This Article Abstract Full Text (PDF) Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Leviev, I. Articles by James, R. W. Search for Related Content PubMed PubMed Citation Articles by Leviev, I. Articles by James, R. W. Related Collections Pathophysiology Risk Factors Genetics of cardiovascular disease Lipid and lipoprotein metabolism

(Arteriosclerosis, Thrombosis, and Vascular Biology. 2000;20:516.)
© 2000 American Heart Association, Inc.

Atherosclerosis and Lipoproteins

Promoter Polymorphisms of Human Paraoxonase PON1 Gene and Serum Paraoxonase Activities and Concentrations

Ilia Leviev; Richard W. James

From the Clinical Diabetes Unit, Division of Endocrinology and Diabetology, University Hospital, Geneva, Switzerland.

Correspondence to Richard W. James, Clinical Diabetes Unit, Division of Endocrinology and Diabetology, University Hospital, 1211 Geneva 14, Switzerland. E-mail Richard.James{at}hcuge.ch

	Abstract

Top Abstract Introduction Methods Results Discussion References

 
Abstract—Paraoxonase (PON) is a serum enzyme with a wide species distribution. It protects lipoproteins from toxic oxidative modifications and is an antiatherogenic mechanism of major potential. Activity levels of PON are major determinants of the protective function; consequently, factors that influence PON levels are of particular relevance. The present study has identified 3 polymorphisms in the promoter region of the human PON1 gene. Cell transfection studies have revealed their variable impact on promoter activity, with up to 2-fold differences in reporter gene expression. Genotyping studies have established that the polymorphisms are frequent in the population, a finding that is consistent with a major impact on PON concentrations. The physiological relevance of the polymorphisms was underlined by showing that they are associated with highly significant differences in serum concentrations and activities of PON. The study thus firmly establishes a genetic basis for variations in serum PON levels and, consequently, serum PON activity. It is consistent with the suggestion that variations in a major antioxidant function of high density lipoprotein are, to an important degree, genetically determined.

Key Words: HDL • atherosclerosis • oxidative stress • gene expression

	Introduction

Top Abstract Introduction Methods Results Discussion References

 
Paraoxonase (PON) is a human serum enzyme entirely complexed to HDLs.¹ Clinical interest in the enzyme was initially derived from its ability to neutralize highly toxic, exogenous derivatives (eg, pesticides and nerve gases² ). More recently, it has been hypothesized that PON fulfills an analogous role, that of protecting lipids from toxic oxidative modifications.^{3 4} Because the latter constitutes the principal atherogenic modification of serum LDLs, the ability of PON to limit oxidation represents a major antiatherogenic mechanism, and a growing body of data supports that contention.^{3 4 5 6} In particular, these data have demonstrated that the PON content of HDL is a major determinant of the antioxidant function and, consequently, the anti-inflammatory capacity of the lipoprotein.^{2 7 8} Factors that influence PON levels are thus of major consideration for the efficacy of its protective function.

There are substantial interindividual variations in serum PON concentrations that cannot be fully explained by known, coding region polymorphisms.^{2 9} We have recently demonstrated an association of serum concentrations with a polymorphism at amino acid 54 of the coding region.⁹ In complementary studies, we have observed differences in the levels of hepatic mRNA arising from the PON1 alleles defined by the L54M mutation.¹⁰ This implicates gene expression as a major source of variations in serum PON activities and concentrations.

The present study examined the hypothesis that polymorphisms are present in the promoter region of the human PON1 gene and are implicated in variations in serum PON levels. We report the identification of 3 polymorphisms, which have been characterized with respect to their influence on promoter activity. The physiological relevance of the polymorphisms was analyzed by studying their association with serum concentrations and activities of PON. Finally, their association with PON polymorphisms in the coding region of the gene has been determined.

	Methods

Top Abstract Introduction Methods Results Discussion References

 
Amplifying and Cloning the PON1 Gene Promoter Region
In initial studies, the DNA region upstream from the PON1 gene was amplified with the Genome Walker kit (Clontech) by using antisense primers I (ATCCGGATCCGGGGATAGACAAAGGGATCGATG) and II (AGAGTGCCAGTCCCATCCCCAAGAG). By use of the SspI library, a 1100-bp fragment was obtained. After sequencing this fragment, a third primer was designed (primer III, AAAACGCGTCCCACCTCCACCATTGGGGAAAACGCGTCAGATATTCCAGAAGAGAGAAGG), and primers I and III were used to amplify a 1027-bp fragment upstream from the PON1 gene coding region. Polymerase chain reaction (PCR) conditions were as follows: 94°C for 3 minutes, followed by 30 cycles of 94°C for 30 seconds, 55°C for 1 minute, and 72°C for 3 minutes. PCR products were digested with MluI and BamHI (sites incorporated via the PCR primers) and cloned into MluI/BglII-digested plasmid. Cloned PCR products were sequenced by use of the ^T7Sequencing kit (Pharmacia).

