Atherosclerosis and Lipoproteins |
From the Institut National de la Santé et de la Recherche Médicale (INSERM), Unité 321 (C.D., J.C., M.R.), Hopital de la Pitié-Salpétrière, and Unité 525 (O.P., F.C.), Paris, France.
Correspondence to Dr Christiane Dachet, INSERM, Unité 321, Hopital de la Pitié-Salpétrière, 83 Bd de lHopital, 75651 Paris Cedex 13, France. E-mail cdachet{at}infobiogen.fr
| Abstract |
|---|
|
|
|---|
Key Words: cholesteryl ester transfer protein gene polymorphisms transcription factors ECTIM cardiovascular disease
| Introduction |
|---|
|
|
|---|
Several common polymorphisms have been described in the CETP gene,7 8 9 10 most of which are associated with plasma CETP mass and HDL-C levels.9 11 12 However, these associations are complex. The effects of the CETP TaqIB polymorphism on plasma CETP mass and HDL-C appear to be independent.10 13 In addition, the strength of the relation between polymorphisms in the CETP gene and HDL-C levels may be affected by environmental factors. For example, the strength of the association was reduced by obesity and smoking14 15 and enhanced by mild hypertriglyceridemia and alcohol intake.10 16 17 Moreover, CETP activity can be modulated independently of variation in CETP mass by the metabolic state and especially by levels of TG-rich lipoproteins.13 15 18
Only rare mutations, prevalent in the Japanese population, appear to affect either the secretion or the functionality of CETP: these involve splicing defects, introns 10 and 14,19 20 21 nonsense mutations within exons 2,22 6,23 9,24 and 10,25 and a missense mutation within exon 15,26 D442G, which is close to the active site of the enzyme. This latter mutation leads not only to reduction in CETP biosynthesis but also to diminution in the specific activity of the enzyme. Conversely, none of the frequently occurring polymorphisms described to date have been demonstrated to be functional; most of these are located within intronic regions (introns 1, 7, 8, 9, and 10),7 8 10 and there is no evidence that they affect the splicing of the CETP mRNA. The possibility that intron sequences may be involved in the regulation of CETP promoter activity cannot be excluded. However, none of these polymorphisms has been demonstrated to be implicated in such mechanisms. Only 1 common variant within exon 14 has been described in the coding region,9 and it leads to alteration in the primary structure of the protein (Ile405Val). However, this structural change does not affect the specific activity of CETP.17 Some of these polymorphisms are associated with CETP mass and HDL-C level and could represent markers for at least 1 functional variant in linkage disequilibrium with them. A previous investigation10 has suggested that such a variant is not located in the coding sequence of the CETP gene. We have recently identified 2 new polymorphisms in the 5'-flanking region of the CETP gene at positions -629 (CETP/-629) and -631 (CETP/-631) from the start of the translation.27 The CETP/-629 polymorphism is tightly concordant with the TaqIB polymorphism and could account for the associations found between the latter polymorphism and plasma CETP mass and HDL-C level. The results of transfection experiments that we report in the present study demonstrate that this polymorphism is functional, with the A allele displaying lower promoter activity than the C allele. Moreover, gel-shift assays reveal that the Sp1 and Sp3 transcription factors bind to the A but not the C allele and act as repressors of promoter activity.
| Methods |
|---|
|
|
|---|
Analysis of Plasma Lipid Parameters
The assays for determination of lipoprotein
parameters and especially HDL-C, together with detailed
analysis of lipid variables, have been reported earlier for
the ECTIM study.28 CETP mass was measured in frozen
samples stored at -80°C by a 2-site immunoenzymatic
assay.29 Missing measurements are the consequence of
transportation or storage problems; subjects not included did not
differ from those included for any relevant parameter.
Detection of Gene Polymorphisms by SSCP and Sequencing of
5'-Flanking Region
For polymerase chain reaction (PCR)/single-strand conformational
polymorphism (SSCP) analysis, 20 individuals were randomly
selected among controls in the Belfast and Strasbourg populations.
Genomic DNA was prepared from white blood cells by phenol extraction. A
fragment of 820 bp of the upstream sequence of the CETP
gene30 was divided into overlapping fragments of
300 bp
and enzymatically amplified by use of specific
oligonucleotides. Each amplification was performed by
using 250 ng of DNA in a total volume of 50 µL containing 10
mmol/L Tris-HCl, 1.5 mmol/L MgCl2, 0.1%
Triton X-100, 0.2 mg/mL BSA, 200 µmol/L dNTPs, 25 pmol of each
primer, and 0.2 U Taq polymerase (ATGC). For the SSCP analysis,
0.3 µCi of [
-32P]dCTP was added to the
mixture. Thereafter, PCR products were diluted 2-fold in a solution
containing 95% formamide, 10 mmol/L EDTA, 0.05% bromophenol
blue, and 0.05% xylene cyanol. After denaturation at 94°C for 5
minutes, the samples were placed on ice, and a 4-µL sample was loaded
onto nondenaturing 6% acrylamide gels
(acrylamide to bis-acrylamide ratio 39:1).
Electrophoresis was performed at room temperature at 40-W constant
power for 6 hours in the absence or presence of 7.5% glycerol in the
gels. The gels were subsequently dried and autoradiographed
overnight.
DNA from patients with different SSCP migration patterns was reamplified by PCR with unlabeled primers. PCR products were then purified and sequenced by the method of Sanger et al31 with use of a direct sequencing kit (Perkin-Elmer). All samples of DNA that were analyzed differed only by the presence of A or C at the position of the considered polymorphism (-629 or -631). However, when 2 published sequences, which concern 360 and 3500 bp of the promoter (Agellon et al32 and Oliveira et al,30 respectively) are considered, several discrepancies were noted at position -310 (we and Oliveira et al reported T, and Agellon et al reported A), at position -332 (we and Agellon et al reported G, and Oliveira et al reported C), and at position -266 (we and Oliveira et al reported 6A, and Agellon et al reported 5A).
