis, coronary artery disease (CAD), and eventual myocardial infarction (MI).1 2 3 Fibrinolysis involves the endothelial cell (EC) surface–localized conversion of plasminogen (Pmg) by receptor-bound Pmg activators (PAs), tissue-type PA (tPA) and urokinase-type PA (uPA), to the serine protease, plasmin. Plasmin, in turn, degrades fibrin, which is associated with clot formation. ECs synthesize tPA and uPA as well as the major physiological regulator and inhibitor of PA-mediated fibrinolytic activity, Pmg activator inhibitor type (PAI)-1.4 5 Therefore, it is conceivable that perturbation of the expression or activity of >=1 of these fibrinolytic proteins may alter the hemostatic balance on the EC surface, thus promoting early initiation of fibrin deposition, atherogenesis, CAD, and eventual MI.1 Several atherogenic lipoproteins may cause such a perturbation; eg, Lp(a),6 oxidized LDL,7 8 and acetylated LDL9 increase PAI-1 levels and decrease tPA expression in cultured human ECs.8 10 In addition, abnormal triglyceride-rich lipoproteins, including VLDL (hypertriglyceridemic VLDL [HTG-VLDL]), have been shown to increase PAI levels11 12 and decrease surface localized plasmin generation.13 Conversely, normotriglyceridemic VLDL (NTG-VLDL) has been shown to be less potent in creating a prothrombotic state.11 14 The differences in these molecules may be due to differences in composition, conformation, and receptor binding properties; eg, HTG-VLDL, but not NTG-VLDL, binds to ß-VLDL and LDL receptors, which are also found in ECs.15 Furthermore, HTG-VLDL has a more variable and higher lipid load than does NTG-VLDL.15

Altered tPA antigen concentrations may be of important consequence in preclinical atherosclerosis and may be a marker for risk of future MI.16 17 18 Basal tPA antigen levels are increased in plasma from young post-MI patients compared with control subjects, whereas postocclusion tPA concentrations are decreased, a finding that has been confirmed in most cross-sectional studies of CAD patients.1

The exact molecular regulatory mechanisms underlying the repression of tPA by atherogenic lipoproteins have not been elucidated. Other studies have demonstrated that tPA is transcriptionally regulated by a variety of agents, including thrombin,19 cAMP,20 ethanol,21 and transforming growth factor.22 The present study demonstrates that HTG-VLDL decreases tPA antigen and mRNA levels in cultured HUVECs, that this downregulation also occurs at the level of gene transcription, and that a specific region of the tPA promoter is responsive to repression by HTG-VLDL. In addition, the transcriptional repression of tPA gene expression by HTG-VLDL observed in the present study is associated with a decreased net expression of surface-localized EC fibrinolytic activity and, hence, may contribute, in part, to the substantial thrombotic risk associated with hypertriglyceridemia.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Materials
Human Glu-Pmg was obtained from Enzyme Research Products, Inc; collagenase (type I, CLS), from Boehringer-Mannheim Biochemicals; FBS, from Intergen Corp; heparin (porcine intestinal mucosa), human fibronectin, and BSA, from Sigma Chemical Co; [{alpha}-32P]dCTP, [{alpha}-32P]dUTP (3000 Ci/mmol), and sodium 125I (specific activity 14.0 mCi/g), from Amersham Corp; Iodo-Beads, from Pierce Chemical Co; Sephadex G-25 column (PD-10), from Pharmacia; aprotinin (Trasylol), from Mobay Corp; 1,1'-dioctadecyl-1-3,3,3',3'-tetramethylindocarbocyanine perchlorate (DiI)-labeled acetylated LDL (DiI-Ac-LDL), from Biomedical Technologies, Inc; medium 199 (M199), TRIzol reagent, and M-MLV reverse transcriptase, from GIBCO-BRL; tPA ELISA kits (TintElize), from BioPool; BglII, KpnI, AccI, BamHI, DraI, SacI, and SmaI, from Boehringer-Mannheim; calf intestinal phosphatase, T4 DNA ligase, Klenow fragment, Gene Light vector pGL3-basic expression, Dual-Luciferase Reporter Assay System, pRL-TK, and agarose, from Promega Inc; [{alpha}-32P]dCTP (300 Ci/mmol), from Amersham; and Taq DNA polymerase and oligo(dT) primers, from Promega, Inc. Specific primer pairs for tPA and GAPDH (constitutive control) used for polymerase chain reactions (PCRs) were obtained from DNA International, Inc. Lipofectamine, Opti-MEM-1 reduced serum medium, and M199 were from GIBCO-BRL. Frozen bovine hypothalami, from which endothelial cell growth factor was isolated,23 were obtained from Pel-Freeze Inc.

Isolation and Characterization of Lipoproteins
Purified VLDL was obtained freshly isolated from Drs William A. Bradley and Sandra H. Gianturco, University of Alabama at Birmingham (UAB), and was isolated and characterized as described in detail previously.24 Briefly, plasma was obtained from fasting subjects with normal lipid values for isolation of NTG-VLDL or from fasting patients with types 4 and 5 lipoprotein profiles for HTG-VLDL. The diagnoses were based on commonly used criteria.25 NTG-VLDL and HTG-VLDL were subfractionated through a discontinuous NaCl gradient from a density of 1.063 to 1.006 g/mL by the cumulative flotation methods of Lindgren et al,26 as previously detailed.24 The VLDLs used had Svedberg flotation rates of 100 to 400. The defined flotation cut precludes comparison of lipid-rich with lipid-poor particles, ie, large versus small particles that could occur in comparing NTG-VLDL and HTG-VLDL. HTG-VLDL, but not NTG-VLDL, has been shown to bind with high affinity to bovine adrenal LDL receptors15 and to the monocyte-macrophage receptor for triglyceride-rich lipoproteins.27 Binding to the LDL receptor was correlated with the presence of accessible apoE, as found in HTG-VLDL but not in NTG-VLDL.24 Total protein contents of the lipoproteins were obtained by a modified method of Lowry et al,28 and triglyceride contents were obtained by using a kit from Boehringer-Mannheim.27 All lipoproteins were also routinely analyzed by Western blotting to identify their apoprotein contents.

Cell Culture
Human umbilical vein ECs (HUVECs) were obtained from fresh (discarded) umbilical cords by mild collagenase treatment,4 5 seeded into human fibronectin–coated plastic T-25 or 960-mm2 Petri dishes, and grown to confluence in complete culture medium as we have previously described.29 30 Cultures were refed every 48 hours with complete culture medium and maintained in a 95% air/5% CO2–humidified atmosphere. All experiments were carried out with pooled (4 to 6 umbilical veins), confluent, serially subcultured HUVECs (passages 1 to 4). Cells were routinely counted by use of phase-contrast microscopy and a 0.5-mmx0.5-mm counting reticle.

Cell cultures were routinely characterized as HUVECs, and their purity was established by their uniform uptake of the EC-specific fluorescent probe DiI-Ac-LDL31 and their typical monolayer "cobblestone" tight-packing growth morphology.31 32 Only individual cultures with >95% identifiable ECs were used in these experiments.

tPA antigen/mRNA analyses were carried out with postconfluent HUVEC cultures grown in 24-well multiwell plates (200 mm2 per well). Cultures were incubated (0 to 24 hours) in serum-free culture medium (500 mL per well, the same as for complete culture medium, except FBS is replaced with 0.25% BSA) in the absence/presence of HTG-VLDL or NTG-VLDL (0 to 50 µg/mL), and each culture (in triplicate) was then analyzed for its secreted tPA antigen and coincident mRNA levels, as described below.

Nuclear transcription run-on assays were carried with postconfluent cultures grown in T-75 (7500-mm2) flasks. Cultures were incubated in serum-free culture medium in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL) for 8 hours before the isolation of nuclei, as described below.

tPA Antigen Analysis (ELISA)
Measurements of total secreted tPA antigen levels (free plus complex forms) were performed (in duplicate) in serum-free conditioned culture media by use of a commercial tPA (TintElize, BioPool) kit. Determination of antigen concentration was made with a Dynatech plate reader, appropriate standards, and BioLinx software (Dynatech) to measure absorption at 405 nm. Total secreted tPA levels were calculated in nanograms per milliliter per well ({approx}1.8x105 cells per well) per 24 hours.

RNA Isolation
Total cytoplasmic RNA was isolated from the confluent monolayer of each HUVEC culture (in duplicate) that had been incubated for varying times (0, 2, 4, and 8 hours) in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL). Cell monolayers were washed twice in Dulbecco’s PBS, and total RNA was extracted by a single-step method, with the use of TRIzol reagent, according to the manufacturer’s instructions.

Measurement of tPA mRNA Level by Reverse Transcription–PCR
Total RNA (1 µg) in a 20 µL reaction mixture was reverse-transcribed with M-MLV reverse transcriptase (200 U) for 10 minutes at room temperature, followed by 1 hour at 42°C, with oligo(dT) used as a primer. The resulting cDNA (5 µL) was used as a template, and a 234-bp segment of the tPA cDNA was amplified by use of a 24-mer upstream primer (5'-GTCTGCTGTGCACCATCCCCCATC-3') identical to positions 177 to 200 and a 24-mer downstream primer (5'-TTGTCATCAATCTTGAATCCCATA-3') complementary to positions 400 to 377 of the human tPA mRNA.33 A 600-bp segment of an internal standard, GAPDH cDNA, was simultaneously amplified by use of a 24-mer upstream primer (5' CCACCCATGGCAAATTCCATGGCA 3') identical to positions 212 to 235 and a 24-mer downstream primer (5' TCTAGACGGCAGGTCAGGTCCACC 3') complementary to positions 809 to 786 of the human GAPDH mRNA.34 Amplification was carried out in a Techne Thermal Cycler PHC-3 for 28 cycles (1 cycle consisted of 94°C for 45 seconds, 60°C for 45 seconds, and 72°C for 45 seconds). PCR products were analyzed on a 1.2% agarose–ethidium bromide gel. The gels were photographed, and the intensity of each tPA and GAPDH mRNA band was measured by laser densitometric scanning with a Molecular Dynamics Personal Densitometer and expressed as a relative ratio of the GAPDH mRNA band intensity in each lane.

Fibrinolytic (Plasmin) Activity Assay
Surface-localized fibrinolytic activity was measured, with the use of live confluent cultured HUVECs (passages 1 and 2), by the direct conversion of EC-bound single-chain 125I-labeled Glu-Pmg by receptor-bound tPA to 2-chain 125I-labeled plasmin and quantification of either 125I-labeled plasmin Mr 20-kDa light chain or Mr 60-kDa heavy chain formation, after SDS-PAGE under reduced conditions, according to the method of Mussoni et al,35 as modified in our laboratory.4 13 Because early-passage (passages 1 and 2) HUVECs do not synthesize urokinase, the results of this particular assay are largely attributed to the effects of tPA.36 Postconfluent cultured HUVECs in 96-well plates (in triplicate) were incubated at 37°C for 8 hours in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL) in serum-free culture medium, followed by removal of lipoproteins and further incubation in complete culture medium for an additional 16 hours. The cultures were then washed (3 times) with 10 mmol/L HEPES and 0.1 mol/L sodium acetate, pH 7.4, containing 1% BSA (buffer A) and equilibrated with buffer A (50 µL per well) at 4°C for 20 minutes. 125I-labeled Glu-Pmg (2 µmol/L) in buffer A containing 1000 kallikrein inhibiting units per milliliter aprotinin (40 µL) was added to each well and incubated at 4°C for 30 minutes. Culture plates were then placed in a 37°C water bath to initiate tPA-mediated conversion of HUVEC-bound 125I-labeled Glu-Pmg to 125I-labeled plasmin. After 10 minutes of incubation, the reactions were stopped by the rapid addition of 40 µL of hot (56°C) solubilizing buffer (4% SDS, 10% glycerol, and 0.2 mol/L Tris-HCl, pH 6.8). The total contents of each well were analyzed by 0.1% SDS-PAGE under reducing conditions as previously described.13 The amounts of 125I-labeled Mr 20-kDa light chain or Mr 60-kDa heavy chain of plasmin generated were quantified by measuring the radioactivity content in each band with the use of phosphorimaging autoradiography (Molecular Dynamics Series 425F PhosphorImager) in combination with ImageQuant software (Molecular Dynamics), as described below.

SDS-PAGE and Quantitative Phosphorimaging Autoradiography
Reduced samples containing 125I-labeled Glu-Pmg and 125I-labeled plasmin were analyzed by SDS-PAGE with use of a 1.8x82x74-mm polyacrylamide slab gel consisting of an upper 4% stacking gel and a lower 5% to 12.5% gradient running gel, according to the method of Laemmli.37 After electrophoresis, gels were dried and exposed in phosphorimaging cassettes for 3 to 5 hours. The amount of remaining 125I-labeled Glu-Pmg and newly generated 125I-labeled Mr 20-kDa plasmin light chain in each individual gel was quantified by measuring the radioactivity content in each band by phosphorimaging autoradiography with the Molecular Dynamics Series 425F PhosphorImager in combination with ImageQuant software. The radioactivity content in each band was then converted to a plasmin concentration by comparing the radioactivity content of each individual band with the radioactivity content of the 125I-labeled Mr 20-kDa plasmin light chain derived from a known amount of fully converted 125I-labeled Glu-Pmg. A 125I-labeled plasmin standard was obtained by complete activation of 125I-labeled Glu-Pmg (1.0 µg) in buffer A containing 1000 kallikrein inhibiting units per milliliter aprotinin (minus BSA) by incubation with 2-chain uPA (2 IU/mL) for 1 hour at 37°C.13

Nuclear Transcription Run-On Assays
Nuclear run-on assays were carried out essentially as described by Greenberg and Ziff.38 Briefly, postconfluent cultures in T-75 tissue culture flasks (in duplicate) were incubated in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL) for 8 hours at 37°C, followed by a wash with Dulbecco’s PBS. Cells were scraped from the culture flasks and resuspended in NP-40 lysis buffer (0.001 mol/L EDTA, 0.0001 mol/L phenylmethylsulfonyl fluoride, 0.01 mol/L NaCl, 0.003 mol/L MgCl2, 10-6 mol/L antipain, 0.01 mol/L Tris-HCl, pH 7.4, and 0.5% [vol/vol] NP-40) and incubated on ice for 5 minutes. Intact nuclei were pelleted by centrifugation (1660g for 5 minutes at 4°C), washed once in NP-40 lysis buffer, and resuspended in glycerol storage buffer (0.01 mol/L Tris-HCl, pH 8.3, 0.0001 mol/L EDTA, 0.001 mol/L dithiothreitol, and 40% glycerol) at 6x106 nuclei per 100 µL and snap-frozen in liquid nitrogen. Transcription reactions were carried out by mixing the nuclei (100 µL) with an equal volume (100 µL) of 2x reaction buffer (0.03 mol/L Tris-HCl, pH 8, 0.0005 mol/L MgCl2, 0.3 mol/L KCl, 25 U/mL placental RNase, 0.01 mol/L creatine phosphate, 20 U/mL creatine phosphokinase, 0.001 mol/L each ATP, CTP and GTP, 0.0001 mol/L phenylmethylsulfonyl fluoride, and 0.0005 mol/L dithiothreitol) containing 100 µCi of [{alpha}-32P]UTP. After a 45-minute incubation at 28°C ,the reactions were terminated by adding a solution of 0.01 mol/L Tris-HCl, pH 7.5, containing 7 mol/L urea, 2% sarkosyl, and 0.35 mol/L NaCl. DNA was sheared by passage through a syringe needle (21 and 25 gauge), and the 32P-labeled nuclear RNA was isolated on a 5.7 mol/L CsCl gradient by ultracentrifugation at 100 000g for 18 hours at 20°C and then hybridized with cDNAs for tPA and GAPDH (constitutive control) immobilized on nitrocellulose filters. Preparation of nitrocellulose filters containing the cDNAs, hybridization, and washing of filters were carried out as previously described.38 The radioactivity corresponding to each individual filter was quantified by phosphorimaging autoradiography with the Molecular Dynamics Series 425F PhosphorImager in combination with ImageQuant software (Molecular Dynamics).

Amplification 5' Promoter and Flanking Regions ({approx}2220-bp Fragments) of the tPA Gene
A 2220-bp segment of the promoter and 5' flanking region of the tPA gene containing the start site of transcription at +1 and the TATA box at -24 to -29 were amplified by PCR as previously described.39 The PCR was carried out with use of an upstream primer (5' CGATCGGTACCCCATTGTCACCTTATCAGCCTGCCC 3') identical to positions 1473 to 1497 and downstream primer (5' GATCAGATCTTCCTCGCAGAGGTTTCTCTCCAGC 3') complementary to positions 3692 to 3668 of the human tPA gene.33 Both these primers had a CGATC clamp and a KpnI site in the upstream primer (underlined) and a BglII site in the downstream primer (underlined) to aid in the subsequent cloning into the luciferase reporter gene (luc, pGL3-basic expression vector, Promega Corp). Detailed sequencing analyses were carried out with duplicate PCR clones from single PCR amplification of 8 individual (16 sequences) promoter fragments to rule out errors due to PCR cloning or sequencing, as described previously.39 Sequencing was carried out on both strands by the UAB Automated DNA Sequencing Core Facility.

Construction of the tPA Promoter/Luc Construct
The amplified tPA promoter fragments (2.2 kb) were purified by electrophoresis on 1% agarose, digested with KpnI and BglII, and ligated into the KpnI/BglII site of the luciferase reporter gene (GeneLight vector, pGL3-basic expression vector). The ligation mixture was transformed into JM 109 competent cells to generate ptPA222/luc constructs. tPA/luc constructs were purified by ultracentrifugation through a cesium chloride/ethidium bromide gradient before transfection.40 The tPA fragment in the plasmid construct was sequenced on both strands by the UAB Automated DNA Sequencing Core Facility for sequence verification. Sequences were aligned and compared with published human tPA sequences33 by using the Genetics Computer Group sequence analysis software provided by the UAB Biological Computing Resource Core Facility.

Transient Transfection of Cultured HUVECs With ptPA/luc and Promoter and Measurement of Luciferase Activity
Transient transfection experiments were carried out with semiconfluent (60% to 75%) subcultured HUVECs grown in 6-well multiwell plates by use of lipofectamine, as we have previously described with minor modifications.21 39 Briefly, DNA-lipofectamine complexes were preformed for 45 minutes at room temperature by use of 1 µg per well of DNA, 0.05 µg per well internal control vector, a thymidine kinase promoter–driven Renilla luciferase construct (pRL-TK), and 10 µg per well lipofectamine in Opti-MEM-1 reduced serum medium, according to the manufacturer’s instructions. Cultured HUVECs were transfected (in triplicate) with the ptPA/luc constructs and cotransfected with pRL-TK (internal control).41 42 Transfection mixtures were incubated in Opti-MEM-1 reduced serum medium for 1 hour at 37°C. At the end of the incubation, the medium was removed, and cultures were rinsed twice with M199 and then incubated in fresh M199 containing 0.25% BSA for 18 hours in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL). Finally, cultures were rinsed twice with Dulbecco’s PBS, lysed by the addition of 200 µL lysis buffer (Dual-Luciferase kit, Promega), and centrifuged at 16 000g for 1 minute, and the cell supernatants were assayed for their dual luciferase activity (firefly and Renilla) by use of the Dual-Luciferase Reporter Assay System according to manufacturer’s instructions. Activities were measured, and final luciferase activities were normalized to the corresponding Renilla activities to correct for transfection efficiency.

Analysis of Data
All of the data were expressed as the mean±SD of triplicate experiments performed in each assay and analyzed by the Student t test. Data with P<0.05 were taken to represent statistically significant differences in experimental results.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Effect of tPA Antigen and mRNA Expression by HTG-VLDL Cultured HUVECs
Confluent cultured HUVECs were analyzed for their expression of tPA antigen and coincident mRNA levels in the absence/presence of HTG-VLDL or NTG-VLDL (control) at 0 to 50 µg/mL. tPA antigen levels showed a significant decrease in HTG-VLDL–treated HUVEC cultures compared with the NTG-VLDL–treated and culture medium control cells. After incubation for 24 hours in the absence/presence of these lipoproteins, secreted tPA antigens levels were decreased up to {approx}53% in HTG-VLDL–treated HUVEC cultures compared with NTG-VLDL–treated and culture medium control cells (Figure 1Down). Interestingly, the relative changes in tPA antigen between different doses of HTG-VLDL were small, suggesting an all-or-none response at these levels of lipoprotein.



View larger version (16K):
[in this window]
[in a new window]
 
Figure 1. Effects of HTG-VLDL on tPA secretion in cultured HUVECs (0 to 50 µg/mL). N-VLDL indicates NTG-VLDL. Values represent mean±SD of 16 experiments, each carried out in duplicate.

Simultaneous reverse transcription–PCR analysis of these HUVEC cultures for their coincident expression of relative tPA mRNA levels (tPA mRNA/GAPDH mRNA ratios) also indicated a decline in steady-state levels of tPA after HTG-VLDL treatment. After incubation for 8 hours in the presence of HTG-VLDL (20 µg/mL), tPA mRNA levels decreased by 70% compared with baseline levels (Figure 2Down). In addition, after incubation for 8 hours, tPA mRNA levels decreased in the presence of HTG-VLDL (20 µg/mL) compared with NTG-VLDL or control medium (data not shown). These studies were carried out in 16 separate experiments in which 3 or 4 different individual HUVEC cultures were pooled, examined, and compared; similar results were obtained, providing strong evidence that HTG-VLDL downregulates tPA expression.



View larger version (31K):
[in this window]
[in a new window]
 
Figure 2. Time-dependent effect of HTG-VLDL on relative tPA mRNA levels in cultured HUVECs. Values were expressed as the ratios to controls incubated in the absence of lipoproteins and represent mean±SD of 16 experiments, each carried out in duplicate.

Effect of HTG-VLDL on Fibrinolytic Activity in Cultured HUVECs
tPA contributes to cell surface–localized fibrinolytic activity by its ability to convert receptor-bound Pmg to plasmin. These experiments were carried out to establish whether the decrease in tPA levels induced by HTG-VLDL may additionally exert an inhibitory effect on the net expression of cultured HUVEC surface–localized fibrinolytic activity. Confluent cultured HUVECs preincubated in the presence of HTG-VLDL (20 µg/mL), followed by incubation with 125I-labeled Glu-Pmg, showed a significant decrease ({approx}98%) in net expressed fibrinolytic activity (2±2 pmol per well) compared with activity in NTG-VLDL–treated or culture medium control cells ({approx}120±20 pmol per well), as seen in Figure 3Down. As stated earlier, because early-passage HUVECs do not synthesize urokinase, the results of this particular assay are attributed largely to the effects of tPA.36 These studies on the effects of HTG-VLDL on fibrinolytic activity were repeated in 16 separate experiments that used different pools of cultured HUVECs (in triplicate) with similar results.



View larger version (15K):
[in this window]
[in a new window]
 
Figure 3. Effect of HTG-VLDL on surface-localized plasmin generation in cultured HUVECs. Values were expressed as the percentage of controls, incubated in the absence of lipoproteins, and represent mean±SD of 16 experiments, each carried out in triplicate.

Effect of HTG-VLDL on tPA Gene Transcription Rates
Nuclear transcription run-on assays were carried out to establish whether the observed decrease in tPA mRNA in response to HTG-VLDL was due to an decrease in the rate of tPA transcription. Nuclei were isolated from postconfluent cultured HUVECs (in 7500-mm2 flasks) and incubated in the absence/presence of HTG-VLDL for 8 hours at 37°C. Newly synthesized 32P-labeled nuclear transcripts were hybridized to tPA and GAPDH cDNAs immobilized on nylon membranes, and the nuclear run-on assay results were measured by phosphorimaging autoradiography. These results indicated transcriptional repression of the tPA gene by HTG-VLDL, as evidenced by a significant decrease ({approx}72%) in new 32P-labeled tPA mRNA (tPA mRNA/GAPDH mRNA ratio) in the cultured HUVECs treated with HTG-VLDL compared with NTG-VLDL–treated controls (Figure 4Down). These assays were carried out in 6 separate experiments with at least 3 pooled different individual HUVEC cultures; similar results were obtained.



View larger version (23K):
[in this window]
[in a new window]
 
Figure 4. Effect of HTG-VLDL on the transcription rates of the tPA gene. Results are shown for a typical nuclear transcription run-on assay and are expressed as relative tPA mRNA/GAPDH mRNA ratios. Values represent mean±SD of 6 separate experiments, each conducted in duplicate.

Generation of ptPA/luc Promoter Construct and Transient Transfection of Cultured HUVECs With the ptPA/luc Promoter Construct
Because the present study demonstrated that HTG-VLDL but not NTG-VLDL decreased tPA levels in cultured HUVECs and that this repression occurred at the transcriptional level, we sought to further confirm and localize this repression of tPA expression by HTG-VLDL; a 2220-bp segment of the tPA promoter and 5' flanking region, containing the start +1 site as well as the TATA box, was PCR-amplified (Figure 5Down). This was followed by ligation into a promoterless/enhancerless luciferase to generate the promoter/luciferase construct (ptPA222luc) to be used in transient transfection studies.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 5. Schematic representation of the PCR-amplified tPA promoter fragment demonstrating the 2220-bp segment of the promoter and 5'-flanking region of the tPA gene containing the start site of transcription at +1 and the TATA box.

HUVEC cultures were transiently transfected with the ptPA222/luc construct. The cells were concomitantly transfected with Renilla to correct for differences in DNA uptake. The transfected cells were subsequently incubated in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL) for 18 hours, then harvested, and assayed for luciferase and Renilla activity. Compared with NTG-VLDL or control medium, HTG-VLDL decreased promoter activity (luciferase activity) {approx}52% to 57% in the ptPA222/luc construct (Figure 6Down). In addition, no luciferase activity was generated in the reverse orientation undeleted construct (negative control).



View larger version (19K):
[in this window]
[in a new window]
 
Figure 6. Repression of tPA promoter (luciferase) activity by HTG-VLDL in cultured HUVECs transiently transfected with the tPA promoter/luc construct. HTG-VLDL treatment caused an {approx}52% to 57% (2.5±0.7 versus 7.58±0.92) decrease in luciferase activity compared with treatment with NTG-VLDL or control medium.

Therefore, these results demonstrate that the 2.2-kb fragment of the promoter and 5' flanking region of the tPA gene contains the repressive sequences that direct the transcriptional downregulation of the tPA promoter.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The purpose of the present study was to examine the interrelationship between tPA expression and HTG-VLDL in a cultured HUVEC model system. We have demonstrated that HTG-VLDL, but not NTG-VLDL, decreases tPA antigen and mRNA expression and suppresses tPA-mediated fibrinolytic activity. In addition, nuclear transcription run-on assays in these studies demonstrate that HTG-VLDL downregulates tPA expression at the level of gene transcription. These findings complement previous in vitro and clinical observations. For example, it is known that other atherogenic lipoproteins decrease tPA secretion and tPA-mediated Pmg activation in cultured ECs8 10 43 and that compared with control subjects, patients with CAD and elevated Lp(a) levels have a marked reduction in their ability to release tPA in response to venous occlusion.1 Whether this type of regulation also occurs with HTG-VLDL would be of additional clinical importance given the association between HTG and atherosclerosis.

HTG-VLDL is known to transcriptionally regulate other fibrinolytic proteins. For example, prior studies in our laboratory have demonstrated that HTG-VLDL transcriptionally upregulates PAI-1 expression in a genotype-specific manner.29 In addition, Eriksson et al44 recently identified a VLDL response element in the PAI-1 promoter, which is located between -672 bp and -657 bp in the promoter region. However, to our knowledge, no description of regulatory elements in the tPA gene responsive to HTG-VLDL exists. In the present study, we add to the prior body of knowledge by reporting for the first time the transcriptional repression of tPA gene expression by HTG-VLDL. Our transient transfection studies with the ptPA222/luc construct indicate that the cis-repressive element(s), which specifically directs the transcriptional downregulation of the tPA gene by HTG-VLDL, is located within the PCR-amplified 2.2-kb region of the tPA promoter used in these studies.

Repression of gene expression may occur by transcriptional interference. This results when a transcription factor is blocked from successfully interacting with the transcription initiation complex through direct or indirect interactions with another factor. Transcriptional interference of the general transcription factor(s) has been observed for other fibrinolytic protein genes, including the urokinase gene.45 46 Whether this type of interference contributes to the observed repression of the tPA gene by HTG-VLDL is not known.

Additional studies to identify the specific site(s) of the HTG-VLDL repressive element(s) within the tPA promoter and HTG-VLDL inducible transcription/repressive factor(s) that binds to this region are in progress.


*    Acknowledgments
 
This work was supported in part by National Institutes of Health grant HL-52791. We would like to thank the labor and delivery staff at AMI Brookwood Medical Center and University Hospital in Birmingham, Ala, for providing the umbilical cords used for the isolation of HUVECs used in these studies.

Received June 18, 1999; accepted February 21, 2000.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Hamsten A, Wiman B, de Faire V, Blomback M. Increased plasma levels of a rapid inhibitor of tissue plasminogen activator in young survivors of myocardial infarction. N Engl J Med. 1985;313:1557–1563.[Abstract]

2. Wiman B, Hamsten A. The fibrinolytic enzyme system and its role in the etiology of thromboembolic disease. Semin Thromb Hemost. 1990;16:207–216.[Medline] [Order article via Infotrieve]

3. Raghunath PN, Tomaszewski JE, Brady ST, Caron RJ, Okada SS, Barnathan ES. Plasminogen activator system in human coronary atherosclerosis. Arterioscler Thromb Vasc Biol. 1995;15:1432–1443.[Abstract/Free Full Text]

4. Li XN, Varma VK, Parks JM, Benza RL, Koons JC, Grammer JR, Grenett HE, Tabengwa EM, Booyse FM. Thrombin decreases the urokinase receptor and surface-localized fibrinolysis in cultured endothelial cells. Arterioscler Thromb Vasc Biol. 1995;15:410–419.[Abstract/Free Full Text]

5. Haddock RC, Baker CD, Grammer JR, Parks JM, Speidel MT, Spell ML, Booyse FM. Urokinase binding and receptor identification in cultured endothelial cells. J Biol Chem. 1991;266:21466–21473.[Abstract/Free Full Text]

6. Williams JK, Bellinger DA, Nichols TC, Griggs TR, Bumol TF, Fouts RL, Clarkson TB. Occlusive arterial thrombosis in cynomolgus monkeys with varying plasma concentrations of lipoprotein(a). Arterioscler Thromb. 1993;13:548–554.[Abstract/Free Full Text]

7. Latron Y, Chautan M, Anfosso F, Alessi MC, Nalbone G, Lafont H, Juhan-Vague I. Stimulating effect of oxidized low density lipoproteins on plasminogen activator inhibitor-1 synthesis by endothelial cells. Arterioscler Thromb. 1991;11:1821–1829.[Abstract/Free Full Text]

8. Kugiyama K, Sakamoto T, Misumi I, Sugiyama S, Ohgushi M, Ogawa H, Horiguchi M, Yasue H. Transferable lipids in oxidized low-density lipoprotein stimulate plasminogen activator inhibitor-1 and inhibit tissue-type plasminogen activator release from endothelial cells. Circ Res. 1993;73:335–343.[Abstract/Free Full Text]

9. Tremoli E, Camera M, Maderna P, Sironi L, Prati L, Colli S, Piovella F, Bernini F, Corsini A, Mussoni L. Increased synthesis of plasminogen activator inhibitor-1 by cultured human endothelial cells exposed to native and modified LDLs: an LDL receptor–independent phenomenon. Arterioscler Thromb. 1993;13:338–346.[Abstract/Free Full Text]

10. Levin EG, Miles LA, Fless GM, Scanu AM, Baynham P, Curtiss LK, Plow EF. Lipoproteins inhibit the secretion of tissue plasminogen activator from human endothelial cells. Arterioscler Thromb. 1994;14:438–442.[Abstract/Free Full Text]

11. Stiko-Rahm A, Wiman B, Hamsten A, Nilsson J. Secretion of plasminogen activator inhibitor-1 from cultured human umbilical vein endothelial cells is induced by very low density lipoproteins. Arteriosclerosis. 1990;10:1067–1073.[Abstract/Free Full Text]

12. Mussoni L, Mannucci L, Sirtori M, Camera M, Maderna P, Sironi L, Tremoli E. Hypertriglyceridemia and regulation of fibrinolytic activity. Arterioscler Thromb. 1992;12:19–27.[Abstract/Free Full Text]

13. Li XN, Koons JC, Benza RL, Parks JM, Varma VK, Bradley WA, Gianturco SH, Taylor KB, Grammer JR, Tabengwa EM, Booyse FM. Hypertriglyceridemic VLDL decreases plasminogen binding to endothelial cells and surface-localized fibrinolysis. Biochemistry. 1996;35:6080–6088.[Medline] [Order article via Infotrieve]

14. Li XN, Grenett HE, Benza RL, Bradley WA, Gianturco SH, Grammer JR, Tabengwa EM, Gay CP, Booyse FM. Genotype-specific regulation of PAI-1 expression by hypertriglyceridemic VLDL in PAI-1 genotyped cultured human endothelial cell types. Circulation. 1995;92(suppl I):I-694. Abstract.

15. Gianturco SH, Gotto AM, Hwang SC, Karlin JB, Lin A. Apolipoprotein E mediates uptake of Sf 100–400 hypertriglyceridemic very low density lipoproteins by the low density lipoprotein receptor pathway in normal human fibroblasts. J Biol Chem. 1983;258:4526–4533.[Free Full Text]

16. Juhan-Vague I, Alessi MC. Plasminogen activator inhibitor 1 and atherothrombosis. Thromb Haemost. 1993;70:138–143.[Medline] [Order article via Infotrieve]

17. Padro T, Emeis JJ, Steins M, Schmid KW, Kienast J. Quantification of plasminogen activators and their inhibitors in the aortic vessel wall in relation to the presence and severity of atherosclerotic disease. Arterioscler Thromb Vasc Biol. 1995;15:893–902.[Abstract/Free Full Text]

18. Reilly JM, Sicard GA, Lucore CL. Abnormal expression of plasminogen activators in aortic aneurysmal and occlusive disease. J Vasc Surg. 1994;19:865–872.[Medline] [Order article via Infotrieve]

19. Hayakawa Y, Tazawa S, Ishikawa T, Niiya K, Sakuragawa N. Transcriptional regulation of tissue- and urokinase-type plasminogen activator genes by thrombin in human fetal lung fibroblasts. Thromb Haemost. 1995;74:704–710.[Medline] [Order article via Infotrieve]

20. Medcalf RL, Ruegg M, Schleuning WD. A DNA motif related to the cAMP-responsive element and an exon-located activator protein-2 binding site in the human tissue-type plasminogen activator gene promoter cooperate in basal expression and convey activation by phorbol ester and cAMP. J Biol Chem. 1990;265:14618–14626.[Abstract/Free Full Text]

21. Grenett HE, Torres JA, Demissie S, Tabengwa EM, Davis GC, Booyse FM. Ethanol transcriptionally upregulates t-PA and u-PA gene expression in cultured human endothelial cells. Alcohol Clin Exp Res. 1998;22:849–853.[Medline] [Order article via Infotrieve]

22. Medcalf RL, Schleuning WD. Regulation of human tissue-type plasminogen activator gene transcription by epidermal growth factor and 3',5'-cyclic adenosine monophosphate. Mol Endocrinol. 1991;5:1773–1779.[Abstract/Free Full Text]

23. Maciag T, Cerundolo J, Ilsley S, Kelley PR, Forand R. An endothelial cell growth factor from bovine hypothalamus: identification and partial characterization. Proc Natl Acad Sci U S A. 1979;76:5674–5678.[Abstract/Free Full Text]

24. Gianturco SH, Bradley WA. The role of apolipoprotein processing in receptor recognition of VLDL. In: Albers JJ, Segrest JP, eds. Methods in Enzymology. New York, NY: Academic Press; 1986:319–344.

25. Fredrickson DS, Goldstein JL, Brown MS. The familial hyperlipoproteinemias. In: Stanbury JG, Wyngaarden MF., Fredrickson DS, eds. The Metabolic Basis of Inherited Diseases. New York, NY: McGraw-Hill; 1978:604–655.

26. Lindgren FT, Jensen LC, Hatch FT. The isolation and quantitative analysis of serum lipoproteins in blood lipids and lipoproteins. In: Nelson GJ, ed. Blood Lipids and Lipoproteins. New York, NY: Wiley Interscience; 1972:181–274.

27. Gianturco SH, Ramprasad MP, Lin A, Song R, Bradley WA. Cellular binding site and membrane binding proteins for triglyceride-rich lipoproteins in human monocyte-macrophages and THP-1 monocytic cells. J Lipid Res. 1994;35:1674–1687.[Abstract]

28. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265–275.[Free Full Text]

29. Li XN, Grenett HE, Benza RL, Demissie S, Brown SL, Tabengwa EM, Bradley WA, Gianturco SH, Fless GM, Booyse FM. Genotype-specific transcriptional regulation of PAI-1 expression by hypertriglyceridemic (HTG)-VLDL and Lp(a) in cultured human endothelial cells. Arterioscler Thromb Vasc Biol. 1997;17:3215–3223.[Abstract/Free Full Text]

30. Booyse FM, Quarfoot AJ, Chediak J, Stemerman MB, Maciag T. Characterization and properties of cultured human von Willebrand umbilical vein endothelial cells. Blood. 1981;58:788–796.[Free Full Text]

31. Voyta JC, Via DP, Butterfield CE, Zetter BR. Identification and isolation of endothelial cells based on their increased uptake of acetylated-low density lipoprotein. J Cell Biol. 1984;99:2034–2040.[Abstract/Free Full Text]

32. Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins: identification by morphologic and immunologic criteria. J Clin Invest. 1973;52:2745–2756.

33. Degen SJF, Rajput B, Reich E. The human tissue plasminogen activator gene. J Biol Chem. 1986;261:6972–6985.[Abstract/Free Full Text]

34. Tso JY, Sun X, Kao T, Reece KS, Wu R. Isolation and characterization of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene. Nucleic Acids Res. 1985;13:2485–2502.[Abstract/Free Full Text]

35. Mussoni L, Lawrence D, Loskutoff DJ. A direct, plasmin-independent assay for plasminogen activator. Thromb Res. 1984;34:241–254.[Medline] [Order article via Infotrieve]

36. Booyse FM, Scheinbuks J, Lin P, Traylor M, Bruce R. Isolation and interrelationships of the multiple molecular tissue-type and urokinase-type plasminogen activator forms produced by cultured human umbilical vein endothelial cells. J Biol Chem. 1988;263:15129–15138.[Abstract/Free Full Text]

37. Laemmili UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685.[Medline] [Order article via Infotrieve]

38. Greenberg ME, Ziff EB. Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature. 1984;311:433–438.[Medline] [Order article via Infotrieve]

39. Grenett HE, Benza RL, Fless GM, Li XN, Davis GC, Booyse FM. Genotype-specific transcriptional regulation of PAI-1 gene expression by insulin, hypertriglyceridemic VLDL, and Lp(a) in transfected cultured human endothelial cells. Arterioscler Thromb Vasc Biol. 1998;18:1803–1809.[Abstract/Free Full Text]

40. Maniatis T, Fritsch EF, Sambrook J. Plasmid vectors. In: Irwin N, Ford N, Nolan C, Ferguson M, Ockler M, eds. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1982:1.38–1.39.

41. Lorenz WW, Cormier MJ, O’Kane DJ, Hua D, Escher AA, Szalay AA. Expression of the Renilla reniformis luciferase gene in mammalian cells. J Biolumin Chemilumin. 1996;11:31–37.[Medline] [Order article via Infotrieve]

42. Farr A, Roman A. A pitfall of using a second plasmid to determine transfection efficiency. Nucleic Acids Res. 1992;20:920.[Free Full Text]

43. Pekalharing HL, Kleinveld HA, Duif PF, Bouma BN, van Rijn HJ. Effect of lipoprotein(a) and LDL on plasminogen binding to extracellular matrix and on matrix-dependent plasminogen activation by tissue plasminogen activator. Thromb Haemost. 1996;75:497–502.[Medline] [Order article via Infotrieve]

44. Eriksson P, Nilsson L, Karpe F, Hamsten A. Very-low-density lipoprotein response element in the promoter region of the human plasminogen activator inhibitor-1 gene implicated in the impaired fibrinolysis of hypertriglyceridemia. Arterioscler Thromb Vasc Biol. 1998;18:20–26.[Abstract/Free Full Text]

45. De Cesare D, Vallone D, Caracciolo A, Sassone-Corsi P, Nerlov C, Verde P. Heterodimerization of c-Jun with ATF-2 and c-Fos is required for positive and negative regulation of the human urokinase enhancer. Oncogene. 1995;11:365–376.[Medline] [Order article via Infotrieve]

46. Nerlov D, De Cesare D, Pergola F, Caracciolo A, Blasi F, Johnsen M, Verde P. A regulatory element that mediates co-operation between a PEA3-AP-1 element and an AP-1 site is required for phorbol ester induction of urokinase enhancer activity in HepG2 hepatoma cells. EMBO J. 1992;11:4573–4582.[Medline] [Order article via Infotrieve]





This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tabengwa, E. M.
Right arrow Articles by Booyse, F. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tabengwa, E. M.
Right arrow Articles by Booyse, F. M.
Related Collections
Right arrow Fibrinolysis