© 2000 American Heart Association, Inc.
Thrombosis |
Hypertriglyceridemic VLDL Downregulates Tissue Plasminogen Activator Gene Transcription Through cis-Repressive Region(s) in the Tissue Plasminogen Activator Promoter in Cultured Human Endothelial Cells
From the Division of Cardiovascular Disease, University of Alabama at Birmingham.
Correspondence to Edlue M. Tabengwa, PhD, 845 19th St South, BBRB 809 (UAB Station), Birmingham AL 35294-2170. E-mail etabengwa{at}cardio.dom.uab.edu
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—The relationship between tissue plasminogen activator (tPA) levels and the potential regulation by hypertriglyceridemic very low density lipoprotein (HTG-VLDL) was examined in a human umbilical vein endothelial cell (HUVEC) culture model system. HUVEC cultures were incubated in the absence/presence of HTG-VLDL or normal (NTG)-VLDL (0 to 50 µg/mL) at 37°C for various times (0 to 24 hours), followed by analyses of tPA antigen (ELISA), mRNA (reverse transcription–polymerase chain reaction), endothelial cell surface–localized plasmin generation assays, and nuclear transcription run-on assays. Secreted tPA antigen levels decreased
53% (3.3±0.14 versus 6.97±0.42 µg/mL) and mRNA
levels decreased 70% in HTG-VLDL–treated HUVECs compared with
NTG-VLDL–treated and culture medium control cells. Decreased tPA
antigen and mRNA expression was associated with a concomitant 98%
decrease in tPA-mediated plasmin generation in HTG-VLDL–treated HUVEC
cultures. Nuclear transcription run-on assays demonstrated that
HTG-VLDL decreased tPA gene transcription 73% (tPA mRNA/GAPDH mRNA)
in cultured HUVECs. To identify and localize the repressive element(s)
in the tPA promoter responsive to HTG-VLDL, a tPA promoter/luciferase
construct (ptPA222/luc) was generated. HUVECs transiently transfected
with this construct were incubated in the absence/presence of HTG-VLDL
or NTG-VLDL (20 µg/mL). HTG-VLDL decreased promoter activity 52%
to 57% in the ptPA222/luc-transfected cells compared with
NTG-VLDL–treated or buffer control cells. These results indicate that
the 2.2-kb fragment of the promoter and 5' flanking region of the tPA
gene contains the repressive sequences that direct the transcriptional
downregulation of the tPA promoter. Data from these studies suggest
that the repression of tPA gene expression by HTG-VLDL may contribute
to the impaired fibrinolysis often associated with
hypertriglyceridemia.
Key Words: tissue plasminogen activator • gene regulation • hypertriglyceridemic VLDL • fibrinolysis • tissue plasminogen activator promoter • cis-repressive elements
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Impaired fibrinolysis plays an important role in the early pathogenesis of atherosclerosis, coronary artery disease (CAD), and eventual myocardial infarction (MI).1 2 3 Fibrinolysis involves the endothelial cell (EC) surface–localized conversion of plasminogen (Pmg) by receptor-bound Pmg activators (PAs), tissue-type PA (tPA) and urokinase-type PA (uPA), to the serine protease, plasmin. Plasmin, in turn, degrades fibrin, which is associated with clot formation. ECs synthesize tPA and uPA as well as the major physiological regulator and inhibitor of PA-mediated fibrinolytic activity, Pmg activator inhibitor type (PAI)-1.4 5 Therefore, it is conceivable that perturbation of the expression or activity of
1 of these fibrinolytic proteins may
alter the hemostatic balance on the EC surface, thus promoting early
initiation of fibrin deposition, atherogenesis, CAD, and eventual
MI.1 Several atherogenic lipoproteins may cause such a
perturbation; eg, Lp(a),6 oxidized LDL,7 8
and acetylated LDL9 increase PAI-1 levels and
decrease tPA expression in cultured human ECs.8 10 In
addition, abnormal triglyceride-rich lipoproteins,
including VLDL (hypertriglyceridemic VLDL
[HTG-VLDL]), have been shown to increase PAI levels11 12
and decrease surface localized plasmin generation.13
Conversely, normotriglyceridemic VLDL (NTG-VLDL)
has been shown to be less potent in creating a prothrombotic
state.11 14 The differences in these molecules may be due
to differences in composition, conformation, and receptor binding
properties; eg, HTG-VLDL, but not NTG-VLDL, binds to ß-VLDL and LDL
receptors, which are also found in ECs.15 Furthermore,
HTG-VLDL has a more variable and higher lipid load than does
NTG-VLDL.15 Altered tPA antigen concentrations may be of important consequence in preclinical atherosclerosis and may be a marker for risk of future MI.16 17 18 Basal tPA antigen levels are increased in plasma from young post-MI patients compared with control subjects, whereas postocclusion tPA concentrations are decreased, a finding that has been confirmed in most cross-sectional studies of CAD patients.1
The exact molecular regulatory mechanisms underlying the repression of tPA by atherogenic lipoproteins have not been elucidated. Other studies have demonstrated that tPA is transcriptionally regulated by a variety of agents, including thrombin,19 cAMP,20 ethanol,21 and transforming growth factor.22 The present study demonstrates that HTG-VLDL decreases tPA antigen and mRNA levels in cultured HUVECs, that this downregulation also occurs at the level of gene transcription, and that a specific region of the tPA promoter is responsive to repression by HTG-VLDL. In addition, the transcriptional repression of tPA gene expression by HTG-VLDL observed in the present study is associated with a decreased net expression of surface-localized EC fibrinolytic activity and, hence, may contribute, in part, to the substantial thrombotic risk associated with hypertriglyceridemia.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Materials