Allele-Specific Oligonucleotide Hybridization
Genotyping of the CETP/-631 and the CETP/-629
polymorphisms was performed in all subjects participating in the
ECTIM Study by use of allele-specific
oligonucleotides.33 The 2
polymorphisms were detected on the same amplified fragment (262 bp)
by use of the following probes: upper, GCATAACACGTTCACACAAC;
lower, TGTCCTGCACTGTAGTATTC (annealing temperature 55°C). The probes
used and the assay conditions are described in Table 1
. After enzymatic amplification, 1/5 of
the PCR product was denatured in 150 µL of 0.5 mol/L NaOH and 1.5
mol/L NaCl with 10 µL of 0.05% bromophenol solution and blotted onto
nylon membranes (Hybond N+, Amersham). Four
oligonucleotides were used to detect the 2
polymorphisms: (1)
TGTATACCCACCCAGAG, (2)
GTATACCCCCCCAGAGT, (3)
TGTATACACACCCAGAG, and
(4) TGTATACACCCCCAGAG
(the polymorphic nucleotides are underlined and in
bold). Hybridization temperatures were 47°C, 49°C, 45°C, and
47°C, respectively. Oligonucleotides 1 and 2 were
used to detect haplotypes CC and CA, and
oligonucleotides 3 and 4 were used to detect haplotypes
AA and AC. Each allele was detected after preincubation of the
membranes for 2 hours with 50 pmol of unlabeled
oligonucleotide probe for the other allele,
followed by incubation for 4 hours with 10 pmol of the labeled probe
specific for the studied allele. The membranes were washed twice at
room temperature in 1x SSC for 5 minutes followed by 10 minutes in
0.5x SSC at the hybridization temperatures.
|
Plasmid Construction
A 777-bp fragment (extending from the translation start site to
-745 bp) of the CETP promoter was amplified by PCR from individuals
homozygous for either the -629A or -629C allele by use of
oligonucleotides designed to create NheI
(5') and BglII (3') cutting sites. The digested fragments
were cloned between the unique NheI and BglII
sites of the pGL3 basic luciferase expression vector (Promega). In the
same manner, we generated a control vector in which the luciferase gene
was driven by 138 bp (relative to the translation start site) of the
CETP promoter. Indeed, a previous study showed that this fragment was
sufficient to promote maximum activity of the CETP promoter in
transfected HepG2 cells.34
Thereafter, the integrity of inserts was verified for all constructs by sequencing, and a large amount of each vector was prepared by double equilibrium ultracentrifugation in cesium chloride.
Generation of Mutations
Mutagenesis was conducted with use of the Gene Editor
Site-Directed Mutagenesis System (Promega). The following synthetic
oligonucleotide, containing 2 mismatched bases
(underlined bases), was used to introduce mutations at positions -627
and -626 of the CETP gene promoter: 5'
GGCTGTATACCCACAAAGAGTTATTTTATGC 3'. The -629A
construct was used as the matrix. The presence of the mutations was
confirmed by sequencing.
Cell Culture and Transfections
HepG2 cells were obtained from the American Type Culture
Collection and maintained in culture in DMEM supplemented with 10% FBS
(Bio-Whittaker), L-glutamine (2 mmol/L), and
gentamycin (40 µg/mL) under 5% CO2 at 37°C.
The day before transfection, cells were seeded in 6-well plates at
2.5x105 cells per well. Cells were transfected
using Lipofectin Liposomal reagent (GIBCO-BRL) according to the
manufacturers protocol. To account for variable transfection
efficiency, 3 µg of each CETP promoter construct was cotransfected
with 0.5 µg of a ß-galactosidase expression plasmid (pSV-ßgal,
Promega). After 24 hours of incubation, the medium was removed, fresh
medium was added, and the cells were incubated for an additional 16
hours. Cells were harvested in Cellular Lysis Buffer (Promega), cell
debris was pelleted by centrifugation, and the
supernatant was used for assays. Luciferase activities were measured in
a 1420 VICTOR Multilabel counter (Wallac, EG and G Co) with luciferin
reagent (Promega). The ß-galactosidase activities were determined by
a colorimetric method (Promega), and values were used
to normalize variability in transfection efficiency. Data were averaged
from at least 3 independent experiments performed in triplicate with 2
different preparations of DNA.
Electrophoretic Mobility Shift Assay
HepG2 nuclear extracts were prepared from confluent 150-mm
dishes by the method described by Dignam et al.35 Aliquots
of nuclear extracts were stored at -70°C. The protein concentration
was determined by bicinchoninic acid protein assay reagent BCA
(Pierce). For electrophoretic mobility shift assay (EMSA), 0.25 pmol of
32Pend-labeled double-strand
oligonucleotide (1x105 cpm) was
mixed with 6 µg of nuclear factors in a final volume of 20 µL
containing 10 mmol/L Tris-HCl (pH 7.5), 100 mmol/L NaCl,
3 mmol/L MgCl2, 0.5 mmol/L EDTA, 1
mmol/L dithiothreitol, 5% glycerol, 2 µg poly(dI-dC) ·
poly(dI-dC), 4 mmol/L spermidine, and 1 µg BSA. The appropriate
competitor was added to the reaction mixture before the addition of the
end-labeled probe. When indicated, 1 µg of rabbit affinity-purified
polyclonal antibody raised against Sp1 or Sp3 (Santa Cruz
Biotechnology) was incubated with nuclear extracts for 30 minutes on
ice before the addition of the probe. The anti-Sp1 and anti-Sp3
antibodies correspond to epitopes at amino acids 436 to 454 and 676 to
695 of human proteins. Finally, samples were incubated for 15 minutes
on ice, loaded onto a 6% polyacrylamide gel, and
electrophoresed at 200 V for 3 hours. The protein-DNA complexes were
visualized by autoradiography of the dried gels on
Hyperfilm MP (Amersham, Life Science) at -70°C.
Oligonucleotides for the A or C probe were as follows: for -629A, 5'GGCTGTATACCCACCCAGAGTTATT 3'; for -629C, 5'GGCTGTATACCCCCCCAGAGTTATT 3'.
When oligonucleotides including mutations in the -629A
probe were used, the positions of the mutations are shown in
Figure 4
. Double-strand Sp1 and Egr consensus
oligonucleotides were purchased from Promega and Tebu,
respectively. A synthetic oligonucleotide containing
the PuF consensus binding site was synthesized as described by Ji et
al.36 The nonspecific competitor had the following
sequence: 5' TGTCGAATGCAAATCACTAGAA 3'.
|
Statistical Analysis
Pairwise linkage disequilibrium coefficients were estimated by
using log-linear model analysis.37 The extent of
the disequilibrium is reported as the ratio of the unstandardized
coefficients to their minimal/maximal value (D').38 The
sign in front of the coefficients indicates whether the linkage
disequilibrium is positive (rare alleles preferentially associated)
or negative (rare allele preferentially associated with frequent
allele). Mean levels of plasma CETP mass and HDL-C were compared
across genotypes by ANOVA, and possible interactions between
genotypes and between genotypes and quantitative
variables, such as alcohol consumption, on dependent variables
were also tested (SAS/Proc GLM). Hardy-Weinberg equilibrium was tested
by a
2 test with 1 df.
| Results |
|---|
|
|
|---|
Effects of CETP Polymorphisms on Plasma CETP Mass and
HDL-C
The effects of the 2 polymorphisms on plasma CETP mass and
HDL-C levels (536 and 668 subjects, respectively) are shown in Table 2
. The CETP/-629 polymorphism was
significantly associated with plasma concentrations of both CETP mass
and HDL-C. Subjects homozygous for the -629C allele displayed
higher CETP mass and lower HDL-C concentrations than subjects
homozygous for the -629A allele (30% [P<0.001] and
-12% [P<0.01], respectively). Subjects heterozygous for
the polymorphism (-629C/A) displayed intermediate values.