Screening for PON Promoter Polymorphisms
Analysis of Position T(-107)C
Hybridization with allele-specific oligonucleotides was used to analyze polymorphisms at the T(-107)C position (Figure 2). PCR-amplified fragments of the promoter region were loaded onto a nylon membrane (Porablot NYamp, Macherey-Nagel) and hybridized either with oligonucleotide IV (CCGCCCCACCCCTCCC), which is specific for nucleotide T at -107, or with oligonucleotide V (GGGAGGGGCGGGGCGG), which is specific for nucleotide C at -107. With oligonucleotide IV, hybridization was performed at 37°C, followed by 2 washes with 2x SSC/0.1% SDS at room temperature. With oligonucleotide V, hybridization was performed at 54°C, followed by 2 washes with 2x SSC/0.1% SDS at room temperature and 1 high-stringency wash with 1x SSC/0.1% SDS at 60°C.

View larger version (53K): [in this window] [in a new window]   Figure 2. Hybridization with allele-specific oligonucleotides of PCR-amplified promoter region sequences. A, Determination of variable nucleotides at position G(-824)A: left; hybridized with A-specific oligonucleotide VI; right, hybridized with G-specific oligonucleotide VII. B, Determination of variable nucleotides at position T(-107)C; left; hybridized with C-specific oligonucleotide V; right, hybridized with T-specific oligonucleotide IV. Genotypes are indicated below blots.

Analysis of Position G(-824)A
Hybridization with allele-specific oligonucleotides was also used to analyze the polymorphism at position -824 (Figure 2). Allele-specific oligonucleotides were VI (TGACTGCTATTCTTCAG), which is specific for nucleotide A at -824, and VII (CTGAAGAACAGCAGTCA), which is specific for nucleotide G at -824. Hybridization was performed at 44°C and was followed by 2 washes with 2x SSC/0.1% SDS at room temperature and 2 washes with 0.1x SSC/0.1% SDS at room temperature.

Analysis of Position G(-907)C
Allele-specific PCR was used to analyze this position. The sense allele-specific primers were VIII (CAGCAGACAGCAGAGAAGAGAC), which is specific for nucleotide C at -907, and IX (CAGCAGACAGCAGAGAAGAGAG), which is specific for nucleotide G at -907. The opposing antisense primer was primer I. PCR conditions were as described above, except that the annealing temperature was 62°C. Taq polymerase and Q solution from Qiagen were used in reactions.

For all oligonucleotides, hybridization was performed in ExpressHyb solution (Clontech) for 1.5 hours in the presence of 1 pmol/mL of ³³P-labeled oligonucleotide.

Reporter Gene Vector, Cell Transfection, and Cell Culture
DNA fragments (1027 bp) from individuals who differed in PON1 promoter structure were obtained by PCR amplification with the use of primers I and III of the chromosomal DNA region adjacent to the PON1 open reading frame. Fragments were digested with MluI and BamHI (restriction sites within the PCR primers) and inserted before the firefly luciferase reporter gene in the pGL2Basic (Promega) derivative. Cloned fragments were completely sequenced to ensure (1) the absence of any nucleotide variations different from those described in the present report and (2) that promoter sequences that were paired in transfection studies (Figure 3) differed only in the single nucleotide position under study. Renilla luciferase gene from plasmid pRLSV40 (Promega) was used as control for transfection efficiency. The vectors were transfected into the hepatoma cell line Hep G2 at 50% confluence by using 5 µg of DNA and 15 µL of the transfection agent SuperFect (Qiagen). Transfected cells were grown for 24 hours after transfection before being harvested for analysis of firefly and Renilla luciferase activities by use of the Dual Luciferase Reporter Assay kit (Promega).

View larger version (24K): [in this window] [in a new window]   Figure 3. Influence of polymorphisms on activity of PON1 promoter. Paired DNA fragments differed by a single nucleotide (indicated below figure). The position of the variable nucleotide was T(-107)C (A), G(-824)A (B), and G(-907)C (C). Activities were standardized to control (Renilla luciferase) activity. Within each pair, the activity of the stronger variant was expressed relative to that of the weaker variant, which was attributed a value of 1.0 (mean±SD of 4 experiments).

The Hep G2 cell line was obtained from the European collection of cell cultures. The cells were grown in DMEM containing 10% fetal calf serum (GIBCO).