Human Glu-Pmg was obtained from Enzyme Research Products, Inc; collagenase (type I, CLS), from Boehringer-Mannheim Biochemicals; FBS, from Intergen Corp; heparin (porcine intestinal mucosa), human fibronectin, and BSA, from Sigma Chemical Co; [
-32P]dCTP,
[-32P]dUTP (3000 Ci/mmol), and sodium
125I (specific activity 14.0 mCi/g), from
Amersham Corp; Iodo-Beads, from Pierce Chemical Co; Sephadex G-25
column (PD-10), from Pharmacia; aprotinin (Trasylol), from Mobay Corp;
1,1'-dioctadecyl-1-3,3,3',3'-tetramethylindocarbocyanine
perchlorate (DiI)-labeled acetylated LDL (DiI-Ac-LDL), from
Biomedical Technologies, Inc; medium 199 (M199), TRIzol reagent, and
M-MLV reverse transcriptase, from GIBCO-BRL; tPA ELISA kits
(TintElize), from BioPool; BglII, KpnI,
AccI, BamHI, DraI, SacI,
and SmaI, from Boehringer-Mannheim; calf intestinal
phosphatase, T4 DNA ligase, Klenow fragment, Gene Light vector
pGL3-basic expression, Dual-Luciferase Reporter Assay System, pRL-TK,
and agarose, from Promega Inc; [-32P]dCTP
(300 Ci/mmol), from Amersham; and Taq DNA polymerase and oligo(dT)
primers, from Promega, Inc. Specific primer pairs for tPA and GAPDH
(constitutive control) used for polymerase chain reactions (PCRs) were
obtained from DNA International, Inc. Lipofectamine, Opti-MEM-1 reduced
serum medium, and M199 were from GIBCO-BRL. Frozen bovine hypothalami,
from which endothelial cell growth factor was
isolated,23 were obtained from Pel-Freeze
Inc.
Isolation and Characterization of Lipoproteins
Purified VLDL was obtained freshly isolated from Drs William A.
Bradley and Sandra H. Gianturco, University of Alabama at Birmingham
(UAB), and was isolated and characterized as described in detail
previously.24 Briefly, plasma was obtained from fasting
subjects with normal lipid values for isolation of NTG-VLDL or from
fasting patients with types 4 and 5 lipoprotein profiles for HTG-VLDL.
The diagnoses were based on commonly used criteria.25
NTG-VLDL and HTG-VLDL were subfractionated through a discontinuous NaCl
gradient from a density of 1.063 to 1.006 g/mL by the cumulative
flotation methods of Lindgren et al,26 as previously
detailed.24 The VLDLs used had Svedberg flotation rates of
100 to 400. The defined flotation cut precludes comparison of
lipid-rich with lipid-poor particles, ie, large versus small particles
that could occur in comparing NTG-VLDL and HTG-VLDL. HTG-VLDL, but not
NTG-VLDL, has been shown to bind with high affinity to bovine adrenal
LDL receptors15 and to the monocyte-macrophage
receptor for triglyceride-rich lipoproteins.27
Binding to the LDL receptor was correlated with the presence of
accessible apoE, as found in HTG-VLDL but not in
NTG-VLDL.24 Total protein contents of the lipoproteins
were obtained by a modified method of Lowry et al,28 and
triglyceride contents were obtained by using a kit from
Boehringer-Mannheim.27 All lipoproteins were also
routinely analyzed by Western blotting to identify their
apoprotein contents.
Cell Culture
Human umbilical vein ECs (HUVECs) were obtained from fresh
(discarded) umbilical cords by mild collagenase
treatment,4 5 seeded into human fibronectin–coated
plastic T-25 or 960-mm2 Petri dishes, and grown
to confluence in complete culture medium as we have previously
described.29 30 Cultures were refed every 48 hours with
complete culture medium and maintained in a 95% air/5%
CO2–humidified atmosphere. All experiments were
carried out with pooled (4 to 6 umbilical veins), confluent, serially
subcultured HUVECs (passages 1 to 4). Cells were routinely counted by
use of phase-contrast microscopy and a 0.5-mmx0.5-mm counting reticle.
Cell cultures were routinely characterized as HUVECs, and their purity was established by their uniform uptake of the EC-specific fluorescent probe DiI-Ac-LDL31 and their typical monolayer "cobblestone" tight-packing growth morphology.31 32 Only individual cultures with >95% identifiable ECs were used in these experiments.
tPA antigen/mRNA analyses were carried out with postconfluent HUVEC cultures grown in 24-well multiwell plates (200 mm2 per well). Cultures were incubated (0 to 24 hours) in serum-free culture medium (500 mL per well, the same as for complete culture medium, except FBS is replaced with 0.25% BSA) in the absence/presence of HTG-VLDL or NTG-VLDL (0 to 50 µg/mL), and each culture (in triplicate) was then analyzed for its secreted tPA antigen and coincident mRNA levels, as described below.
Nuclear transcription run-on assays were carried with postconfluent cultures grown in T-75 (7500-mm2) flasks. Cultures were incubated in serum-free culture medium in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL) for 8 hours before the isolation of nuclei, as described below.
tPA Antigen Analysis (ELISA)
Measurements of total secreted tPA antigen levels (free plus
complex forms) were performed (in duplicate) in serum-free conditioned
culture media by use of a commercial tPA (TintElize, BioPool) kit.
Determination of antigen concentration was made with a Dynatech plate
reader, appropriate standards, and BioLinx software (Dynatech) to
measure absorption at 405 nm. Total secreted tPA levels were calculated
in nanograms per milliliter per well (1.8x105 cells per
well) per 24 hours.
RNA Isolation
Total cytoplasmic RNA was isolated from the confluent monolayer
of each HUVEC culture (in duplicate) that had been incubated for
varying times (0, 2, 4, and 8 hours) in the absence/presence of
HTG-VLDL or NTG-VLDL (20 µg/mL). Cell monolayers were washed twice in
Dulbecco’s PBS, and total RNA was extracted by a single-step method,
with the use of TRIzol reagent, according to the manufacturer’s
instructions.
Measurement of tPA mRNA Level by Reverse
Transcription–PCR
Total RNA (1 µg) in a 20 µL reaction mixture was
reverse-transcribed with M-MLV reverse transcriptase (200 U) for 10
minutes at room temperature, followed by 1 hour at 42°C, with
oligo(dT) used as a primer. The resulting cDNA (5 µL) was used as a
template, and a 234-bp segment of the tPA cDNA was amplified by use of
a 24-mer upstream primer (5'-GTCTGCTGTGCACCATCCCCCATC-3') identical to
positions 177 to 200 and a 24-mer downstream primer
(5'-TTGTCATCAATCTTGAATCCCATA-3') complementary to positions 400 to 377
of the human tPA mRNA.33 A 600-bp segment of an internal
standard, GAPDH cDNA, was simultaneously amplified by use
of a 24-mer upstream primer (5' CCACCCATGGCAAATTCCATGGCA 3') identical
to positions 212 to 235 and a 24-mer downstream primer (5'
TCTAGACGGCAGGTCAGGTCCACC 3') complementary to positions 809 to 786 of
the human GAPDH mRNA.34 Amplification was carried out in a
Techne Thermal Cycler PHC-3 for 28 cycles (1 cycle consisted of 94°C
for 45 seconds, 60°C for 45 seconds, and 72°C for 45 seconds). PCR
products were analyzed on a 1.2% agarose–ethidium bromide
gel. The gels were photographed, and the intensity of each tPA and
GAPDH mRNA band was measured by laser densitometric scanning with a
Molecular Dynamics Personal Densitometer and expressed as a relative
ratio of the GAPDH mRNA band intensity in each lane.
Fibrinolytic (Plasmin) Activity Assay
Surface-localized fibrinolytic activity was measured, with the
use of live confluent cultured HUVECs (passages 1 and 2), by the direct
conversion of EC-bound single-chain 125I-labeled
Glu-Pmg by receptor-bound tPA to 2-chain
125I-labeled plasmin and quantification of either
125I-labeled plasmin
Mr 20-kDa light chain or
Mr 60-kDa heavy chain formation, after
SDS-PAGE under reduced conditions, according to the method of Mussoni
et al,35 as modified in our
laboratory.4 13 Because early-passage (passages 1 and 2)
HUVECs do not synthesize urokinase, the results of this particular
assay are largely attributed to the effects of tPA.36
Postconfluent cultured HUVECs in 96-well plates (in triplicate) were
incubated at 37°C for 8 hours in the absence/presence of HTG-VLDL or
NTG-VLDL (20 µg/mL) in serum-free culture medium, followed by removal
of lipoproteins and further incubation in complete culture medium for
an additional 16 hours. The cultures were then washed (3 times) with
10 mmol/L HEPES and 0.1 mol/L sodium acetate, pH 7.4, containing
1% BSA (buffer A) and equilibrated with buffer A (50 µL per well) at
4°C for 20 minutes. 125I-labeled Glu-Pmg
(2 µmol/L) in buffer A containing 1000 kallikrein inhibiting
units per milliliter aprotinin (40 µL) was added to each well and
incubated at 4°C for 30 minutes. Culture plates were then placed in a
37°C water bath to initiate tPA-mediated conversion of HUVEC-bound
125I-labeled Glu-Pmg to
125I-labeled plasmin. After 10 minutes of
incubation, the reactions were stopped by the rapid addition of 40 µL
of hot (56°C) solubilizing buffer (4% SDS, 10% glycerol, and 0.2
mol/L Tris-HCl, pH 6.8). The total contents of each well were
analyzed by 0.1% SDS-PAGE under reducing conditions as
previously described.13 The amounts of
125I-labeled Mr
20-kDa light chain or Mr 60-kDa heavy chain
of plasmin generated were quantified by measuring the radioactivity
content in each band with the use of phosphorimaging
autoradiography (Molecular Dynamics Series 425F
PhosphorImager) in combination with ImageQuant software (Molecular
Dynamics), as described below.
SDS-PAGE and Quantitative Phosphorimaging Autoradiography
Reduced samples containing 125I-labeled
Glu-Pmg and 125I-labeled plasmin were
analyzed by SDS-PAGE with use of a 1.8x82x74-mm
polyacrylamide slab gel consisting of an upper 4% stacking gel
and a lower 5% to 12.5% gradient running gel, according to the method
of Laemmli.37 After electrophoresis, gels were dried and
exposed in phosphorimaging cassettes for 3 to 5 hours. The amount of
remaining 125I-labeled Glu-Pmg and newly
generated 125I-labeled
Mr 20-kDa plasmin light chain in each
individual gel was quantified by measuring the radioactivity content in
each band by phosphorimaging autoradiography with the
Molecular Dynamics Series 425F PhosphorImager in combination with
ImageQuant software. The radioactivity content in each band was then
converted to a plasmin concentration by comparing the radioactivity
content of each individual band with the radioactivity content of the
125I-labeled Mr
20-kDa plasmin light chain derived from a known amount of fully
converted 125I-labeled Glu-Pmg. A
125I-labeled plasmin standard was obtained by
complete activation of 125I-labeled Glu-Pmg (1.0
µg) in buffer A containing 1000 kallikrein inhibiting units per
milliliter aprotinin (minus BSA) by incubation with 2-chain uPA (2
IU/mL) for 1 hour at 37°C.13
Nuclear Transcription Run-On Assays
Nuclear run-on assays were carried out essentially as described
by Greenberg and Ziff.38 Briefly, postconfluent cultures
in T-75 tissue culture flasks (in duplicate) were incubated in the
absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL) for 8 hours at
37°C, followed by a wash with Dulbecco’s PBS. Cells were scraped
from the culture flasks and resuspended in NP-40 lysis buffer (0.001
mol/L EDTA, 0.0001 mol/L phenylmethylsulfonyl fluoride, 0.01
mol/L NaCl, 0.003 mol/L MgCl2,
10-6 mol/L antipain, 0.01 mol/L Tris-HCl, pH
7.4, and 0.5% [vol/vol] NP-40) and incubated on ice for 5 minutes.
Intact nuclei were pelleted by centrifugation
(1660g for 5 minutes at 4°C), washed once in NP-40 lysis
buffer, and resuspended in glycerol storage buffer (0.01 mol/L
Tris-HCl, pH 8.3, 0.0001 mol/L EDTA, 0.001 mol/L dithiothreitol, and
40% glycerol) at 6x106 nuclei per 100 µL and
snap-frozen in liquid nitrogen. Transcription reactions were carried
out by mixing the nuclei (100 µL) with an equal volume (100 µL) of
2x reaction buffer (0.03 mol/L Tris-HCl, pH 8, 0.0005 mol/L
MgCl2, 0.3 mol/L KCl, 25 U/mL placental RNase,
0.01 mol/L creatine phosphate, 20 U/mL creatine phosphokinase, 0.001
mol/L each ATP, CTP and GTP, 0.0001 mol/L phenylmethylsulfonyl
fluoride, and 0.0005 mol/L dithiothreitol) containing 100 µCi
of [-32P]UTP. After a 45-minute incubation
at 28°C ,the reactions were terminated by adding a solution of 0.01
mol/L Tris-HCl, pH 7.5, containing 7 mol/L urea, 2% sarkosyl, and 0.35
mol/L NaCl. DNA was sheared by passage through a syringe needle (21 and
25 gauge), and the 32P-labeled nuclear RNA was
isolated on a 5.7 mol/L CsCl gradient by
ultracentrifugation at 100 000g for 18
hours at 20°C and then hybridized with cDNAs for tPA and GAPDH
(constitutive control) immobilized on nitrocellulose
filters. Preparation of nitrocellulose filters containing the cDNAs,
hybridization, and washing of filters were carried out as previously
described.38 The radioactivity corresponding to each
individual filter was quantified by phosphorimaging
autoradiography with the Molecular Dynamics Series 425F
PhosphorImager in combination with ImageQuant software (Molecular
Dynamics).
Amplification 5' Promoter and Flanking Regions (2220-bp
Fragments) of the tPA Gene
A 2220-bp segment of the promoter and 5' flanking region of the
tPA gene containing the start site of transcription at +1 and the TATA
box at -24 to -29 were amplified by PCR as previously
described.39 The PCR was carried out with use of an
upstream primer (5'
CGATCGGTACCCCATTGTCACCTTATCAGCCTGCCC 3')
identical to positions 1473 to 1497 and downstream primer (5'
GATCAGATCTTCCTCGCAGAGGTTTCTCTCCAGC 3')
complementary to positions 3692 to 3668 of the human tPA
gene.33 Both these primers had a CGATC clamp and a
KpnI site in the upstream primer (underlined) and a
BglII site in the downstream primer (underlined) to aid in
the subsequent cloning into the luciferase reporter gene (luc,
pGL3-basic expression vector, Promega Corp). Detailed sequencing
analyses were carried out with duplicate PCR clones from single
PCR amplification of 8 individual (16 sequences) promoter fragments to
rule out errors due to PCR cloning or sequencing, as described
previously.39 Sequencing was carried out on both
strands by the UAB Automated DNA Sequencing Core Facility.
Construction of the tPA Promoter/Luc Construct
The amplified tPA promoter fragments (2.2 kb) were purified by
electrophoresis on 1% agarose, digested with KpnI and
BglII, and ligated into the KpnI/BglII
site of the luciferase reporter gene (GeneLight vector, pGL3-basic
expression vector). The ligation mixture was transformed into JM 109
competent cells to generate ptPA222/luc constructs. tPA/luc constructs
were purified by ultracentrifugation through a cesium
chloride/ethidium bromide gradient before
transfection.40 The tPA fragment in the plasmid
construct was sequenced on both strands by the UAB Automated DNA
Sequencing Core Facility for sequence verification. Sequences were
aligned and compared with published human tPA sequences33
by using the Genetics Computer Group sequence analysis software
provided by the UAB Biological Computing Resource Core Facility.