Conversely, no significant correlation was observed between the
CETP/-631 polymorphism and either plasma CETP mass or HDL-C
concentration. This lack of significant association was unaffected when
the CETP/-629 polymorphism was taken into account in the
statistical analyses. No association was observed between the
CETP polymorphism and other lipid variables, including VLDL or
LDL cholesterol, plasma cholesterol, apoB, or
triglyceride concentrations (data not shown).
Interestingly, as we reported before,10 no
correlation was observed between plasma CETP mass and HDL-C. As
expected from the tight association between the CETP/-629 and
CETP/TaqIB polymorphisms and from our former results
concerning CETP/TaqIB,10 a strong
interaction between the CETP/-629 polymorphism and alcohol
consumption on plasma HDL-C was detected (result not shown).
|
Functionality of CETP/-629C/A Polymorphism
To determine whether the CETP/-629 polymorphism might
influence the activity of the CETP promoter, transient transfections of
HepG2 cells were performed with 4 plasmids: a negative control
consisting of the pGl3 basic vector lacking an insert, a 138-bp plasmid
containing the proximal region upstream from the translation site as a
positive control, and 2 other constructs containing a 777-bp fragment
(from translation site to -745 bp) with either A or C at position
-629 (termed p-629A and p-629C, respectively). As expected, the
negative control resulted in low levels of luciferase activity. The
highest expression was obtained with the 138-bp fragment of the CETP
promoter, as already described.34 Luciferase activity
produced by vectors containing the long promoter fragment (777 bp)
represented
30% of the activity obtained with the short
fragment (-138 bp, data not shown). The results obtained after
transfection with the 2 CETP allelic promoter fragments are shown in
Figure 1
. Luciferase activity after cell
transfection with the plasmid containing the A allele, p-629A, was
significantly lower than that observed with the C allele, p-629C
(2960±308 versus 3834±397 related luciferase units, respectively;
P<0.05), with activity of the A allele
representing
75% of that of the C allele. This
finding is consistent with the low plasma CETP mass observed in
subjects homozygous for the A allele.
|
EMSA of CETP Promoter Fragment Surrounding -629C/A
Polymorphism
To investigate protein-DNA interactions in the vicinity of the
polymorphism, EMSA was performed by use of nuclear extracts from
HepG2 and synthetic oligonucleotides spanning the
sequence of the CETP gene promoter from -641 to -617 bp and
containing either A or C at position -629. Interaction with the A
probe in the absence of competitor resulted in the formation of 4 bands
(Figure 2
, lane 1). Two bands, designed
AI and AII, were specifically competed by a molar excess of unlabeled A
probe (Figure 2
, lanes 3 and 4) but not by a nonspecific
competitor (Figure 2
, lane 2). In the same manner, 4 retarded
complexes were observed after incubation of nuclear extracts with the C
probe in the absence of competitor (Figure 2
, lane 8). Two of
them, designed CI and CII, disappeared after competition with a molar
excess of unlabeled C probe (Figure 2
, lanes 12 and 13) but not
after competition with an unrelated oligonucleotide
(Figure 2
, lane 9). Moreover, a molar excess of unlabeled C or A
probe was only a poor competitor of retarded complexes formed with the
other radiolabeled probe: A (Figure 2
, lanes 5 and 6) or C
(Figure 2
, lanes 10 and 11). Taken together, these results
indicate that 2 specific complexes having different migration rates
were formed with the 2 probes and suggest that different proteins are
involved in the formation of complexes with the A or C probe.
|
The promoter sequence surrounding the -629 polymorphism displayed
similarities with the inverted form of a nonconsensus Sp1 binding
site,39 hereafter termed -629-Sp1. Subsequently, we
investigated whether any protein of the Sp1 transcription factor family
might be implicated in complex formation. A synthetic
oligonucleotide containing the Sp1 consensus binding
site was used as competitor. The 2 complexes formed with the A probe,
AI and AII, were entirely competed by an excess of Sp1
oligonucleotide (Figure 2
, lane 7), whereas a
partial competition was observed with CI, and no competition was
observed with CII (Figure 2
, lane 14). To confirm the
participation of a protein of the Sp1 family in the formation of a
specific complex, we used 2 antibodies specific for either human Sp1 or
human Sp3 (Figure 3
). The antibody
against human Sp1 significantly decreased the AI complex (Figure 3
, lane 2), whereas the antibody specific for human Sp3
partially abolished AI but totally abolished AII (Figure 3
, lane
3). When antibodies to Sp1 and Sp3 were incubated together with nuclear
extracts, complexes AI and AII were entirely disrupted and supershifted
(Figure 3
, lane 4). Formation of complexes CI and CII was not
affected by incubation with antibodies to either Sp1 or Sp3 (Figure 3
, lanes 7 and 8). Incubation with preimmune serum did not
affect the formation of any complex formed with either the A or C probe
(Figure 3
, lanes 5 and 9). These results strongly suggest that
Sp1 and Sp3 are the 2 nuclear factors implicated in the formation of
the 2 specific complexes observed with the A probe.
|
Curiously, in the presence of the C probe, a complex was observed just
below the CI band and especially in the presence of the nonspecific
competitor (Figure 2
, lane 9). This complex appeared to migrate
at the same position as the AII complex and disappeared after
competition with an excess of unlabeled A probe (Figure 2
, lanes
10 and 11) but not after competition with the C probe (Figure 2
, lanes 12 and 13). An excess of Sp1 oligonucleotide did
not compete for the formation of this complex, indicating that no
protein of the Sp family is implicated in the formation of this
complex.
Further analysis of the promoter sequence surrounding the -629 polymorphism revealed similarities with 2 other consensus binding sites (or their inverted form) that could potentially bind the PuF/nm23H2 and Egr transcription factor families. To identify the factor(s) involved in the formation of CI and CII complexes, synthetic oligonucleotides containing either the PuF or the Egr consensus binding sites were used as competitors. The PuF probe competed with the retarded complex, CII. However, the incubation of nuclear extracts with an antibody specific to human nm23H2 (the protein that binds the PuF site) failed to disrupt either the CI or CII complexes (data not shown). Furthermore, a synthetic oligonucleotide containing the Egr consensus binding site did not compete for formation of CI or CII (data not shown).
Functional Relevance of -629-Sp1 Binding Site
To determine whether the -629-Sp1 binding site was implicated in
the regulation of CETP promoter activity, we performed transfection
experiments in HepG2 cells by use of the CETP promoter plasmid
containing the A allele promoter fragment in which the nonconsensus
Sp1 binding site was disrupted. We first generated an
oligonucleotide that was mutated in the -629-Sp1
binding site to eliminate the fixation of Sp1 and Sp3 and that
contained an A at position -629; in this way, binding of unidentified
proteins to the -629C probe was avoided (Figure 4A
). This mutated
oligonucleotide (-629AM) was tested by EMSA (Figure 4B
). When used as a competitor, a 100-fold molar excess of
mutated oligonucleotide had no effect on the specific
retarded complexes, AI and AII, formed with the -629A probe (Figure 4B
, lane 3). By contrast, the same molar excess of unlabeled
wild-type -629A completely prevented complex formation (Figure 4B
, lane 2).When mutated oligonucleotide was
used as a probe, incubation with HepG2 nuclear extracts in the absence
of competitor resulted in the formation of 2 complexes having the same
migration rate as the nonspecific complexes observed after incubation
with the wild-type -629A probe (Figure 4B
, lanes 4 and 1,
respectively). A 100-fold molar excess of unlabeled mutated
oligonucleotide did not affect the formation of these 2
complexes (Figure 4B
, lane 5), thereby confirming their
nonspecificity. As expected, under our EMSA conditions, the mutated
oligonucleotide failed to specifically bind any
transcription factors. These mutations were then introduced by
site-directed mutagenesis into the p-629A vector and the CETP-mutated
promoter plasmid (p-629AM) used to transfect HepG2 cells. As expected,
A allele (p-629A) promoter activity was significantly lower than C
allele (p-629C) promoter activity (-25%, P<0.05;
Figure 4C
). Compared with the wild-type plasmid (p-629A), the
mutated plasmid (p-629AM) resulted in a significant increase of
promoter activity (25%, P<0.05; Figure 4C
). Plasmid
p-629AM displayed promoter activity similar to that of the p-629C
plasmid containing the C allele promoter sequence (Figure 4C
). These findings suggest that the binding of the 2
transcription factors, Sp1 and Sp3, to the -629-Sp1 binding site
accounts for differences detected in promoter activity between the A
and the C alleles.
| Discussion |
|---|
|
|
|---|
Two specific complexes, AI and AII, were identified when HepG2 nuclear extracts were incubated with the A probe. In the presence of an antibody specific for human Sp1, the band intensity of the high-Mr complex, AI, was significantly reduced. Whereas in the presence of an antibody specific for human Sp3, the band intensity of this complex, AI, was slightly decreased, and the low-Mr complex, AII, disappeared entirely. The molecular mass of Sp1 is 109 kDa,39 whereas Sp3 has been reported to be present in cells as 2 isoforms of 115 and 80 kDa.41 In the presence of the 2 antibodies, both complexes were supershifted, indicating that only Sp1 and Sp3 are involved in their formation. Thus, supershift data indicate that AI may correspond to complexes formed with Sp1 and the higher molecular weight isoform of Sp3 and that AII may correspond to complexes formed with the lower molecular weight isoform of Sp3. Together, these results strongly suggest that nuclear factors Sp1 and Sp3 bind specifically to the A allele. The basic recognition unit of the Sp family transcription factors is a motif with a consensus sequence 5'-(G/T)GGGCGGPu-Pu-Py-3', known as a GC box. Furthermore, GA and GT boxes (or their inverted forms, CT and CA elements) can also bind Sp proteins with similar specificity in the promoters of a variety of genes.39 42 43 44 Such observations are consistent with our results, because the promoter sequence surrounding the A allele closely resembles the inverted form of a GT box. Conversely, neither Sp1 nor Sp3 bound to the C allele; this finding is in agreement with a recent study showing that the transversion of the central C to G (or G to C for the inverted form) is critical in the formation of DNA-protein complexes.39
When we introduced mutations in the -629-Sp1 binding site to avoid the binding of Sp1 and Sp3 and to avoid creation of new complexes with other DNA binding proteins, the activity of the mutated CETP promoter fragment was significantly increased compared with that of the A wild-type fragment. These data strongly suggest that binding of Sp1 to the -629 site is associated with lower transcriptional activity of the reporter gene and indicate that the -629-Sp1 binding site is functional. Previous studies have identified several binding sites for nuclear factors in the proximal sequence of the CETP gene promoter; these include Sp1 at position -38, in juxtaposition to the TATA box, and an apoA-1 regulatory protein-1 (ARP-1) site located between -118 and -93 bp.34 The proximal 580 bases of the promoter contain several potential binding sites for sterol response element binding protein-1 (SREBP-1) and at least 1 potential binding site for CCAAT-enhancer binding protein (C/EBP).30 Interestingly, ARP-1 can act either as a repressor or an inducer of CETP gene transcription, depending on the presence or the absence of the promoter region between -636 and -300 bp and including the -629-Sp1 binding site.34 A distal element, which could correspond to the -629-Sp1 binding site, may therefore modulate CETP expression. On the other hand, it has been shown that SREBP-145 and C/EBP32 activate CETP gene expression. In addition, Sp1 can interact synergistically with a number of other nuclear factors46 47 48 and particularly with SREBP-142 and C/EBP.49 In vivo, transcription factors binding to distal regulatory elements can interact with transcription factors binding to sequences within the proximal region.30 50 Indeed, a recent study involving in vitro transient transfection has revealed an interaction between 2 transcription factors, Sp1 and GATA 1.48 Together, these data suggest that despite its distal position, the -629-Sp1 binding site may modulate transcriptional activity of the CETP gene by synergistic interaction with other nuclear factors, including ARP-1, SREBP-1, and C/EBP.
In the present study, transfection experiments showed that Sp1/Sp3 acted as repressors of promoter activity. It is generally admitted that Sp1 stimulates transcription and that Sp3 represses Sp1-mediated transcriptional activation.51 However, several studies suggest that gene regulation by Sp transcription factors is more complex than previously assumed. There is some evidence that Sp1 may itself decrease transcriptional activity when bound to certain Sp1 elements, depending on its local interactions.48 On the other hand, it has been demonstrated that Sp3 is a bifunctional protein containing independent repressor and activator domains. Such dual-function regulation is dependent on the promoter and the cellular context.52 In addition, it appears that the level of Sp3 or the nuclear Sp1/Sp3 ratio may play a role in regulating promoter transcription activity.39 43 Moreover, the Sp1/Sp3 ratio differs between cell types.43 From our results, the mechanism by which Sp1 and/or Sp3 represses CETP gene promoter activity cannot be precisely defined. Further investigations and especially cotransfection studies with vectors expressing either Sp1 or Sp3 in Drosophila SL2 cells, which lack endogenous Sp activity, would be necessary to define the molecular mechanism involved.
We did not identify nuclear factors binding the C allele. Nonetheless, the nm23H2 and Egr transcription factors were excluded. However, the mutated promoter fragment (which did not bind any transcription factors in the region of the polymorphism) expressed activity similar to the promoter fragment containing the C allele, strongly suggesting that nuclear factors binding the C allele do not affect promoter activity. One hypothesis may be that undetermined nuclear factors binding the C allele prevent the binding of Sp1 and Sp3 without themselves modulating promoter activity. On the other hand, we cannot exclude an action of these nuclear factors in another metabolic context or in vivo.
The CETP/-629 polymorphism is significantly associated with plasma CETP mass and HDL-C levels. However, no correlation was observed between CETP mass and HDL-C, thereby indicating that the 2 associations were independent. Clearly, our results show that the -629 polymorphism is functional and that it modulates not only the transcription rate of the CETP promoter but also plasma CETP mass. It has been suggested that CETP may be in excess in the plasma of normolipidemic subjects, such that cholesteryl ester transfer rates are determined by plasma triglyceride concentrations; by contrast, CETP may be limiting in hypertriglyceridemic patients, in which case, transfer rates may be determined by plasma CETP concentration.53 The association between the -629 polymorphism and HDL-C could be, at least in part, the consequence of alterations in plasma CETP mass, especially in dyslipidemic individuals. The lack of correlation between CETP mass and HDL-C could reflect the contribution of metabolic and environmental factors to the modulation of HDL-C. However, it has been shown that CETP deficiency may be associated with the prevalence of cardiovascular disease despite marked elevation of HDL-C,54 55 especially in hypertriglyceridemic patients.17 In addition, CETP activity appears to inhibit the progression of atherosclerosis in hypertriglyceridemic mice.56 Finally, a recent study has shown a significant relation between variation at the CETP gene locus and the progression of coronary atherosclerosis that is independent of plasma HDL-C levels.57 Clearly, then, the CETP gene may exert effects on cardiovascular risk that are independent of HDL-C levels. Thus, further knowledge of the molecular mechanisms that modulate the expression of the CETP gene is essential.
| Acknowledgments |
|---|
Received May 19, 1999; accepted August 18, 1999.
| References |
|---|
|
|
|---|
2. Tall AR. Plasma cholesteryl ester transfer protein. J Lipid Res. 1993;34:12551274.[Medline] [Order article via Infotrieve]
3. Bruce C, Tall AR. Cholesteryl ester transfer protein, reverse cholesterol transport and atherosclerosis. Curr Opin Lipidol. 1995;6:306311.[Medline] [Order article via Infotrieve]
4. Inazu A, Brown ML, Hesler CB, Agellon LB, Koizumi J, Takata K, Maruhama Y, Mabuchi H, Tall AR. Increased high density lipoprotein levels caused by a common cholesteryl-ester transfer protein gene mutation. N Engl J Med. 1990;323:12341238.[Abstract]
5. Bathnagar D, Durrington PN, Channon KN, Prais H, Mackness MI. Increased transfer of cholesteryl esters from high density lipoproteins to low density and very low density lipoproteins in patients with angiographic evidence of coronary artery disease. Atherosclerosis. 1993;98:2532.[Medline] [Order article via Infotrieve]
6. Guérin M, Bruckert E, Dolphin PJ, Chapman MJ. Absence of cholesteryl ester transfer protein-mediated cholesteryl ester mass transfer from high-density lipoprotein to low-density lipoprotein particles is a major feature of combined hyperlipidemia. Eur J Invest. 1996;26:485494.
7.
Drayna D, Lawn R. Multiple RFLPs at the cholesteryl
ester transfer protein (CETP) locus. Nucleic Acids Res. 1987;15:4698.
8.
Zuliani G, Hobbs HH. EcoNI polymorphism in the
human cholesteryl ester transfer protein (CETP) gene. Nucleic
Acids Res. 1990;18:2834.
9. Funke H, Wiebusch H, Fuer L, Muntoni S, Schulte H, Assmann G. Identification of mutations in the cholesteryl ester transfer protein in Europeans with elevated high density lipoprotein cholesterol. Circulation. 1994;90:1241.
10. Fumeron F, Betoulle D, Luc G, Behague I, Richard S, Poirier O, Jemaa R, Avans A, Alveiler D, Marques-vidal P, Bard JM, Fruchard JC, Ducimetière P, Apfelbaum M, Cambien F. Alcohol intake modulates the effect of a polymorphism of the cholesteryl ester transfer protein on plasma high density lipoprotein and the risk of myocardial infarction. J Clin Invest. 1995;96:16641671.
11.
Kuivenhoven JA, De Knijff P, Boer JMA, Smalheer HA,
Botma GJ, Seidell JC, Kastelein JP, Pritchard PH.
Heterogeneity at the CETP gene locus: influence on
plasma CETP concentrations and HDL cholesterol levels.
Arterioscler Thromb Vasc Biol. 1997;17:560568.
12. Gudnasson V, Thormar K, Humphries SE. Interaction of the cholesteryl ester transfer protein 1405V polymorphism with alcohol consumption in smoking and non-smoking healthy men, and the effect on plasma HDL cholesterol and apo AI concentration. Clin Genet. 1997;51:1521.[Medline] [Order article via Infotrieve]
13.
Bernard S, Moulin P, Lagrost L, Picard S, Elchebly M,
Ponsin G, Chapuis F, Berthezene F. Association between plasma
HDL-cholesterol concentration and TaqIB CETP gene
polymorphism in non-insulin-dependent diabetes mellitus. J
Lipid Res. 1998;39:5965.
14. Mendis S, Shephered J, Packard CJ, Gaffney D. Genetic variation in the cholesteryl ester transfer protein and apolipoprotein A-I genes and its relation to coronary heart disease in a Sri Lankan population. Atherosclerosis. 1990;83:2127.[Medline] [Order article via Infotrieve]
15.
Freeman DJ, Bruce AG, Holmes AP, Lindsay GM, Gaffney D,
Packard CJ, Shephered J. Regulation of plasma HDL
cholesterol and subfraction distribution by genetic and
environmental factors: association between the TaqIB RFLP in the CETP
gene and smoking and obesity. Arterioscler Thromb. 1994;14:336344.
16. Hannuksela ML, Liinamaa MJ, Kesaniemi YA, Savolainen MJ. Relationship of polymorphism in the cholesteryl ester transfer protein gene to transfer protein activity and plasma lipoprotein levels in alcohol drinkers. Atherosclerosis. 1994;110:3544.[Medline] [Order article via Infotrieve]
17.
Bruce C, Sharp DS, Tall AR. Relationship of HDL and
coronary heart disease to a common amino acid polymorphism
in the cholesteryl ester transfer protein in men with and without
hypertriglyceridemia. J Lipid
Res. 1998;39:10711078.
18.
Guérin M, Dolphin PJ, Talussot C, Gardette J,
Berthezene F, Chapman MJ. Pravastatin modulates cholesteryl
ester transfer from HDL to apoB-containing lipoproteins and lipoprotein
subspecies profile in familial
hypercholesterolemia. Arterioscler Thromb
Vasc Biol. 1995;15:13591368.
19. Brown ML, Inazu A, Hesler CB, Agellon LB, Mann C, Whitlock ME, Marcel YL, Milne RW, Koizumi J, Mabuchi H, Takeda R, Tall AR. Molecular basis of lipid transfer protein deficiency in a family with increased high-density lipoproteins. Nature. 1989;342:448451.[Medline] [Order article via Infotrieve]
20. Inazu A, Jiang X, Araki T, Yagi K, Kamon N, Koizumi J, Mabuchi H, Takeda R, Moriyama Y, Doi M, Tall AR. Genetic cholesteryl ester transfer protein deficiency caused by two prevalent mutations as a major determinant of increased levels of high density lipoprotein cholesterol. J Clin Invest. 1994;94:18721882.
21. Sakai N, Santamarina-Fojo S, Yamashita S, Matsuzawa Y, Brewer HB. Exon 10 skipping caused by intron 10 splice donor site mutation in cholesteryl ester transfer protein gene results in abnormal downstream splice selection. J Lipid Res. 1996;37:20652073.[Abstract]
22.
Ritsch A, Drexel H, Amann FW, Pfeifhofer C, Patsch JR.
Deficiency of cholesteryl ester transfer protein: description of the
molecular defect and the dissociation of cholesteryl ester and
triglyceride transport in plasma. Arterioscler Thromb
Vasc Biol. 1997;17:34333441.
23. Arai T, Yamashita S, Sakai N, Hirano K, Okada S, Ishigami M, Maruyama T, Yamane M, Kobayashi H, Nozaki S, Funahashi T, Kameda-Takemura K, Nakajima N, Matsuzawa Y. A novel nonsense mutation (G181X) in the human cholesteryl ester transfer protein gene in Japanese hyperalphalipoproteinemic subjects. J Lipid Res. 1996;37:21452154.[Abstract]
24.
Teh EM, Dolphin PJ, Breckenridge WC, Tan M. Human
plasma CETP deficiency: identification of a novel mutation in exon 9 of
the CETP gene in a Caucasian subject from North America. J Lipid
Res. 1998;39:442456.
25. Gotoda T, Kinoshita M, Shimano H, Harada K, Shimada M, Ohsuga J, Teramoto T, Yazaki Y, Yamada N. Cholesteryl ester transfer protein deficiency caused by a nonsense mutation detected in the patients macrophage mRNA. Biochem Biophys Res Commun. 1993;194:519524.[Medline] [Order article via Infotrieve]
26. Takahashi K, Jiang XC, Sakai N, Yamashita S, Hirano K, Bujo H, Yamazaki H, Kusunoki J, Mirua T, Kussie P, Matsuzawa Y, Saito Y, Tall AR. A missense mutation in the cholesteryl ester transfer protein gene with possible dominant effects on plasma high density lipoproteins. J Clin Invest. 1993;92:20602064.
27. Corbex M, Poirier O, Fumeron F, Betoulle D, Evans A, Ruidavets JB, Arveiler D, Luc G, Tiret L, Cambien F. An extensive association analysis between the CETP gene and coronary heart disease phenotypes reveals several putative functional polymorphisms and gene-environment interaction. Genet Epidemiol. In press.
28.
Parra HJ, Arveiler D, Evans AE, Cambou JP, Amouyel P,
Bingham A, McMaster D, Schaffer P, Douste-Blazy P, Luc G, Richard JL,
Ducimetière P, Fruchart JC, Cambien F. A case control study
of lipoprotein particles in two populations at contrasting risk for
CHD, the ECTIM Study. Arterioscler Thromb. 1992;12:701707.
29.
Mezdour H, Kora I, Parra HJ, Tartar A, Marcel YL,
Fruchart JC. Two-site enzyme immunoassay of cholesteryl ester transfer
protein with monoclonal and polyclonal antibodies. Clin
Chem. 1994;40:593597.
30.
Oliveira HF, Choinard RA, Agellon LB, Bruce C, Ma L,
Walsh A, Breslow JL, Tall AR. Human cholesteryl ester transfer protein
gene proximal promoter contains dietary cholesterol
positive responsive elements and mediates expression in small intestine
and periphery while predominant liver and spleen expression is
controlled by 5'-distal sequences: cis-acting sequences mapped in
transgenic mice. J Biol Chem. 1996;271:3183131838.
31.
Sanger F, Nicklen S, Coulson AR. DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci
U S A. 1977;74:54635467.
32.
Agellon LB, Zhang P, Jiang XC, Mendelsohn L, Tall AR.
The CCAAT/enhancer-binding protein trans-activates the human
cholesteryl ester transfer protein gene promoter. J Biol
Chem. 1992;267:2233622339.
33. Di Lella A, Huang W, Woo S. Screening for phenylketonuria mutations by DNA amplification with the polymerase chain reaction. Lancet. 1988;8584:497499.
34.
Gaudet F, Ginsburg GS. Transcriptional regulation of
the cholesteryl ester transfer protein gene by the orphan nuclear
hormone receptor apoliporotein AI regulatory protein-1. J
Biol Chem. 1995;270:2991629922.
35.
Dignam JD, Lebovitz RM, Roeder RG. Accurate
transcription initiation by RNA polymerase II in a soluble extract from
isolated mammalian nuclei. Nucleic Acids Res. 1983;11:14751489.
36.
Ji L, Arcinas M, Boxer LM. The transcription factor,
Nm23H2, binds to and activates the translocated c-myc
allele in Burkitts lymphoma. J Biol Chem. 1995;270:1339213398.
37. Tiret L, Amouyel P, Rakotovao R, Cambien F, Ducimetière P. Testing for association between disease and linked marker loci: a log-linear-model analysis. Am J Hum Genet. 1991;48:926934.[Medline] [Order article via Infotrieve]
38. Nei M. Molecular evolutionary genetics. 1987.
39.
Hoppe KL, Francone OL. Binding and functional effects
of transcription factors Sp1 and Sp3 on the proximal human lecithin:
cholesterol acyltransferase promoter. J Lipid
Res. 1998;39:969977.
40.
Hall HGC, Miller G, Cruickshank K, Cooper JA, Humphries
SE, Talmud PJ. A common mutation in the lipoprotein lipase gene
promoter, -93 T/G, is associated with lower plasma
triglyceride levels and increased promoter activity in
vitro. Arterioscler Thromb Vasc Biol. 1997;17:19691976.
41.
Kennett SB, Udvadia AJ, Horowitz JM. Sp3 encodes
multiple proteins that differ in their capacity to stimulate or repress
transcription. Nucleic Acids Res. 1997;25:31103117.
42.
Yang WS, Deeb S. Sp1 and Sp3 transactivate the
human lipoprotein lipase gene promoter through binding to a CT element:
synergy with the sterol regulatory element binding protein and reduced
transactivation of a naturally occurring promoter variant. J
Lipid Res. 1998;39:20542064.
43.
Hata Y, Duh E, Zhang K, Robinson GS, Aiello LP.