PON Activities and Mass Concentrations
PON enzymatic activities were assayed in human serum samples as described previously¹¹ by using both phenylacetate and paraoxon as substrates. A control pool of human sera, independently calibrated by Dr M. Mackness (University of Manchester, School of Medicine, Manchester, UK), was used to standardize activity assays. Mass measurements were performed by a competitive ELISA, as described previously in detail.¹¹

Genotyping of PON Coding Region Polymorphisms
DNA was extracted from blood cells, and the coding region polymorphisms L54M and Q191R were determined by restriction isotyping.⁹

Study Populations
The study population (n=374; 184 men and 190 women, mean age 47.9±0.72 years) consisted of volunteers from the medical research and the University Hospital, Geneva, Switzerland. They were in good health according to their answers to a short questionnaire and were not undergoing any medical treatment or taking any medication for chronic disease, notably cardiovascular disease and diabetes. Participants gave a fasting blood sample. Mean serum lipid levels were within clinically acceptable limits: cholesterol 5.50±1.0 mmol/L, triglycerides 1.18±0.61 mmol/L, and HDL cholesterol 1.23±0.32 mmol/L. The study was approved by the ethics commission of the medical faculty, University of Geneva.

Statistical Analyses
Continuous clinical and biological variables were analyzed by 1-way ANOVA. Categorical variables were compared between groups by the ² test and crude odds ratio. Allele frequencies were estimated by the gene-counting method, and Hardy-Weinberg equilibrium was tested by the ² test.

	Results

Top Abstract Introduction Methods Results Discussion References

 
Polymorphisms Exist in Promoter Region of Human PON1 Gene
From an initial sample of 100 subjects, which had been characterized with respect to serum PON activities and concentrations, samples with low, medium, and high concentrations of PON were selected on the rationale that the concentration level may reflect differences in gene expression. Amplified DNA upstream from the PON open reading frame was sequenced and revealed 3 polymorphic sites at nucleotide positions -107 (C or T), -824 (A or G), and -907 (C or G) (Figure 1). The numbering is with respect to the A of the PON1 initiation codon, which was assigned the value 0. The complete sequence of the region is accessible at Genbank, accession number AF051133. No other polymorphisms were detected in 100 samples analyzed by sequencing. Genotyping procedures were developed to analyze the promoter polymorphisms in the whole population (Figure 2). The distributions of the genotypes for the 3 promoter polymorphisms are shown in Table 1. In preliminary studies, genotype frequencies were compared in subjects aged <40 years (n=124) and >40 years (n=250). These were not found to be significantly different. The analysis revealed a strong association between the 3 polymorphisms (for -107x-907, ²=185.5, P<0.0001; for -107x-824, ²=133.5, P<0.0001; and for -824x-907, ²=97.8, P<0.0001). A strong association was also observed between the promoter polymorphisms and the polymorphism influencing amino acid 54 of the PON1 gene coding region (for -107, ²=31.7, P<0.0001; for -824, ²=21.7, P<0.0005; and for -907, ²=39.9, P<0.0001) but not with polymorphism 191.

View larger version (42K): [in this window] [in a new window]   Figure 1. Polymorphic sequences within the 5' region of the PON1 gene. The polymorphic nucleotides are shown in bold type, and their positions are indicated with arrows. Numbering is determined by the PON initiation codon (to the right). Distances between the indicated nucleotide sequences are given in italics. The possible binding site for the transcription factor Sp1 is framed.

View this table: [in this window] [in a new window]   Table 1. Genotype Frequencies of PON Promoter Polymorphisms

Promoter Polymorphisms Are Associated With Modulated Gene Expression
The influence of the polymorphisms on gene expression was examined by using reporter gene constructs. These indicated strong independent impacts of 2 polymorphisms on transcriptional activity of the PON1 promoter (Figure 3). The -107C variant had 2 times higher activity than did the -107T variant (P<0.05), whereas the -824A polymorphism was 1.7 times more active than the -824G polymorphism (Figure 3B, P<0.05). This is in agreement with the observed higher serum activities and concentrations of PON associated with the -107C and -824A polymorphisms (see below). No significant differences in gene expression were noted when the -907C and -907G variants were analyzed (Figure 3C). Further studies are necessary to determine whether there are interactions between promoter polymorphisms with respect to gene expression and to define what other factors, both genetic and nongenetic,¹⁰ influence serum concentrations of PON. A minimum conclusion from these studies is that the promoter polymorphisms strongly influence gene expression.

Promoter Polymorphisms Are Associated With Variations in Serum PON Concentrations and Activities
Table 2 shows the PON concentrations and activities (with the nondiscriminatory substrate phenylacetate) as a function of the different polymorphisms. There were highly significant variations in serum concentrations and activities of PON as a function of all 3 promoter polymorphisms. Thus, -107T, -824G, and -907C were associated with lower serum PON levels, whereas -107C, -824A, and -907G were correlated with the highest concentrations and activities. A gene dose effect is also evident, with heterozygotes having intermediate values. Given the strong association between the promoter polymorphisms and the data on reporter gene expression, it remains to be determined to what extent each polymorphic site contributes to variations in enzyme levels (see below).

View this table: [in this window] [in a new window]   Table 2. PON Mass Concentrations and Enzymatic Activities as a Function of Promoter and Coding Region Mutations

Table 3 shows the results of stepwise multiple regression analysis of the different parameters that could influence serum concentrations of PON. Model A was limited to PON1 gene polymorphisms. It shows that the T(-107)C polymorphism has a predominant effect, accounting for 24.7% of the variation in serum concentrations of PON. The G(-907)C polymorphism was also implicated but did not reach statistical significance (P=0.07). Interestingly, the coding region polymorphism affecting amino acid 54 also made a significant contribution to variations in serum PON concentrations (4.4% of the variation), whereas no significant contribution was observed for the coding region Q191R polymorphism. The PON1 gene polymorphisms accounted for 29.1% of the variations in serum PON levels. Model B introduced other parameters, notably serum lipids, into the analysis. They did not modulate the associations of the T(-107)C and L54M mutations with serum PON, but in this model, the association with the G(-907)C polymorphism was also significant. In addition, HDL cholesterol, triglycerides, sex, and age were independently associated with variations in serum concentrations of PON. Model B accounted for 37.7% of the variation in serum PON levels.

View this table: [in this window] [in a new window]   Table 3. Parameters Associated With Variations in Serum Concentrations of PON

	Discussion

Top Abstract Introduction Methods Results Discussion References

 
The present study has identified 3 common polymorphisms in the promoter region of the human PON1 gene. Transfection studies demonstrated that they have an important impact on promoter activity, with up to 2-fold differences in reporter gene expression between polymorphisms. The physiological relevance of the polymorphisms was highlighted by showing that they are associated with highly significant differences in serum concentrations and enzymatic activities of PON. The study thus firmly establishes a genetic basis for variations in serum PON levels and, consequently, serum PON activity. The physiological aspects of these polymorphisms are important. It has recently been established that the PON content of HDL is a major determinant of the antioxidant capacity of the lipoprotein.^{5 7 8} Our results suggest that this antioxidant function of HDL is, at least in part, genetically determined.

The T(-107)C polymorphic site appears to have a dominant effect on expression of the PON1 gene, with a minor contribution from the G(-907)C polymorphic site. We are presently examining the promoter sequence for possible transcription sites. The polymorphic position T(-107)C lies within the GGCGGG (the polymorphic site is italicized) consensus sequence of the binding site for the transcription factor Sp1.¹² Mutations within this site have been previously shown to affect the promoter activity of other sites.^{13 14}

In a previous study, we reported a significant association between the coding region L54M mutation and serum PON levels.⁹ The present study clarifies this point. It is, in part, due to the strong association with the promoter polymorphisms. However, this link does not explain completely the association of L54M with serum PON concentrations, which remained significant in the model containing the promoter polymorphisms. Thus, when we analyzed samples from subjects with the same T(-107)C genotype (eg, TT homozygotes), there remained a significant difference in PON concentrations between subjects who were homozygous LL (88.5±21.2 mg/mL, n=23) or MM (78.2±17.5 mg/mL, n=33; by ANOVA, P<0.05) for the L54M mutation. The observation is intriguing because the methionine-leucine difference at position 54 represents a conservative amino acid exchange. One possibility is that the latter could nevertheless affect either protein stability or the association of PON with HDL, the serum transport vector for the enzyme.

A second important implication of the present study relates to the association of the PON1 gene with the risk of vascular disease. Several studies have identified PON as an independent genetic risk factor for coronary disease,^{9 15 16 17 18 19 20} although there is no complete agreement on this point.^{21 22} These studies relate to the coding region polymorphisms L54M and Q191R. The ability of the promoter polymorphisms to modulate serum concentrations of the enzymes to an important degree suggests that they could influence the association between the coding region mutations of the PON1 gene and risk of disease. We are presently investigating this hypothesis. In this respect, it should be noted that polymorphisms affecting the Sp1 site have previously been shown to have particularly marked clinical consequences.^{23 24} A second possibility is that the promoter polymorphisms could be a confounding factor in the discordant results concerning the role of PON as a genetic risk factor. We are also studying this possibility.

Finally, it should be emphasized that observations involving PON also have implications in the toxicology field. Studies in animal models have clearly demonstrated that serum PON activity is protective against certain environmental poisons derived from organophosphates.^{2 25 26} In humans, the activity of the polymorphism arising from the Q191R coding region mutation undoubtedly has a major impact on susceptibility to these compounds. However, within subjects homozygous for Q191R alleles, there remains a considerable range of enzymatic activities,^{27 28} which will modulate susceptibility to poisoning. The present study indicates that in this case there is also a strong genetic influence.

	Acknowledgments

 
This study was supported by grants from the Swiss National Science Foundation (Nos. 32-40292.94 and 31-453731.98), the Swiss Cardiology Foundation, the Stanley Thomas Johnson Foundation, and the AR&J Leenaards Foundation. The technical expertise of Marie-Claude Meynet Brulhart, Barbara Kalix, Silvana Bioletto, and Katia Galan was greatly appreciated. Particular thanks go to Prof A. Morabia for continual help with statistical analyses and Profs S. Antonarakis and M. Morris for advice on the analysis of genotype linkage.

Received May 25, 1999; accepted June 25, 1999.

	References

Top Abstract Introduction Methods Results Discussion References

 
1. Blatter M-C, James RW, Messmer S, Barja F, Pometta D. Identification of a distinct human high-density lipoprotein subspecies defined by a lipoprotein-associated protein, K-45: identity of K-45 with paraoxonase. Eur J Biochem. 1993;211:871–879.[Medline] [Order article via Infotrieve]

2. La Du BN. Human serum paraoxonase/arylesterase. In: Kalow W, ed. Pharmacogenetics of Drug Metabolism. New York, NY: Pergamon Press; 1992:51–91.

3. Mackness MI, Arrol S, Abbot C, Durrington PN. Protection of low-density lipoprotein against oxidative modification by high-density lipoprotein associated paraoxonase. Atherosclerosis. 1993;104:129–135.[Medline] [Order article via Infotrieve]

4. Watson AD, Berliner JA, Hama SY, La Du BN, Faull KF, Fogelman AM, Navab M. Protective effect of high density lipoprotein associated paraoxonase: inhibition of the biological activity of minimally oxidized low density lipoprotein. J Clin Invest. 1995;96:2882–2891.

5. Aviram M, Rosenblat M, Bisgaier CL, Newton RS, Primo-Parma SL, La Du BN. Paraoxonase inhibits high-density lipoprotein oxidation and preserves its functions: a possible peroxidative role for paraoxonase. J Clin Invest. 1998;101:1581–1590.[Medline] [Order article via Infotrieve]

6. Shih DM, Gu L, Xia Y-R, Navab M, Li W-F, Hama S, Castellani LW, Furlong CE, Costa LG, Fogelman AM, Lusis AJ. Mice lacking serum paraoxonase are susceptible to organophosphate toxicity and atherosclerosis. Nature. 1998;394:284–287.[Medline] [Order article via Infotrieve]

7. Van Lenten BJ, Hama SY, de Beer FC, Stafforini DM, McIntyre TM, Prescott SM, La Du BN, Fogelman AM, Navab M. Anti-inflammatory HDL becomes pro-inflammatory during the acute phase response. J Clin Invest. 1995;96:2758–2767.

8. Shih DM, Gu L, Hama S, Xia Y-R, Navab M, Fogelman AM, Lusis AJ. Genetic-dietary regulation of serum paraoxonase expression and its role in atherogenesis in a mouse model. J Clin Invest. 1996;97:1630–1639.[Medline] [Order article via Infotrieve]

9. Blatter Garin M-C, James RW, Dussoix P, Blanché H, Passa P, Froguel P, Ruiz J. Paraoxonase polymorphism Met-Leu54 is associated with modified serum concentrations of the enzyme: a possible link between the paraoxonase gene and increased risk of cardiovascular disease in diabetes. J Clin Invest. 1997;99:62–66.[Medline] [Order article via Infotrieve]

10. Leviev I, Negro F, James RW. Two alleles of the human paraoxonase gene produce different amounts of mRNA: an explanation for differences in serum concentrations of paraoxonase associated with the (Leu-Met54) polymorphism. Arterioscler Thromb Vasc Biol. 1997;17:3935–3939.

11. Blatter Garin M-C, Abbot C, Messmer S, Mackness MI, Durrington P, Pometta D, James RW. Quantification of human serum paraoxonase by enzyme-linked immunoassay: population differences in protein concentrations. Biochem J. 1994;304:549–554.

12. Kadonaga JT, Carner KR, Masiarz FR, Tjian R. Isolation of cDNA encoding transcription factor Sp1 and functional analysis of the DNA binding domain. Cell. 1987;51:1079–1090.[Medline] [Order article via Infotrieve]

13. Saikawa Y, Price K, Hance KW, Chen TY, Elwood PC. Structural and functional analysis of the human KB cell folate receptor gene P4 promoter: cooperation of 3 clustered Sp1-binding sites with the initiator region for basal promoter activity. Biochemistry. 1995;34:9951–9961.[Medline] [Order article via Infotrieve]

14. Sun XM, Neuwirth C, Wade DP, Knight BL, Soutar AK. A mutation (T-45C) in the promoter region of the low density lipoprotein (LDL)-receptor gene is associated with mild clinical phenotype in a patient with heterozygous familial hypercholesterolaemia (FH). Hum Mol Genet. 1995;4:2125–2129.[Abstract/Free Full Text]

15. Ruiz J, Blanché H, James RW, Blatter MC, Charpentier G, Morabia A, Passa P, Froguel P. The polymorphism (Gln-Arg192) of the high-density lipoprotein-bound enzyme paraoxonase is an independent cardiovascular risk factor in non-insulin dependent diabetic patients. Lancet. 1995;346:869–872.[Medline] [Order article via Infotrieve]

16. Serrato M, Marian AJ. A variant of human paraoxonase/arylesterase (HUMPONA) gene is a risk factor for coronary heart disease. J Clin Invest. 1995;96:3005–3008.

17. Zama T, Murata M, Matsubara Y, Kawano K, Aoki N, Yoshini H, Watanabe G, Ishikawa K, Ikeda Y. A ¹⁹²Arg variant of the human paraoxonase (HUMPONA) gene polymorphism is associated with an increased risk for coronary artery disease in the Japanese. Arterioscler Thromb Vasc Biol. 1997;17:3565–3569.[Abstract/Free Full Text]

18. Sanghera DK, Saha N, Aston CE, Kamboh MI. Genetic polymorphisms of paraoxonase and the risk of coronary heart disease. Arterioscler Thromb Vasc Biol. 1997;17:1067–1073.[Abstract/Free Full Text]

19. Odawara M, Tachi Y, Yamashita K. Paraoxonase polymorphism (Gln192-Arg) is associated with coronary heart disease in Japanese noninsulin-dependent diabetic patients. J Clin Endocrinol Metab. 1997;82:2257–2260.[Abstract/Free Full Text]

20. Pfohl M, Koch M, Enderle MD, Kühn R, Füllhase J, Karsch KR, Häring HU. Paraoxonase 192 Gln/Arg gene polymorphism, coronary artery disease, and myocardial infarction in type 2 diabetes. Diabetes. 1999;48:623–627.[Abstract]

21. Antikainen M, Murtomaki S, Syvänne M, Pahlman R, Tahvanainen E, Jauhiainen M, Frick MH, Ehnholm C. The Gln-Arg191 polymorphism of the human paraoxonase gene (HUMPONA) is not associated with risk of coronary artery disease in Finns. J Clin Invest. 1996;98:883–885.[Medline] [Order article via Infotrieve]

22. Herrmann S-M, Blanc H, Poirier O, Arveiler D, Luc G, Evans A, Marques-Vidal P, Bard J-M, Cambien F. The Gln/Arg polymorphism of human paraoxonase (PON 192) is not related to myocardial infarction in the ECTIM study. Atherosclerosis. 1996;126:299–304.[Medline] [Order article via Infotrieve]

23. Sakai T, Ohtani N, McGee TL, Robbins PD, Dryja TP. Oncogenic germ line mutations in Sp1 and ATF sites in the human retinoblastoma gene. Nature. 1991;353:83–86.[Medline] [Order article via Infotrieve]

24. Koivisto UM, Palvimo JJ, Janne OA, Kontula K. A single base substitution in the proximal Sp1 site of the human low density lipoprotein receptor promoter as a cause of heterozygous familial hypercholesterolemia. Proc Natl Acad Sci U S A. 1994;91:10526–10530.[Abstract/Free Full Text]

25. Brealey CJ, Walker CH, Baldwin BC. A-esterase activities in relation to the differential toxicity of pirimiphos-methyl to birds and mammals. Pestic Sci. 1980;11:546–554.

26. Li W-F, Costa CE, Furlong CE. Serum paraoxonase status: a major factor in determining resistance to organophosphates. J Toxicol Environ Health. 1993;40:337–346.[Medline] [Order article via Infotrieve]

27. Playfer JR, Eze LC, Bullen MF, Evans DAP. Genetic polymorphisms and interethnic variability of plasma paraoxonase activity. J Med Genet. 1976;13:337–342.[Abstract/Free Full Text]

28. Humbert R, Adler DA, Disteche CM, Hassett C, Omiecinski CJ, Furlong CE. The molecular basis of the human serum paraoxonase activity polymorphism. Nat Genet. 1993;3:73–76.[Medline] [Order article via Infotrieve]

This article has been cited by other articles:

				R. J. Richter, G. P. Jarvik, and C. E. Furlong Determination of Paraoxonase 1 Status Without the Use of Toxic Organophosphate Substrates Circ Cardiovasc Genet, December 1, 2008; 1(2): 147 - 152. [Full Text] [PDF]

				G. Lurie, L. R. Wilkens, P. J. Thompson, K. E. McDuffie, M. E. Carney, K. Y. Terada, and M. T. Goodman Genetic Polymorphisms in the Paraoxonase 1 Gene and Risk of Ovarian Epithelial Carcinoma Cancer Epidemiol. Biomarkers Prev., August 1, 2008; 17(8): 2070 - 2077. [Abstract] [Full Text] [PDF]

				X. Moren, S. Deakin, M.-L. Liu, M.-R. Taskinen, and R. W. James HDL subfraction distribution of paraoxonase-1 and its relevance to enzyme activity and resistance to oxidative stress J. Lipid Res., June 1, 2008; 49(6): 1246 - 1253. [Abstract] [Full Text] [PDF]

				L. Gaidukov and D. S. Tawfik The development of human sera tests for HDL-bound serum PON1 and its lipolactonase activity J. Lipid Res., July 1, 2007; 48(7): 1637 - 1646. [Abstract] [Full Text] [PDF]

				R Sanchez, E Levy, E Seidman, D Amre, F Costea, and D Sinnett Paraoxonase 1, 2 and 3 DNA variants and susceptibility to childhood inflammatory bowel disease. Gut, December 1, 2006; 55(12): 1820 - 1821. [Full Text] [PDF]

				L. Gaidukov, M. Rosenblat, M. Aviram, and D. S. Tawfik The 192R/Q polymorphs of serum paraoxonase PON1 differ in HDL binding, lipolactonase stimulation, and cholesterol efflux J. Lipid Res., November 1, 2006; 47(11): 2492 - 2502. [Abstract] [Full Text] [PDF]

				N. C. Schanen Epigenetics of autism spectrum disorders Hum. Mol. Genet., October 15, 2006; 15(suppl_2): R138 - R150. [Abstract] [Full Text] [PDF]

				M. Graner, R. W. James, J. Kahri, M. S. Nieminen, M. Syvanne, and M.-R. Taskinen Association of Paraoxonase-1 Activity and Concentration With Angiographic Severity and Extent of Coronary Artery Disease J. Am. Coll. Cardiol., June 20, 2006; 47(12): 2429 - 2435. [Abstract] [Full Text] [PDF]

				M.-C. Blatter Garin, X. Moren, and R. W. James Paraoxonase-1 and serum concentrations of HDL-cholesterol and apoA-I J. Lipid Res., March 1, 2006; 47(3): 515 - 520. [Abstract] [Full Text] [PDF]

				P. M. Erlich, K. L. Lunetta, L. A. Cupples, M. Huyck, R. C. Green, C. T. Baldwin, L. A. Farrer, and for the MIRAGE Study Group Polymorphisms in the PON gene cluster are associated with Alzheimer disease Hum. Mol. Genet., January 1, 2006; 15(1): 77 - 85. [Abstract] [Full Text] [PDF]

				K. Ranade, T. G. Kirchgessner, O. A. Iakoubova, J. J. Devlin, T. DelMonte, P. Vishnupad, L. Hui, Z. Tsuchihashi, F. M. Sacks, M. S. Sabatine, et al. Evaluation of the Paraoxonases as Candidate Genes for Stroke: Gln192Arg Polymorphism in the Paraoxonase 1 Gene Is Associated With Increased Risk of Stroke Stroke, November 1, 2005; 36(11): 2346 - 2350. [Abstract] [Full Text] [PDF]

				T. M. van Himbergen, M. Roest, J. de Graaf, E. H. J. M. Jansen, H. Hattori, J. J. P. Kastelein, H. A. M. Voorbij, A. F. H. Stalenhoef, and L. J. H. van Tits Indications that paraoxonase-1 contributes to plasma high density lipoprotein levels in familial hypercholesterolemia J. Lipid Res., March 1, 2005; 46(3): 445 - 451. [Abstract] [Full Text] [PDF]

				T. S. E. Albert, P. N. Duchateau, S. S. Deeb, C. R. Pullinger, M. H. Cho, D. C. Heilbron, M. J. Malloy, J. P. Kane, and B. G. Brown Apolipoprotein L-I is positively associated with hyperglycemia and plasma triglycerides in CAD patients with low HDL J. Lipid Res., March 1, 2005; 46(3): 469 - 474. [Abstract] [Full Text] [PDF]

				C. Bergmeier, R. Siekmeier, and W. Gross Distribution Spectrum of Paraoxonase Activity in HDL Fractions Clin. Chem., December 1, 2004; 50(12): 2309 - 2315. [Abstract] [Full Text] [PDF]

				B. Voetsch, K. S. Benke, C. I. Panhuysen, B. P. Damasceno, and J. Loscalzo The Combined Effect of Paraoxonase Promoter and Coding Region Polymorphisms on the Risk of Arterial Ischemic Stroke Among Young Adults Arch Neurol, March 1, 2004; 61(3): 351 - 356. [Abstract] [Full Text] [PDF]

				B. Voetsch and J. Loscalzo Genetic Determinants of Arterial Thrombosis Arterioscler. Thromb. Vasc. Biol., February 1, 2004; 24(2): 216 - 229. [Abstract] [Full Text]

				A. F Hernndez, B. Mackness, L. Rodrigo, O. Lopez, A. Pla, F. Gil, P. N Durrington, G. Pena, T. Parron, J. L Serrano, et al. Paraoxonase activity and genetic polymorphisms in greenhouse workers with long term pesticide exposure Human and Experimental Toxicology, November 1, 2003; 22(11): 565 - 574. [Abstract] [PDF]

				S. Deakin, I. Leviev, S. Guernier, and R. W. James Simvastatin Modulates Expression of the PON1 Gene and Increases Serum Paraoxonase: A Role for Sterol Regulatory Element-Binding Protein-2 Arterioscler. Thromb. Vasc. Biol., November 1, 2003; 23(11): 2083 - 2089. [Abstract] [Full Text] [PDF]

				N. Ferre, J. Camps, J. Fernandez-Ballart, V. Arija, M. M. Murphy, S. Ceruelo, E. Biarnes, E. Vilella, M. Tous, and J. Joven Regulation of Serum Paraoxonase Activity by Genetic, Nutritional, and Lifestyle Factors in the General Population Clin. Chem., September 1, 2003; 49(9): 1491 - 1497. [Abstract] [Full Text] [PDF]

				M. Marchesani, A. Hakkarainen, T.-P. Tuomainen, J. Kaikkonen, E. Pukkala, P. Uimari, E. Seppala, M. Matikainen, O.-P. Kallioniemi, J. Schleutker, et al. New Paraoxonase 1 Polymorphism I102V and the Risk of Prostate Cancer in Finnish Men J Natl Cancer Inst, June 4, 2003; 95(11): 812 - 818. [Abstract] [Full Text] [PDF]

				C. Gouedard, N. Koum-Besson, R. Barouki, and Y. Morel Opposite Regulation of the Human Paraoxonase-1 Gene PON-1 by Fenofibrate and Statins Mol. Pharmacol., April 1, 2003; 63(4): 945 - 956. [Abstract] [Full Text] [PDF]

				X. Wang, Z. Fan, J. Huang, S. Su, Q. Yu, J. Zhao, R. Hui, Z. Yao, Y. Shen, B. Qiang, et al. Extensive Association Analysis Between Polymorphisms of PON Gene Cluster With Coronary Heart Disease in Chinese Han Population Arterioscler. Thromb. Vasc. Biol., February 1, 2003; 23(2): 328 - 334. [Abstract] [Full Text] [PDF]

				P.N. Durrington, B. Mackness, and M.I. Mackness The Hunt for Nutritional and Pharmacological Modulators of Paraoxonase Arterioscler. Thromb. Vasc. Biol., August 1, 2002; 22(8): 1248 - 1250. [Full Text] [PDF]

				S. Deakin, I. Leviev, V. Nicaud, M.-C. B. Meynet, L. Tiret, and R. W. James Paraoxonase-1 L55M Polymorphism Is Associated with an Abnormal Oral Glucose Tolerance Test and Differentiates High Risk Coronary Disease Families J. Clin. Endocrinol. Metab., March 1, 2002; 87(3): 1268 - 1273. [Abstract] [Full Text] [PDF]

				M. M. Murphy, E. Vilella, S. Ceruelo, L. Figuera, M. Sanchez, J. Camps, G. Cuco, N. Ferre, A. Labad, N. Tasevska, et al. The MTHFR C677T, APOE, and PON55 Gene Polymorphisms Show Relevant Interactions with Cardiovascular Risk Factors Clin. Chem., February 1, 2002; 48(2): 372 - 375. [Full Text] [PDF]

				S. Deakin, I. Leviev, M. Gomaraschi, L. Calabresi, G. Franceschini, and R. W. James Enzymatically Active Paraoxonase-1 Is Located at the External Membrane of Producing Cells and Released by a High Affinity, Saturable, Desorption Mechanism J. Biol. Chem., February 1, 2002; 277(6): 4301 - 4308. [Abstract] [Full Text] [PDF]

				B. Mackness, G. K. Davies, W. Turkie, E. Lee, D. H. Roberts, E. Hill, C. Roberts, P. N. Durrington, and M. I. Mackness Paraoxonase Status in Coronary Heart Disease: Are Activity and Concentration More Important Than Genotype? Arterioscler. Thromb. Vasc. Biol., September 1, 2001; 21(9): 1451 - 1457. [Abstract] [Full Text] [PDF]

				I. Leviev, S. Deakin, and R. W. James Decreased stability of the M54 isoform of paraoxonase as a contributory factor to variations in human serum paraoxonase concentrations J. Lipid Res., April 1, 2001; 42(4): 528 - 535. [Abstract] [Full Text]

				P. N. Durrington, B. Mackness, and M. I. Mackness Paraoxonase and Atherosclerosis Arterioscler. Thromb. Vasc. Biol., April 1, 2001; 21(4): 473 - 480. [Abstract] [Full Text] [PDF]

				M. Senti, M. Tomas, J. Marrugat, R. Elosua, and f. t. REGICOR Investigators Paraoxonase1-192 Polymorphism Modulates the Nonfatal Myocardial Infarction Risk Associated With Decreased HDLs Arterioscler. Thromb. Vasc. Biol., March 1, 2001; 21(3): 415 - 420. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a response Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Leviev, I. Articles by James, R. W. Search for Related Content PubMed PubMed Citation Articles by Leviev, I. Articles by James, R. W. Related Collections Pathophysiology Risk Factors Genetics of cardiovascular disease Lipid and lipoprotein metabolism