Transient Transfection of Cultured HUVECs With ptPA/luc and
Promoter and Measurement of Luciferase Activity
Transient transfection experiments were carried out with
semiconfluent (60% to 75%) subcultured HUVECs grown in 6-well
multiwell plates by use of lipofectamine, as we have previously
described with minor modifications.21 39 Briefly,
DNA-lipofectamine complexes were preformed for 45 minutes at
room temperature by use of 1 µg per well of DNA, 0.05 µg per well
internal control vector, a thymidine kinase promoter–driven Renilla
luciferase construct (pRL-TK), and 10 µg per well lipofectamine in
Opti-MEM-1 reduced serum medium, according to the manufacturer’s
instructions. Cultured HUVECs were transfected (in triplicate) with the
ptPA/luc constructs and cotransfected with pRL-TK (internal
control).41 42 Transfection mixtures were incubated in
Opti-MEM-1 reduced serum medium for 1 hour at 37°C. At the end of the
incubation, the medium was removed, and cultures were rinsed twice with
M199 and then incubated in fresh M199 containing 0.25% BSA for 18
hours in the absence/presence of HTG-VLDL or NTG-VLDL (20 µg/mL).
Finally, cultures were rinsed twice with Dulbecco’s PBS, lysed by the
addition of 200 µL lysis buffer (Dual-Luciferase kit, Promega), and
centrifuged at 16 000g for 1 minute, and the cell
supernatants were assayed for their dual luciferase activity (firefly
and Renilla) by use of the Dual-Luciferase Reporter Assay System
according to manufacturer’s instructions. Activities were measured,
and final luciferase activities were normalized to the corresponding
Renilla activities to correct for transfection efficiency.
Analysis of Data
All of the data were expressed as the mean±SD of triplicate
experiments performed in each assay and analyzed by the Student
t test. Data with P<0.05 were taken to
represent statistically significant differences in experimental
results.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Effect of tPA Antigen and mRNA Expression by HTG-VLDL Cultured HUVECs
Confluent cultured HUVECs were analyzed for their expression of tPA antigen and coincident mRNA levels in the absence/presence of HTG-VLDL or NTG-VLDL (control) at 0 to 50 µg/mL. tPA antigen levels showed a significant decrease in HTG-VLDL–treated HUVEC cultures compared with the NTG-VLDL–treated and culture medium control cells. After incubation for 24 hours in the absence/presence of these lipoproteins, secreted tPA antigens levels were decreased up to
53% in HTG-VLDL–treated HUVEC cultures compared with
NTG-VLDL–treated and culture medium control cells (Figure 1
). Interestingly, the relative changes
in tPA antigen between different doses of HTG-VLDL were small,
suggesting an all-or-none response at these levels of lipoprotein.
|
Simultaneous reverse transcription–PCR analysis of
these HUVEC cultures for their coincident expression of relative tPA
mRNA levels (tPA mRNA/GAPDH mRNA ratios) also indicated a decline in
steady-state levels of tPA after HTG-VLDL treatment. After incubation
for 8 hours in the presence of HTG-VLDL (20 µg/mL), tPA mRNA levels
decreased by 70% compared with baseline levels (Figure 2). In addition, after incubation for 8
hours, tPA mRNA levels decreased in the presence of HTG-VLDL (20
µg/mL) compared with NTG-VLDL or control medium (data not shown).
These studies were carried out in 16 separate experiments in which 3 or
4 different individual HUVEC cultures were pooled, examined, and
compared; similar results were obtained, providing strong evidence that
HTG-VLDL downregulates tPA expression.
|
Effect of HTG-VLDL on Fibrinolytic Activity in Cultured
HUVECs
tPA contributes to cell surface–localized fibrinolytic activity
by its ability to convert receptor-bound Pmg to plasmin. These
experiments were carried out to establish whether the decrease in tPA
levels induced by HTG-VLDL may additionally exert an
inhibitory effect on the net expression of cultured HUVEC
surface–localized fibrinolytic activity. Confluent cultured HUVECs
preincubated in the presence of HTG-VLDL (20 µg/mL), followed by
incubation with 125I-labeled Glu-Pmg, showed a
significant decrease (98%) in net expressed fibrinolytic activity
(2±2 pmol per well) compared with activity in NTG-VLDL–treated or
culture medium control cells (120±20 pmol per well), as seen in
Figure 3. As stated earlier, because
early-passage HUVECs do not synthesize urokinase, the results of this
particular assay are attributed largely to the effects of
tPA.36 These studies on the effects of HTG-VLDL
on fibrinolytic activity were repeated in 16 separate experiments that
used different pools of cultured HUVECs (in triplicate) with similar
results.
|
Effect of HTG-VLDL on tPA Gene Transcription Rates
Nuclear transcription run-on assays were carried out to establish
whether the observed decrease in tPA mRNA in response to HTG-VLDL was
due to an decrease in the rate of tPA transcription. Nuclei were
isolated from postconfluent cultured HUVECs (in
7500-mm2 flasks) and incubated in the
absence/presence of HTG-VLDL for 8 hours at 37°C. Newly synthesized
32P-labeled nuclear transcripts were hybridized
to tPA and GAPDH cDNAs immobilized on nylon membranes, and
the nuclear run-on assay results were measured by phosphorimaging
autoradiography. These results indicated
transcriptional repression of the tPA gene by HTG-VLDL, as evidenced by
a significant decrease (72%) in new
32P-labeled tPA mRNA (tPA mRNA/GAPDH mRNA ratio)
in the cultured HUVECs treated with HTG-VLDL compared with
NTG-VLDL–treated controls (Figure 4).
These assays were carried out in 6 separate experiments with at least 3
pooled different individual HUVEC cultures; similar results were
obtained.
|
Generation of ptPA/luc Promoter Construct and Transient
Transfection of Cultured HUVECs With the ptPA/luc Promoter
Construct
Because the present study demonstrated that HTG-VLDL but not
NTG-VLDL decreased tPA levels in cultured HUVECs and that this
repression occurred at the transcriptional level, we sought to further
confirm and localize this repression of tPA expression by HTG-VLDL; a
2220-bp segment of the tPA promoter and 5' flanking region, containing
the start +1 site as well as the TATA box, was PCR-amplified (Figure 5). This was followed by ligation into a
promoterless/enhancerless luciferase to generate the
promoter/luciferase construct (ptPA222luc) to be used in transient
transfection studies.
|
HUVEC cultures were transiently transfected with the ptPA222/luc
construct. The cells were concomitantly transfected with Renilla to
correct for differences in DNA uptake. The transfected cells were
subsequently incubated in the absence/presence of HTG-VLDL or NTG-VLDL
(20 µg/mL) for 18 hours, then harvested, and assayed for luciferase
and Renilla activity. Compared with NTG-VLDL or control medium,
HTG-VLDL decreased promoter activity (luciferase activity) 52% to
57% in the ptPA222/luc construct (Figure 6). In addition, no luciferase activity
was generated in the reverse orientation undeleted construct (negative
control).
|
Therefore, these results demonstrate that the 2.2-kb fragment of the promoter and 5' flanking region of the tPA gene contains the repressive sequences that direct the transcriptional downregulation of the tPA promoter.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The purpose of the present study was to examine the interrelationship between tPA expression and HTG-VLDL in a cultured HUVEC model system. We have demonstrated that HTG-VLDL, but not NTG-VLDL, decreases tPA antigen and mRNA expression and suppresses tPA-mediated fibrinolytic activity. In addition, nuclear transcription run-on assays in these studies demonstrate that HTG-VLDL downregulates tPA expression at the level of gene transcription. These findings complement previous in vitro and clinical observations. For example, it is known that other atherogenic lipoproteins decrease tPA secretion and tPA-mediated Pmg activation in cultured ECs8 10 43 and that compared with control subjects, patients with CAD and elevated Lp(a) levels have a marked reduction in their ability to release tPA in response to venous occlusion.1 Whether this type of regulation also occurs with HTG-VLDL would be of additional clinical importance given the association between HTG and atherosclerosis.
HTG-VLDL is known to transcriptionally regulate other fibrinolytic proteins. For example, prior studies in our laboratory have demonstrated that HTG-VLDL transcriptionally upregulates PAI-1 expression in a genotype-specific manner.29 In addition, Eriksson et al44 recently identified a VLDL response element in the PAI-1 promoter, which is located between -672 bp and -657 bp in the promoter region. However, to our knowledge, no description of regulatory elements in the tPA gene responsive to HTG-VLDL exists. In the present study, we add to the prior body of knowledge by reporting for the first time the transcriptional repression of tPA gene expression by HTG-VLDL. Our transient transfection studies with the ptPA222/luc construct indicate that the cis-repressive element(s), which specifically directs the transcriptional downregulation of the tPA gene by HTG-VLDL, is located within the PCR-amplified 2.2-kb region of the tPA promoter used in these studies.
Repression of gene expression may occur by transcriptional interference. This results when a transcription factor is blocked from successfully interacting with the transcription initiation complex through direct or indirect interactions with another factor. Transcriptional interference of the general transcription factor(s) has been observed for other fibrinolytic protein genes, including the urokinase gene.45 46 Whether this type of interference contributes to the observed repression of the tPA gene by HTG-VLDL is not known.
Additional studies to identify the specific site(s) of the HTG-VLDL repressive element(s) within the tPA promoter and HTG-VLDL inducible transcription/repressive factor(s) that binds to this region are in progress.
|
Acknowledgments |
|---|
This work was supported in part by National Institutes of Health grant HL-52791. We would like to thank the labor and delivery staff at AMI Brookwood Medical Center and University Hospital in Birmingham, Ala, for providing the umbilical cords used for the isolation of HUVECs used in these studies.
Received June 18, 1999; accepted February 21, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Hamsten A, Wiman B, de Faire V, Blomback M. Increased plasma levels of a rapid inhibitor of tissue plasminogen activator in young survivors of myocardial infarction. N Engl J Med. 1985;313:1557–1563.[Abstract]
2. Wiman B, Hamsten A. The fibrinolytic enzyme system and its role in the etiology of thromboembolic disease. Semin Thromb Hemost. 1990;16:207–216.[Medline] [Order article via Infotrieve]
3.
Raghunath PN, Tomaszewski JE, Brady ST, Caron RJ,
Okada SS, Barnathan ES. Plasminogen
activator system in human coronary
atherosclerosis. Arterioscler Thromb Vasc
Biol. 1995;15:1432–1443.
4.
Li XN, Varma VK, Parks JM, Benza RL, Koons JC, Grammer
JR, Grenett HE, Tabengwa EM, Booyse FM. Thrombin decreases the
urokinase receptor and surface-localized fibrinolysis
in cultured endothelial cells. Arterioscler
Thromb Vasc Biol. 1995;15:410–419.
5.
Haddock RC, Baker CD, Grammer JR, Parks JM, Speidel
MT, Spell ML, Booyse FM. Urokinase binding and receptor identification
in cultured endothelial cells. J Biol
Chem. 1991;266:21466–21473.
6.
Williams JK, Bellinger DA, Nichols TC, Griggs TR,
Bumol TF, Fouts RL, Clarkson TB. Occlusive arterial
thrombosis in cynomolgus monkeys with varying plasma concentrations of
lipoprotein(a). Arterioscler Thromb. 1993;13:548–554.
7.
Latron Y, Chautan M, Anfosso F, Alessi MC, Nalbone G,
Lafont H, Juhan-Vague I. Stimulating effect of oxidized low density
lipoproteins on plasminogen activator
inhibitor-1 synthesis by endothelial cells.
Arterioscler Thromb. 1991;11:1821–1829.
8.
Kugiyama K, Sakamoto T, Misumi I, Sugiyama S, Ohgushi
M, Ogawa H, Horiguchi M, Yasue H. Transferable lipids in oxidized
low-density lipoprotein stimulate plasminogen
activator inhibitor-1 and inhibit tissue-type
plasminogen activator release from
endothelial cells. Circ Res. 1993;73:335–343.
9.
Tremoli E, Camera M, Maderna P, Sironi L, Prati L,
Colli S, Piovella F, Bernini F, Corsini A, Mussoni L. Increased
synthesis of plasminogen activator
inhibitor-1 by cultured human endothelial
cells exposed to native and modified LDLs: an LDL receptor–independent
phenomenon. Arterioscler Thromb. 1993;13:338–346.
10.
Levin EG, Miles LA, Fless GM, Scanu AM, Baynham P,
Curtiss LK, Plow EF. Lipoproteins inhibit the secretion of tissue
plasminogen activator from human
endothelial cells. Arterioscler Thromb. 1994;14:438–442.
11.
Stiko-Rahm A, Wiman B, Hamsten A, Nilsson J. Secretion
of plasminogen activator
inhibitor-1 from cultured human umbilical vein
endothelial cells is induced by very low density
lipoproteins. Arteriosclerosis. 1990;10:1067–1073.
12.
Mussoni L, Mannucci L, Sirtori M, Camera M, Maderna P,
Sironi L, Tremoli E. Hypertriglyceridemia
and regulation of fibrinolytic activity. Arterioscler
Thromb. 1992;12:19–27.
13. Li XN, Koons JC, Benza RL, Parks JM, Varma VK, Bradley WA, Gianturco SH, Taylor KB, Grammer JR, Tabengwa EM, Booyse FM. Hypertriglyceridemic VLDL decreases plasminogen binding to endothelial cells and surface-localized fibrinolysis. Biochemistry. 1996;35:6080–6088.[Medline] [Order article via Infotrieve]
14. Li XN, Grenett HE, Benza RL, Bradley WA, Gianturco SH, Grammer JR, Tabengwa EM, Gay CP, Booyse FM. Genotype-specific regulation of PAI-1 expression by hypertriglyceridemic VLDL in PAI-1 genotyped cultured human endothelial cell types. Circulation. 1995;92(suppl I):I-694. Abstract.
15.
Gianturco SH, Gotto AM, Hwang SC, Karlin JB, Lin A.
Apolipoprotein E mediates uptake of Sf 100–400
hypertriglyceridemic very low density
lipoproteins by the low density lipoprotein receptor pathway in normal
human fibroblasts. J Biol Chem. 1983;258:4526–4533.
16. Juhan-Vague I, Alessi MC. Plasminogen activator inhibitor 1 and atherothrombosis. Thromb Haemost. 1993;70:138–143.[Medline] [Order article via Infotrieve]
17.
Padro T, Emeis JJ, Steins M, Schmid KW, Kienast J.
Quantification of plasminogen activators and
their inhibitors in the aortic vessel wall in relation to
the presence and severity of atherosclerotic disease.
Arterioscler Thromb Vasc Biol. 1995;15:893–902.
18. Reilly JM, Sicard GA, Lucore CL. Abnormal expression of plasminogen activators in aortic aneurysmal and occlusive disease. J Vasc Surg. 1994;19:865–872.[Medline] [Order article via Infotrieve]
19. Hayakawa Y, Tazawa S, Ishikawa T, Niiya K, Sakuragawa N. Transcriptional regulation of tissue- and urokinase-type plasminogen activator genes by thrombin in human fetal lung fibroblasts. Thromb Haemost. 1995;74:704–710.[Medline] [Order article via Infotrieve]
20.
Medcalf RL, Ruegg M, Schleuning WD. A DNA motif related
to the cAMP-responsive element and an exon-located
activator protein-2 binding site in the human tissue-type
plasminogen activator gene promoter cooperate
in basal expression and convey activation by phorbol ester and cAMP.
J Biol Chem. 1990;265:14618–14626.
21. Grenett HE, Torres JA, Demissie S, Tabengwa EM, Davis GC, Booyse FM. Ethanol transcriptionally upregulates t-PA and u-PA gene expression in cultured human endothelial cells. Alcohol Clin Exp Res. 1998;22:849–853.[Medline] [Order article via Infotrieve]
22.
Medcalf RL, Schleuning WD. Regulation of human
tissue-type plasminogen activator gene
transcription by epidermal growth factor and 3',5'-cyclic
adenosine monophosphate. Mol Endocrinol. 1991;5:1773–1779.
23.
Maciag T, Cerundolo J, Ilsley S, Kelley PR, Forand R.
An endothelial cell growth factor from bovine
hypothalamus: identification and partial characterization. Proc
Natl Acad Sci U S A. 1979;76:5674–5678.
24. Gianturco SH, Bradley WA. The role of apolipoprotein processing in receptor recognition of VLDL. In: Albers JJ, Segrest JP, eds. Methods in Enzymology. New York, NY: Academic Press; 1986:319–344.
25. Fredrickson DS, Goldstein JL, Brown MS. The familial hyperlipoproteinemias. In: Stanbury JG, Wyngaarden MF., Fredrickson DS, eds. The Metabolic Basis of Inherited Diseases. New York, NY: McGraw-Hill; 1978:604–655.
26. Lindgren FT, Jensen LC, Hatch FT. The isolation and quantitative analysis of serum lipoproteins in blood lipids and lipoproteins. In: Nelson GJ, ed. Blood Lipids and Lipoproteins. New York, NY: Wiley Interscience; 1972:181–274.
27. Gianturco SH, Ramprasad MP, Lin A, Song R, Bradley WA. Cellular binding site and membrane binding proteins for triglyceride-rich lipoproteins in human monocyte-macrophages and THP-1 monocytic cells. J Lipid Res. 1994;35:1674–1687.[Abstract]
28.
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein
measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265–275.
29.
Li XN, Grenett HE, Benza RL, Demissie S, Brown SL,
Tabengwa EM, Bradley WA, Gianturco SH, Fless GM, Booyse FM.
Genotype-specific transcriptional regulation of PAI-1
expression by hypertriglyceridemic
(HTG)-VLDL and Lp(a) in cultured human endothelial
cells. Arterioscler Thromb Vasc Biol. 1997;17:3215–3223.
30.
Booyse FM, Quarfoot AJ, Chediak J, Stemerman MB, Maciag
T. Characterization and properties of cultured human von
Willebrand umbilical vein endothelial cells.
Blood. 1981;58:788–796.
31.
Voyta JC, Via DP, Butterfield CE, Zetter BR.
Identification and isolation of endothelial cells based
on their increased uptake of acetylated-low density
lipoprotein. J Cell Biol. 1984;99:2034–2040.
32. Jaffe EA, Nachman RL, Becker CG, Minick CR. Culture of human endothelial cells derived from umbilical veins: identification by morphologic and immunologic criteria. J Clin Invest. 1973;52:2745–2756.
33.
Degen SJF, Rajput B, Reich E. The human tissue
plasminogen activator gene. J Biol
Chem. 1986;261:6972–6985.
34.
Tso JY, Sun X, Kao T, Reece KS, Wu R. Isolation and
characterization of rat and human
glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic
complexity and molecular evolution of the gene. Nucleic Acids
Res. 1985;13:2485–2502.
35. Mussoni L, Lawrence D, Loskutoff DJ. A direct, plasmin-independent assay for plasminogen activator. Thromb Res. 1984;34:241–254.[Medline] [Order article via Infotrieve]
36.
Booyse FM, Scheinbuks J, Lin P, Traylor M, Bruce R.
Isolation and interrelationships of the multiple molecular tissue-type
and urokinase-type plasminogen activator forms
produced by cultured human umbilical vein endothelial
cells. J Biol Chem. 1988;263:15129–15138.
37. Laemmili UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 1970;227:680–685.[Medline] [Order article via Infotrieve]
38. Greenberg ME, Ziff EB. Stimulation of 3T3 cells induces transcription of the c-fos proto-oncogene. Nature. 1984;311:433–438.[Medline] [Order article via Infotrieve]
39.
Grenett HE, Benza RL, Fless GM, Li XN, Davis GC, Booyse
FM. Genotype-specific transcriptional regulation of PAI-1 gene
expression by insulin, hypertriglyceridemic
VLDL, and Lp(a) in transfected cultured human
endothelial cells. Arterioscler Thromb Vasc
Biol. 1998;18:1803–1809.
40. Maniatis T, Fritsch EF, Sambrook J. Plasmid vectors. In: Irwin N, Ford N, Nolan C, Ferguson M, Ockler M, eds. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1982:1.38–1.39.
41. Lorenz WW, Cormier MJ, O’Kane DJ, Hua D, Escher AA, Szalay AA. Expression of the Renilla reniformis luciferase gene in mammalian cells. J Biolumin Chemilumin. 1996;11:31–37.[Medline] [Order article via Infotrieve]
42.
Farr A, Roman A. A pitfall of using a second plasmid to
determine transfection efficiency. Nucleic Acids Res. 1992;20:920.
43. Pekalharing HL, Kleinveld HA, Duif PF, Bouma BN, van Rijn HJ. Effect of lipoprotein(a) and LDL on plasminogen binding to extracellular matrix and on matrix-dependent plasminogen activation by tissue plasminogen activator. Thromb Haemost. 1996;75:497–502.[Medline] [Order article via Infotrieve]
44.
Eriksson P, Nilsson L, Karpe F, Hamsten A.
Very-low-density lipoprotein response element in the promoter region of
the human plasminogen activator
inhibitor-1 gene implicated in the impaired
fibrinolysis of
hypertriglyceridemia. Arterioscler
Thromb Vasc Biol. 1998;18:20–26.
45. De Cesare D, Vallone D, Caracciolo A, Sassone-Corsi P, Nerlov C, Verde P. Heterodimerization of c-Jun with ATF-2 and c-Fos is required for positive and negative regulation of the human urokinase enhancer. Oncogene. 1995;11:365–376.[Medline] [Order article via Infotrieve]
46. Nerlov D, De Cesare D, Pergola F, Caracciolo A, Blasi F, Johnsen M, Verde P. A regulatory element that mediates co-operation between a PEA3-AP-1 element and an AP-1 site is required for phorbol ester induction of urokinase enhancer activity in HepG2 hepatoma cells. EMBO J. 1992;11:4573–4582.[Medline] [Order article via Infotrieve]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||