Transcription factors Sp1 and Sp3 alter vascular
endothelial growth factor receptor expression through a
novel recognition sequence. J Biol Chem. 1998;273:1929419303.
44.
Long F, Sonenshein GE, Linsenmayer TF. Multiple
transcriptional elements in the avian type X collagen gene:
identification of Sp1 family proteins as regulators for high level
expression in hypertrophic chondrocytes. J Biol Chem. 1998;273:65426549.
45.
Chouinard RA, Luo Y, Osborne TF, Walsh A, Tall AR.
Sterol regulatory element binding protein-1 activates the
cholesteryl ester transfer protein gene in vivo but is not required for
sterol up-regulation of gene expression. J Biol Chem. 1998;273:2240922414.
46.
Fischer KD, Haese A, Nowock J. Cooperation of GATA-1
and Sp1 can result in synergistic transcriptional activation or
interference. J Biol Chem. 1993;268:2391523923.
47.
Ries S, Buchler C, Langmann T, Fehringer P, Aslanidis
C, Scmitz G. Transcriptional regulation of lysosomal acid lipase in
differentiating monocytes is mediated by transcription factors Sp1 and
AP-2. J Lipid Res. 1998;39:21252134.
48.
Shou Y, Baron S, Poncz M. An Sp1-binding silencer
element is critical negative regulator of the megakaryocyte specific
aIIb gene. J Biol Chem. 1998;273:57165726.
49.
Lopez-Rodriguez C, Botella L, Corbi AL.
CCAAT-enhancer-binding proteins (C/EBP) regulate the tissue specific
activity of the CD11c integrin gene promoter through functional
interactions with Sp1 proteins. J Biol Chem. 1997;272:2912029126.
50. Ginsburg GS, Ozer J, Karathanasis SK. Intestinal apolipoprotein AI gene transcription is regulated by multiple distinct DNA elements and is synergistically activated by the orphan nuclear receptor, hepatocyte nuclear factor 4. J Clin Invest. 1995;96:528538.
51. Hagen G, Muller S, Beato M, Suske G. Sp1 mediated transcriptional activation is repressed by Sp3. EMBO J. 1994;13:38433851.[Medline] [Order article via Infotrieve]
52.
Majello B, De Luca P, Lania L. Sp3 is a bifunctional
transcription regulator with modular independent activation and
repression domains. J Biol Chem. 1997;272:40214026.
53. Mann CJ, Yen FT, Grant AM, Bihain BE. Mechanism of plasma cholesteryl ester transfer in hypertriglyceridemia. J Clin Invest. 1991;88:20592066.
54.
Tato F, Vega GL, Grundy SM. Bimodal distribution of
cholesteryl ester transfer protein activities in
normotriglyceridemic men with low HDL
concentrations. Arterioscler Thromb Vasc Biol. 1995;15:446451.
55. Zhong S, Sharp DS, Grove JS, Bruce C, Yano K, Curb JD, Tall AR. Increased coronary heart disease in Japanese-American men with mutation in the cholesteryl ester transfer protein gene despite increased HDL levels. J Clin Invest. 1996;97:29172923.[Medline] [Order article via Infotrieve]
56. Hayek T, Masucci-Magoulas L, Jiang X, Walsh A, Rubin E, Breslow JL, Tall AR. Decreased early atherosclerotic lesions in hypertriglyceridemic mice expressing cholesteryl ester transfer protein transgene. J Clin Invest. 1995;20712074.
57.
Kuivenhoven JA, Jukema JW, Zwinderman AH, De Knijff P,
McPherson R, Bruschke AVG, Lie KI, Kastelein JP. The role of a common
variant of the cholesteryl ester transfer protein gene in the
progression of coronary atherosclerosis.
N Engl J Med. 1998;338:8693.
This article has been cited by other articles:
![]() |
A. Thompson, E. Di Angelantonio, N. Sarwar, S. Erqou, D. Saleheen, R. P. F. Dullaart, B. Keavney, Z. Ye, and J. Danesh Association of Cholesteryl Ester Transfer Protein Genotypes With CETP Mass and Activity, Lipid Levels, and Coronary Risk JAMA, June 18, 2008; 299(23): 2777 - 2788. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Y Li, C. Zhang, F. W Asselbergs, L. Qi, E. Rimm, D. J Hunter, and F. B Hu Interaction between dietary fat intake and the cholesterol ester transfer protein TaqIB polymorphism in relation to HDL-cholesterol concentrations among US diabetic men Am. J. Clinical Nutrition, November 1, 2007; 86(5): 1524 - 1529. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Porchay-Balderelli, F. Pean, N. Bellili, R. Jaziri, M. Marre, F. Fumeron, and for the DIABHYCAR Study Group The CETP TaqIB Polymorphism Is Associated With the Risk of Sudden Death in Type 2 Diabetic Patients Diabetes Care, November 1, 2007; 30(11): 2863 - 2867. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Spielmann, A. S. Leon, D. C. Rao, T. Rice, J. S. Skinner, C. Bouchard, and T. Rankinen CETP genotypes and HDL-cholesterol phenotypes in the HERITAGE Family Study Physiol Genomics, September 11, 2007; 31(1): 25 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Singer, H. Holdaas, A. G. Jardine, B. Fellstrom, I. Os, G. Bermann, J. M. Meyer, and on behalf of the Assessment of Lescol in Renal Tra Genetic analysis of fluvastatin response and dyslipidemia in renal transplant recipients J. Lipid Res., September 1, 2007; 48(9): 2072 - 2078. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Thompson, L. S. Wood, E. H. Pickering, B. DeChairo, and C. L. Hyde High-density genotyping and functional SNP localization in the CETP gene J. Lipid Res., February 1, 2007; 48(2): 434 - 443. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Borggreve, H. L. Hillege, B. H. R. Wolffenbuttel, P. E. de Jong, M. W. Zuurman, G. van der Steege, A. van Tol, R. P. F. Dullaart, and on behalf of the PREVEND Study Group An Increased Coronary Risk Is Paradoxically Associated with Common Cholesteryl Ester Transfer Protein Gene Variations That Relate to Higher High-Density Lipoprotein Cholesterol: A Population-Based Study J. Clin. Endocrinol. Metab., September 1, 2006; 91(9): 3382 - 3388. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Frisdal, A. H.E.M. Klerkx, W. L. Goff, M. W.T. Tanck, J.-P. Lagarde, J. W. Jukema, J. J.P. Kastelein, M. J. Chapman, and M. Guerin Functional interaction between -629C/A, -971G/A and -1337C/T polymorphisms in the CETP gene is a major determinant of promoter activity and plasma CETP concentration in the REGRESS Study Hum. Mol. Genet., September 15, 2005; 14(18): 2607 - 2618. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Borggreve, H. L. Hillege, B. H. R. Wolffenbuttel, P. E. de Jong, S. J. L. Bakker, G. van der Steege, A. van Tol, R. P. F. Dullaart, and on behalf of the PREVEND Study Group The Effect of Cholesteryl Ester Transfer Protein -629C->A Promoter Polymorphism on High-Density Lipoprotein Cholesterol Is Dependent on Serum Triglycerides J. Clin. Endocrinol. Metab., July 1, 2005; 90(7): 4198 - 4204. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. B. Lloyd, M. E. Lira, L. S. Wood, L. K. Durham, T. B. Freeman, G. M. Preston, X. Qiu, E. Sugarman, P. Bonnette, A. Lanzetti, et al. Cholesteryl Ester Transfer Protein Variants Have Differential Stability but Uniform Inhibition by Torcetrapib J. Biol. Chem., April 15, 2005; 280(15): 14918 - 14922. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.M. Boekholdt, F.M. Sacks, J.W. Jukema, J. Shepherd, D.J. Freeman, A.D. McMahon, F. Cambien, V. Nicaud, G.J. de Grooth, P.J. Talmud, et al. Cholesteryl Ester Transfer Protein TaqIB Variant, High-Density Lipoprotein Cholesterol Levels, Cardiovascular Risk, and Efficacy of Pravastatin Treatment: Individual Patient Meta-Analysis of 13 677 Subjects Circulation, January 25, 2005; 111(3): 278 - 287. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. J. de Grooth, A. H. E. M. Klerkx, E. S. G. Stroes, A. F. H. Stalenhoef, J. J. P. Kastelein, and J. A. Kuivenhoven A review of CETP and its relation to atherosclerosis J. Lipid Res., November 1, 2004; 45(11): 1967 - 1974. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.C. Shoulders, E.L. Jones, and R.P. Naoumova Genetics of familial combined hyperlipidemia and risk of coronary heart disease Hum. Mol. Genet., April 1, 2004; 13(90001): R149 - 160. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D Tobin, P. S Braund, P. R Burton, J. R Thompson, R. Steeds, K. Channer, S. Cheng, K. Lindpaintner, and N. J Samani Genotypes and haplotypes predisposing to myocardial infarction: a multilocus case-control study Eur. Heart J., March 2, 2004; 25(6): 459 - 467. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J Freeman, N. J Samani, V. Wilson, A. D McMahon, P. S Braund, S. Cheng, M. J Caslake, C. J Packard, D. Gaffney, and on behalf of the West of Scotland Study Group A polymorphism of the cholesteryl ester transfer protein gene predicts cardiovascular events in non-smokers in the West of Scotland Coronary Prevention Study Eur. Heart J., October 2, 2003; 24(20): 1833 - 1842. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Boekholdt and J. F. Thompson Natural genetic variation as a tool in understanding the role of CETP in lipid levels and disease J. Lipid Res., July 1, 2003; 44(6): 1080 - 1093. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Le Goff, M. Guerin, L. Petit, M. J. Chapman, and J. Thillet Regulation of human CETP gene expression: role of SP1 and SP3 transcription factors at promoter sites -690, -629, and -37 J. Lipid Res., July 1, 2003; 44(7): 1322 - 1331. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Blankenberg, H. J. Rupprecht, C. Bickel, X.-C. Jiang, O. Poirier, K. J. Lackner, J.u. Meyer, F. Cambien, L. Tiret, and AtheroGene Investigators Common genetic variation of the cholesteryl ester transfer protein gene strongly predicts future cardiovascular death in patients with coronary artery disease J. Am. Coll. Cardiol., June 4, 2003; 41(11): 1983 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Anderson and J. F. Carlquist Genetic polymorphisms of hepatic lipase and cholesteryl ester transfer protein, intermediate phenotypes, and coronary risk: Do they add up yet? J. Am. Coll. Cardiol., June 4, 2003; 41(11): 1990 - 1993. [Full Text] [PDF] |
||||
![]() |
W. Le Goff, M. Guerin, M. J. Chapman, and J. Thillet A CYP7A promoter binding factor site and Alu repeat in the distal promoter region are implicated in regulation of human CETP gene expression J. Lipid Res., May 1, 2003; 44(5): 902 - 910. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. V. van Venrooij, R. P. Stolk, J.-D. Banga, T. P. Sijmonsma, A. van Tol, D. W. Erkelens, and G. M. Dallinga-Thie Common Cholesteryl Ester Transfer Protein Gene Polymorphisms and the Effect of Atorvastatin Therapy in Type 2 Diabetes Diabetes Care, April 1, 2003; 26(4): 1216 - 1223. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Barter, H. B. Brewer Jr, M. J. Chapman, C. H. Hennekens, D. J. Rader, and A. R. Tall Cholesteryl Ester Transfer Protein: A Novel Target for Raising HDL and Inhibiting Atherosclerosis Arterioscler. Thromb. Vasc. Biol., February 1, 2003; 23(2): 160 - 167. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.C. Mahaney, L. Almasy, D.L. Rainwater, J.L. VandeBerg, S.A. Cole, J.E. Hixson, J. Blangero, and J.W. MacCluer A Quantitative Trait Locus on Chromosome 16q Influences Variation in Plasma HDL-C Levels in Mexican Americans Arterioscler. Thromb. Vasc. Biol., February 1, 2003; 23(2): 339 - 345. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H.E.M. Klerkx, M. W.T. Tanck, J. J.P. Kastelein, H. O.F. Molhuizen, J. W. Jukema, A. H. Zwinderman, and J. A. Kuivenhoven Haplotype analysis of the CETP gene: not TaqIB, but the closely linked -629C->A polymorphism and a novel promoter variant are independently associated with CETP concentration Hum. Mol. Genet., January 15, 2003; 12(2): 111 - 123. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Bansal, D. van den Boom, S. Kammerer, C. Honisch, G. Adam, C. R. Cantor, P. Kleyn, and A. Braun Association testing by DNA pooling: An effective initial screen PNAS, December 24, 2002; 99(26): 16871 - 16874. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Nagano, S. Yamashita, K.-i. Hirano, M. Ito, T. Maruyama, M. Ishihara, Y. Sagehashi, T. Oka, T. Kujiraoka, H. Hattori, et al. Two novel missense mutations in the CETP gene in Japanese hyperalphalipoproteinemic subjects: high-throughput assay by Invader (R) assay J. Lipid Res., July 1, 2002; 43(7): 1011 - 1018. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Brousseau, J. J. O'Connor Jr, J. M. Ordovas, D. Collins, J. D. Otvos, T. Massov, J. R. McNamara, H. B. Rubins, S. J. Robins, and E. J. Schaefer Cholesteryl Ester Transfer Protein TaqI B2B2 Genotype Is Associated With Higher HDL Cholesterol Levels and Lower Risk of Coronary Heart Disease End Points in Men With HDL Deficiency: Veterans Affairs HDL Cholesterol Intervention Trial Arterioscler. Thromb. Vasc. Biol., July 1, 2002; 22(7): 1148 - 1154. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |