Thrombosis |
From the Division of Cardiovascular Disease, University of Alabama at Birmingham.
Correspondence to Edlue M. Tabengwa, PhD, 845 19th St South, BBRB 809 (UAB Station), Birmingham AL 35294-2170. E-mail etabengwa{at}cardio.dom.uab.edu
| Abstract |
|---|
|
|
|---|
53% (3.3±0.14 versus 6.97±0.42 µg/mL) and mRNA
levels decreased
70% in HTG-VLDLtreated HUVECs compared with
NTG-VLDLtreated and culture medium control cells. Decreased tPA
antigen and mRNA expression was associated with a concomitant
98%
decrease in tPA-mediated plasmin generation in HTG-VLDLtreated HUVEC
cultures. Nuclear transcription run-on assays demonstrated that
HTG-VLDL decreased tPA gene transcription
73% (tPA mRNA/GAPDH mRNA)
in cultured HUVECs. To identify and localize the repressive element(s)
in the tPA promoter responsive to HTG-VLDL, a tPA promoter/luciferase
construct (ptPA222/luc) was generated. HUVECs transiently transfected
with this construct were incubated in the absence/presence of HTG-VLDL
or NTG-VLDL (20 µg/mL). HTG-VLDL decreased promoter activity
52%
to 57% in the ptPA222/luc-transfected cells compared with
NTG-VLDLtreated or buffer control cells. These results indicate that
the 2.2-kb fragment of the promoter and 5' flanking region of the tPA
gene contains the repressive sequences that direct the transcriptional
downregulation of the tPA promoter. Data from these studies suggest
that the repression of tPA gene expression by HTG-VLDL may contribute
to the impaired fibrinolysis often associated with
hypertriglyceridemia.
Key Words: tissue plasminogen activator gene regulation hypertriglyceridemic VLDL fibrinolysis tissue plasminogen activator promoter cis-repressive elements
| Introduction |
|---|
|
|
|---|
1 of these fibrinolytic proteins may
alter the hemostatic balance on the EC surface, thus promoting early
initiation of fibrin deposition, atherogenesis, CAD, and eventual
MI.1 Several atherogenic lipoproteins may cause such a
perturbation; eg, Lp(a),6 oxidized LDL,7 8
and acetylated LDL9 increase PAI-1 levels and
decrease tPA expression in cultured human ECs.8 10 In
addition, abnormal triglyceride-rich lipoproteins,
including VLDL (hypertriglyceridemic VLDL
[HTG-VLDL]), have been shown to increase PAI levels11 12
and decrease surface localized plasmin generation.13
Conversely, normotriglyceridemic VLDL (NTG-VLDL)
has been shown to be less potent in creating a prothrombotic
state.11 14 The differences in these molecules may be due
to differences in composition, conformation, and receptor binding
properties; eg, HTG-VLDL, but not NTG-VLDL, binds to ß-VLDL and LDL
receptors, which are also found in ECs.15 Furthermore,
HTG-VLDL has a more variable and higher lipid load than does
NTG-VLDL.15 Altered tPA antigen concentrations may be of important consequence in preclinical atherosclerosis and may be a marker for risk of future MI.16 17 18 Basal tPA antigen levels are increased in plasma from young post-MI patients compared with control subjects, whereas postocclusion tPA concentrations are decreased, a finding that has been confirmed in most cross-sectional studies of CAD patients.1
The exact molecular regulatory mechanisms underlying the repression of tPA by atherogenic lipoproteins have not been elucidated. Other studies have demonstrated that tPA is transcriptionally regulated by a variety of agents, including thrombin,19 cAMP,20 ethanol,21 and transforming growth factor.22 The present study demonstrates that HTG-VLDL decreases tPA antigen and mRNA levels in cultured HUVECs, that this downregulation also occurs at the level of gene transcription, and that a specific region of the tPA promoter is responsive to repression by HTG-VLDL. In addition, the transcriptional repression of tPA gene expression by HTG-VLDL observed in the present study is associated with a decreased net expression of surface-localized EC fibrinolytic activity and, hence, may contribute, in part, to the substantial thrombotic risk associated with hypertriglyceridemia.
| Methods |
|---|
|
|
|---|
-32P]dCTP,
[
-32P]dUTP (3000 Ci/mmol), and sodium
125I (specific activity 14.0 mCi/g), from
Amersham Corp; Iodo-Beads, from Pierce Chemical Co; Sephadex G-25
column (PD-10), from Pharmacia; aprotinin (Trasylol), from Mobay Corp;
1,1'-dioctadecyl-1-3,3,3',3'-tetramethylindocarbocyanine
perchlorate (DiI)-labeled acetylated LDL (DiI-Ac-LDL), from
Biomedical Technologies, Inc; medium 199 (M199), TRIzol reagent, and
M-MLV reverse transcriptase, from GIBCO-BRL; tPA ELISA kits
(TintElize), from BioPool; BglII, KpnI,
AccI, BamHI, DraI, SacI,
and SmaI, from Boehringer-Mannheim; calf intestinal
phosphatase, T4 DNA ligase, Klenow fragment, Gene Light vector
pGL3-basic expression, Dual-Luciferase Reporter Assay System, pRL-TK,
and agarose, from Promega Inc; [
-32P]dCTP
(300 Ci/mmol), from Amersham; and Taq DNA polymerase and oligo(dT)
primers, from Promega, Inc. Specific primer pairs for tPA and GAPDH
(constitutive control) used for polymerase chain reactions (PCRs) were
obtained from DNA International, Inc. Lipofectamine, Opti-MEM-1 reduced
serum medium, and M199 were from GIBCO-BRL. Frozen bovine hypothalami,
from which endothelial cell growth factor was
isolated,23 were obtained from Pel-Freeze
Inc.
Isolation and Characterization of Lipoproteins
Purified VLDL was obtained freshly isolated from Drs William A.
Bradley and Sandra H. Gianturco, University of Alabama at Birmingham
(UAB), and was isolated and characterized as described in detail
previously.24 Briefly, plasma was obtained from fasting
subjects with normal lipid values for isolation of NTG-VLDL or from
fasting patients with types 4 and 5 lipoprotein profiles for HTG-VLDL.
The diagnoses were based on commonly used criteria.25
NTG-VLDL and HTG-VLDL were subfractionated through a discontinuous NaCl
gradient from a density of 1.063 to 1.006 g/mL by the cumulative
flotation methods of Lindgren et al,26 as previously
detailed.24 The VLDLs used had Svedberg flotation rates of
100 to 400. The defined flotation cut precludes comparison of
lipid-rich with lipid-poor particles, ie, large versus small particles
that could occur in comparing NTG-VLDL and HTG-VLDL. HTG-VLDL, but not
NTG-VLDL, has been shown to bind with high affinity to bovine adrenal
LDL receptors15 and to the monocyte-macrophage
receptor for triglyceride-rich lipoproteins.27
Binding to the LDL receptor was correlated with the presence of
accessible apoE, as found in HTG-VLDL but not in
NTG-VLDL.24 Total protein contents of the lipoproteins
were obtained by a modified method of Lowry et al,28 and
triglyceride contents were obtained by using a kit from
Boehringer-Mannheim.27 All lipoproteins were also
routinely analyzed by Western blotting to identify their
apoprotein contents.
Cell Culture
Human umbilical vein ECs (HUVECs) were obtained from fresh
(discarded) umbilical cords by mild collagenase
treatment,4 5 seeded into human fibronectincoated
plastic T-25 or 960-mm2 Petri dishes, and grown
to confluence in complete culture medium as we have previously
described.29 30 Cultures were refed every 48 hours with
complete culture medium and maintained in a 95% air/5%
CO2humidified atmosphere. All experiments were
carried out with pooled (4 to 6 umbilical veins), confluent, serially
subcultured HUVECs (passages 1 to 4). Cells were routinely counted by
use of phase-contrast microscopy and a 0.5-mmx0.5-mm counting reticle.
Cell cultures were routinely characterized as HUVECs, and their purity was established by their uniform uptake of the EC-specific fluorescent probe DiI-Ac-LDL31 and their typical monolayer "cobblestone" tight-packing growth morphology.31 32 Only individual cultures with >95% identifiable ECs were used in these experiments.
tPA antigen/mRNA analyses were carried out with postconfluent HUVEC cultures grown in 24-well multiwell plates (200 mm2 per well). Cultures were incubated (0 to 24 hours) in serum-free culture medium (500 mL per well, the same as for complete culture medium, except FBS is replaced with 0.25% BSA) in the absence/presence of HTG-VLDL or NTG-VLDL (0 to 50 µg/mL), and each culture (in triplicate) was then analyzed for its secreted tPA antigen and coincident mRNA levels, as described below.
Nuclear transcription run-on assays were carried with postconfluent cultures grown in T-75 (7500-mm2) flasks. Cultures were incubated in serum-free culture medium in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL) for 8 hours before the isolation of nuclei, as described below.
tPA Antigen Analysis (ELISA)
Measurements of total secreted tPA antigen levels (free plus
complex forms) were performed (in duplicate) in serum-free conditioned
culture media by use of a commercial tPA (TintElize, BioPool) kit.
Determination of antigen concentration was made with a Dynatech plate
reader, appropriate standards, and BioLinx software (Dynatech) to
measure absorption at 405 nm. Total secreted tPA levels were calculated
in nanograms per milliliter per well (
1.8x105 cells per
well) per 24 hours.
RNA Isolation
Total cytoplasmic RNA was isolated from the confluent monolayer
of each HUVEC culture (in duplicate) that had been incubated for
varying times (0, 2, 4, and 8 hours) in the absence/presence of
HTG-VLDL or NTG-VLDL (20 µg/mL). Cell monolayers were washed twice in
Dulbeccos PBS, and total RNA was extracted by a single-step method,
with the use of TRIzol reagent, according to the manufacturers
instructions.
Measurement of tPA mRNA Level by Reverse
TranscriptionPCR
Total RNA (1 µg) in a 20 µL reaction mixture was
reverse-transcribed with M-MLV reverse transcriptase (200 U) for 10
minutes at room temperature, followed by 1 hour at 42°C, with
oligo(dT) used as a primer. The resulting cDNA (5 µL) was used as a
template, and a 234-bp segment of the tPA cDNA was amplified by use of
a 24-mer upstream primer (5'-GTCTGCTGTGCACCATCCCCCATC-3') identical to
positions 177 to 200 and a 24-mer downstream primer
(5'-TTGTCATCAATCTTGAATCCCATA-3') complementary to positions 400 to 377
of the human tPA mRNA.33 A 600-bp segment of an internal
standard, GAPDH cDNA, was simultaneously amplified by use
of a 24-mer upstream primer (5' CCACCCATGGCAAATTCCATGGCA 3') identical
to positions 212 to 235 and a 24-mer downstream primer (5'
TCTAGACGGCAGGTCAGGTCCACC 3') complementary to positions 809 to 786 of
the human GAPDH mRNA.34 Amplification was carried out in a
Techne Thermal Cycler PHC-3 for 28 cycles (1 cycle consisted of 94°C
for 45 seconds, 60°C for 45 seconds, and 72°C for 45 seconds). PCR
products were analyzed on a 1.2% agaroseethidium bromide
gel. The gels were photographed, and the intensity of each tPA and
GAPDH mRNA band was measured by laser densitometric scanning with a
Molecular Dynamics Personal Densitometer and expressed as a relative
ratio of the GAPDH mRNA band intensity in each lane.
Fibrinolytic (Plasmin) Activity Assay
Surface-localized fibrinolytic activity was measured, with the
use of live confluent cultured HUVECs (passages 1 and 2), by the direct
conversion of EC-bound single-chain 125I-labeled
Glu-Pmg by receptor-bound tPA to 2-chain
125I-labeled plasmin and quantification of either
125I-labeled plasmin
Mr 20-kDa light chain or
Mr 60-kDa heavy chain formation, after
SDS-PAGE under reduced conditions, according to the method of Mussoni
et al,35 as modified in our
laboratory.4 13 Because early-passage (passages 1 and 2)
HUVECs do not synthesize urokinase, the results of this particular
assay are largely attributed to the effects of tPA.36
Postconfluent cultured HUVECs in 96-well plates (in triplicate) were
incubated at 37°C for 8 hours in the absence/presence of HTG-VLDL or
NTG-VLDL (20 µg/mL) in serum-free culture medium, followed by removal
of lipoproteins and further incubation in complete culture medium for
an additional 16 hours. The cultures were then washed (3 times) with
10 mmol/L HEPES and 0.1 mol/L sodium acetate, pH 7.4, containing
1% BSA (buffer A) and equilibrated with buffer A (50 µL per well) at
4°C for 20 minutes. 125I-labeled Glu-Pmg
(2 µmol/L) in buffer A containing 1000 kallikrein inhibiting
units per milliliter aprotinin (40 µL) was added to each well and
incubated at 4°C for 30 minutes. Culture plates were then placed in a
37°C water bath to initiate tPA-mediated conversion of HUVEC-bound
125I-labeled Glu-Pmg to
125I-labeled plasmin. After 10 minutes of
incubation, the reactions were stopped by the rapid addition of 40 µL
of hot (56°C) solubilizing buffer (4% SDS, 10% glycerol, and 0.2
mol/L Tris-HCl, pH 6.8). The total contents of each well were
analyzed by 0.1% SDS-PAGE under reducing conditions as
previously described.13 The amounts of
125I-labeled Mr
20-kDa light chain or Mr 60-kDa heavy chain
of plasmin generated were quantified by measuring the radioactivity
content in each band with the use of phosphorimaging
autoradiography (Molecular Dynamics Series 425F
PhosphorImager) in combination with ImageQuant software (Molecular
Dynamics), as described below.
SDS-PAGE and Quantitative Phosphorimaging Autoradiography
Reduced samples containing 125I-labeled
Glu-Pmg and 125I-labeled plasmin were
analyzed by SDS-PAGE with use of a 1.8x82x74-mm
polyacrylamide slab gel consisting of an upper 4% stacking gel
and a lower 5% to 12.5% gradient running gel, according to the method
of Laemmli.37 After electrophoresis, gels were dried and
exposed in phosphorimaging cassettes for 3 to 5 hours. The amount of
remaining 125I-labeled Glu-Pmg and newly
generated 125I-labeled
Mr 20-kDa plasmin light chain in each
individual gel was quantified by measuring the radioactivity content in
each band by phosphorimaging autoradiography with the
Molecular Dynamics Series 425F PhosphorImager in combination with
ImageQuant software. The radioactivity content in each band was then
converted to a plasmin concentration by comparing the radioactivity
content of each individual band with the radioactivity content of the
125I-labeled Mr
20-kDa plasmin light chain derived from a known amount of fully
converted 125I-labeled Glu-Pmg. A
125I-labeled plasmin standard was obtained by
complete activation of 125I-labeled Glu-Pmg (1.0
µg) in buffer A containing 1000 kallikrein inhibiting units per
milliliter aprotinin (minus BSA) by incubation with 2-chain uPA (2
IU/mL) for 1 hour at 37°C.13
Nuclear Transcription Run-On Assays
Nuclear run-on assays were carried out essentially as described
by Greenberg and Ziff.38 Briefly, postconfluent cultures
in T-75 tissue culture flasks (in duplicate) were incubated in the
absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL) for 8 hours at
37°C, followed by a wash with Dulbeccos PBS. Cells were scraped
from the culture flasks and resuspended in NP-40 lysis buffer (0.001
mol/L EDTA, 0.0001 mol/L phenylmethylsulfonyl fluoride, 0.01
mol/L NaCl, 0.003 mol/L MgCl2,
10-6 mol/L antipain, 0.01 mol/L Tris-HCl, pH
7.4, and 0.5% [vol/vol] NP-40) and incubated on ice for 5 minutes.
Intact nuclei were pelleted by centrifugation
(1660g for 5 minutes at 4°C), washed once in NP-40 lysis
buffer, and resuspended in glycerol storage buffer (0.01 mol/L
Tris-HCl, pH 8.3, 0.0001 mol/L EDTA, 0.001 mol/L dithiothreitol, and
40% glycerol) at 6x106 nuclei per 100 µL and
snap-frozen in liquid nitrogen. Transcription reactions were carried
out by mixing the nuclei (100 µL) with an equal volume (100 µL) of
2x reaction buffer (0.03 mol/L Tris-HCl, pH 8, 0.0005 mol/L
MgCl2, 0.3 mol/L KCl, 25 U/mL placental RNase,
0.01 mol/L creatine phosphate, 20 U/mL creatine phosphokinase, 0.001
mol/L each ATP, CTP and GTP, 0.0001 mol/L phenylmethylsulfonyl
fluoride, and 0.0005 mol/L dithiothreitol) containing 100 µCi
of [
-32P]UTP. After a 45-minute incubation
at 28°C ,the reactions were terminated by adding a solution of 0.01
mol/L Tris-HCl, pH 7.5, containing 7 mol/L urea, 2% sarkosyl, and 0.35
mol/L NaCl. DNA was sheared by passage through a syringe needle (21 and
25 gauge), and the 32P-labeled nuclear RNA was
isolated on a 5.7 mol/L CsCl gradient by
ultracentrifugation at 100 000g for 18
hours at 20°C and then hybridized with cDNAs for tPA and GAPDH
(constitutive control) immobilized on nitrocellulose
filters. Preparation of nitrocellulose filters containing the cDNAs,
hybridization, and washing of filters were carried out as previously
described.38 The radioactivity corresponding to each
individual filter was quantified by phosphorimaging
autoradiography with the Molecular Dynamics Series 425F
PhosphorImager in combination with ImageQuant software (Molecular
Dynamics).
Amplification 5' Promoter and Flanking Regions (
2220-bp
Fragments) of the tPA Gene
A 2220-bp segment of the promoter and 5' flanking region of the
tPA gene containing the start site of transcription at +1 and the TATA
box at -24 to -29 were amplified by PCR as previously
described.39 The PCR was carried out with use of an
upstream primer (5'
CGATCGGTACCCCATTGTCACCTTATCAGCCTGCCC 3')
identical to positions 1473 to 1497 and downstream primer (5'
GATCAGATCTTCCTCGCAGAGGTTTCTCTCCAGC 3')
complementary to positions 3692 to 3668 of the human tPA
gene.33 Both these primers had a CGATC clamp and a
KpnI site in the upstream primer (underlined) and a
BglII site in the downstream primer (underlined) to aid in
the subsequent cloning into the luciferase reporter gene (luc,
pGL3-basic expression vector, Promega Corp). Detailed sequencing
analyses were carried out with duplicate PCR clones from single
PCR amplification of 8 individual (16 sequences) promoter fragments to
rule out errors due to PCR cloning or sequencing, as described
previously.39 Sequencing was carried out on both
strands by the UAB Automated DNA Sequencing Core Facility.
Construction of the tPA Promoter/Luc Construct
The amplified tPA promoter fragments (2.2 kb) were purified by
electrophoresis on 1% agarose, digested with KpnI and
BglII, and ligated into the KpnI/BglII
site of the luciferase reporter gene (GeneLight vector, pGL3-basic
expression vector). The ligation mixture was transformed into JM 109
competent cells to generate ptPA222/luc constructs. tPA/luc constructs
were purified by ultracentrifugation through a cesium
chloride/ethidium bromide gradient before
transfection.40 The tPA fragment in the plasmid
construct was sequenced on both strands by the UAB Automated DNA
Sequencing Core Facility for sequence verification. Sequences were
aligned and compared with published human tPA sequences33
by using the Genetics Computer Group sequence analysis software
provided by the UAB Biological Computing Resource Core Facility.
Transient Transfection of Cultured HUVECs With ptPA/luc and
Promoter and Measurement of Luciferase Activity
Transient transfection experiments were carried out with
semiconfluent (60% to 75%) subcultured HUVECs grown in 6-well
multiwell plates by use of lipofectamine, as we have previously
described with minor modifications.21 39 Briefly,
DNA-lipofectamine complexes were preformed for 45 minutes at
room temperature by use of 1 µg per well of DNA, 0.05 µg per well
internal control vector, a thymidine kinase promoterdriven Renilla
luciferase construct (pRL-TK), and 10 µg per well lipofectamine in
Opti-MEM-1 reduced serum medium, according to the manufacturers
instructions. Cultured HUVECs were transfected (in triplicate) with the
ptPA/luc constructs and cotransfected with pRL-TK (internal
control).41 42 Transfection mixtures were incubated in
Opti-MEM-1 reduced serum medium for 1 hour at 37°C. At the end of the
incubation, the medium was removed, and cultures were rinsed twice with
M199 and then incubated in fresh M199 containing 0.25% BSA for 18
hours in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL).
Finally, cultures were rinsed twice with Dulbeccos PBS, lysed by the
addition of 200 µL lysis buffer (Dual-Luciferase kit, Promega), and
centrifuged at 16 000g for 1 minute, and the cell
supernatants were assayed for their dual luciferase activity (firefly
and Renilla) by use of the Dual-Luciferase Reporter Assay System
according to manufacturers instructions. Activities were measured,
and final luciferase activities were normalized to the corresponding
Renilla activities to correct for transfection efficiency.
Analysis of Data
All of the data were expressed as the mean±SD of triplicate
experiments performed in each assay and analyzed by the Student
t test. Data with P<0.05 were taken to
represent statistically significant differences in experimental
results.
| Results |
|---|
|
|
|---|
53% in HTG-VLDLtreated HUVEC cultures compared with
NTG-VLDLtreated and culture medium control cells (Figure 1
|
Simultaneous reverse transcriptionPCR analysis of
these HUVEC cultures for their coincident expression of relative tPA
mRNA levels (tPA mRNA/GAPDH mRNA ratios) also indicated a decline in
steady-state levels of tPA after HTG-VLDL treatment. After incubation
for 8 hours in the presence of HTG-VLDL (20 µg/mL), tPA mRNA levels
decreased by 70% compared with baseline levels (Figure 2
). In addition, after incubation for 8
hours, tPA mRNA levels decreased in the presence of HTG-VLDL (20
µg/mL) compared with NTG-VLDL or control medium (data not shown).
These studies were carried out in 16 separate experiments in which 3 or
4 different individual HUVEC cultures were pooled, examined, and
compared; similar results were obtained, providing strong evidence that
HTG-VLDL downregulates tPA expression.
|
Effect of HTG-VLDL on Fibrinolytic Activity in Cultured
HUVECs
tPA contributes to cell surfacelocalized fibrinolytic activity
by its ability to convert receptor-bound Pmg to plasmin. These
experiments were carried out to establish whether the decrease in tPA
levels induced by HTG-VLDL may additionally exert an
inhibitory effect on the net expression of cultured HUVEC
surfacelocalized fibrinolytic activity. Confluent cultured HUVECs
preincubated in the presence of HTG-VLDL (20 µg/mL), followed by
incubation with 125I-labeled Glu-Pmg, showed a
significant decrease (
98%) in net expressed fibrinolytic activity
(2±2 pmol per well) compared with activity in NTG-VLDLtreated or
culture medium control cells (
120±20 pmol per well), as seen in
Figure 3
. As stated earlier, because
early-passage HUVECs do not synthesize urokinase, the results of this
particular assay are attributed largely to the effects of
tPA.36 These studies on the effects of HTG-VLDL
on fibrinolytic activity were repeated in 16 separate experiments that
used different pools of cultured HUVECs (in triplicate) with similar
results.
|
Effect of HTG-VLDL on tPA Gene Transcription Rates
Nuclear transcription run-on assays were carried out to establish
whether the observed decrease in tPA mRNA in response to HTG-VLDL was
due to an decrease in the rate of tPA transcription. Nuclei were
isolated from postconfluent cultured HUVECs (in
7500-mm2 flasks) and incubated in the
absence/presence of HTG-VLDL for 8 hours at 37°C. Newly synthesized
32P-labeled nuclear transcripts were hybridized
to tPA and GAPDH cDNAs immobilized on nylon membranes, and
the nuclear run-on assay results were measured by phosphorimaging
autoradiography. These results indicated
transcriptional repression of the tPA gene by HTG-VLDL, as evidenced by
a significant decrease (
72%) in new
32P-labeled tPA mRNA (tPA mRNA/GAPDH mRNA ratio)
in the cultured HUVECs treated with HTG-VLDL compared with
NTG-VLDLtreated controls (Figure 4
).
These assays were carried out in 6 separate experiments with at least 3
pooled different individual HUVEC cultures; similar results were
obtained.
|
Generation of ptPA/luc Promoter Construct and Transient
Transfection of Cultured HUVECs With the ptPA/luc Promoter
Construct
Because the present study demonstrated that HTG-VLDL but not
NTG-VLDL decreased tPA levels in cultured HUVECs and that this
repression occurred at the transcriptional level, we sought to further
confirm and localize this repression of tPA expression by HTG-VLDL; a
2220-bp segment of the tPA promoter and 5' flanking region, containing
the start +1 site as well as the TATA box, was PCR-amplified (Figure 5
). This was followed by ligation into a
promoterless/enhancerless luciferase to generate the
promoter/luciferase construct (ptPA222luc) to be used in transient
transfection studies.
|
HUVEC cultures were transiently transfected with the ptPA222/luc
construct. The cells were concomitantly transfected with Renilla to
correct for differences in DNA uptake. The transfected cells were
subsequently incubated in the absence/presence of HTG-VLDL or NTG-VLDL
(20 µg/mL) for 18 hours, then harvested, and assayed for luciferase
and Renilla activity. Compared with NTG-VLDL or control medium,
HTG-VLDL decreased promoter activity (luciferase activity)
52% to
57% in the ptPA222/luc construct (Figure 6
). In addition, no luciferase activity
was generated in the reverse orientation undeleted construct (negative
control).
|
Therefore, these results demonstrate that the 2.2-kb fragment of the promoter and 5' flanking region of the tPA gene contains the repressive sequences that direct the transcriptional downregulation of the tPA promoter.
| Discussion |
|---|
|
|
|---|
HTG-VLDL is known to transcriptionally regulate other fibrinolytic proteins. For example, prior studies in our laboratory have demonstrated that HTG-VLDL transcriptionally upregulates PAI-1 expression in a genotype-specific manner.29 In addition, Eriksson et al44 recently identified a VLDL response element in the PAI-1 promoter, which is located between -672 bp and -657 bp in the promoter region. However, to our knowledge, no description of regulatory elements in the tPA gene responsive to HTG-VLDL exists. In the present study, we add to the prior body of knowledge by reporting for the first time the transcriptional repression of tPA gene expression by HTG-VLDL. Our transient transfection studies with the ptPA222/luc construct indicate that the cis-repressive element(s), which specifically directs the transcriptional downregulation of the tPA gene by HTG-VLDL, is located within the PCR-amplified 2.2-kb region of the tPA promoter used in these studies.
Repression of gene expression may occur by transcriptional interference. This results when a transcription factor is blocked from successfully interacting with the transcription initiation complex through direct or indirect interactions with another factor. Transcriptional interference of the general transcription factor(s) has been observed for other fibrinolytic protein genes, including the urokinase gene.45 46 Whether this type of interference contributes to the observed repression of the tPA gene by HTG-VLDL is not known.
Additional studies to identify the specific site(s) of the HTG-VLDL repressive element(s) within the tPA promoter and HTG-VLDL inducible transcription/repressive factor(s) that binds to this region are in progress.
| Acknowledgments |
|---|
Received June 18, 1999; accepted February 21, 2000.
| References |
|---|
|
|
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |