© 2000 American Heart Association, Inc.
Atherosclerosis and Lipoproteins |
Involvement of Oxysterols and Lysophosphatidylcholine in the Oxidized LDL–Induced Impairment of Serum Albumin Synthesis by HEPG2 Cells
Presented in part at 5th Multiple Risk Factors in Cardiovascular Disease, Venice, Italy, October 1999.
From INSERM U498 (E.B., N.L., D.B.), Biochimie des Lipoprotéines et Interactions Vasculaires, Université de Bourgogne, Dijon, France, and the Hyperlipidemia and Atherosclerosis Research Group (J.D., L.B.), Clinical Research Institute of Montreal, Quebec, Canada.
Correspondence to Dr Denis Blache, INSERM U498, Biochimie des Lipoprotéines et Interactions Vasculaires, Faculté de Médecine, Université de Bourgogne, 7, Bd Jeanne d’Arc, 21033 Dijon, France. E-mail dblache{at}u-bourgogne.fr
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Oxidized low density lipoproteins (Ox-LDLs) are increasingly thought to be a key element in atherogenesis. We have previously reported that serum albumin has important antioxidant properties and that a reduced synthesis of albumin may represent a crucial point in the overall antioxidant defense. In the present work, we aimed at determining whether Ox-LDL could modulate albumin synthesis in cultured human hepatocytes (HepG2 cells). With the use of enzyme immunoassay and radiolabeled leucine incorporation followed by specific immunoprecipitation, Ox-LDL was found to lead to a dose-dependent decrease in albumin secretion. Moreover, the protein synthesis and mRNA levels were decreased in the presence of Ox-LDL, as assessed by Northern blot analysis. Because oxysterols and lysophospholipids are key components of Ox-LDL, we tested the effects of oxysterols (7-ketocholesterol and 25-hydroxycholesterol) and lysophosphatidylcholine on albumin secretion and expression. In our experimental conditions, we found that incubations with oxysterols or lysophosphatidylcholine at pathophysiological concentrations similar to those measured in Ox-LDLs reproduced the above-mentioned inhibitory effects on albumin synthesis. On the basis of our in vitro data, we propose that this newly described biological effect of Ox-LDL might partly explain the findings of epidemiological studies indicating that reduced levels of serum albumin are associated with increased mortality.
Key Words: oxidant stress • lipid peroxidation • liver • atherosclerosis
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Oxidant stress is increasingly thought to be a key element in atherogenesis. Atherosclerosis is a complex multifactorial disease caused by an excessive accumulation of lipids in the vascular wall. These lipids are essentially found in foam cells, which result from the transformation of smooth muscle cells and macrophages.1 By damaging the lipids contained in LDLs, free radicals generate proatherogenic oxidized particles.2 3 These antioxidant-depleted oxidized lipid–enriched lipoproteins accumulate polyunsaturated fatty acid breakdown substances that secondarily react with the apoB of LDL. These modified LDLs are no longer recognized by their classic LDL receptors but by scavenger receptors, which are not downregulated by excess cholesterol.4 This oxidative stress hypothesis is reinforced by data provided by various studies on the beneficial effects of lipid-soluble antioxidants.5 6 7 Indeed, although a precise cause-and-effect relationship between the susceptibility of LDL to oxidation and the potential benefits of antioxidant therapy with respect to vascular lesion development and/or reduction has not yet been established, particularly in clinical trials, studies in animals and humans indicate that supplementation with antioxidants increases the resistance of LDL to oxidation.
Among compounds formed during oxidation are the products of cholesterol auto-oxidation (oxysterols).8 Oxysterols are found in foods,9 human lipoproteins,10 and various tissues.11 They have a wide range of biological effects, all of which may be of importance for atherosclerosis.12 Oxysterols have been shown to inhibit cholesterol biosynthesis by downregulating the activity of 3-hydroxy-3-methylglutaryl coenzyme A reductase (EC 1.1.1.34), to decrease the number of LDL receptors on cells, to enhance cholesterol ester accumulation by activation of acyl coenzyme A:cholesteryl acyltransferase (EC 2.3.1.26), to alter membrane permeability,13 to modulate platelet function,14 and to induce experimental atherosclerosis.15
Lysophospholipid is also one of the active molecules generated during oxidative modification of LDL. Lysophosphatidylcholine (LPC) has been reported to mediate several of the proinflammatory effects of oxidized LDL (Ox-LDL), to stimulate smooth muscle cell proliferation, and to induce several endothelial genes expressed in the atherosclerotic arterial wall.16 17 LPC, which has also been identified in experimentally induced atherosclerotic lesions in animals, has been shown to be chemotactic.18
Albumin represents the most abundant serum protein, with normal concentrations lying between 35 and 50 g/L. Many epidemiological studies have established an inverse relationship between serum albumin level and mortality risk. In diseased populations as well as in the general population, it has been estimated that the odds of death increases from 24% to 56% for each 2.5-g/L decrement in the initial albumin level (see review19 ). This association holds also for cardiovascular disease after adjustment for the usual risk factors.20 Among a variety of biological mechanisms that have been proposed to explain the beneficial effects of higher albumin concentrations, a direct protective effect of the albumin molecule has been suggested. There is now evidence for a significant antioxidant activity of serum albumin. In fact, this molecule may represent the major and predominant circulating antioxidant in plasma that is known to be exposed to continuous oxidative stress.21 Albumin may thus represent a quantitatively important component of the efficient antioxidant defense that organisms have developed to protect against oxidative attack.22 Moreover, our recent data bring further support to the proposal that in addition to its plasma concentration, the quality of the albumin molecule may be related to its biological properties.23 We reported that glucose and free radicals impair the antioxidant properties of serum albumin. The serum level of albumin is mainly related to its synthesis and catabolism but also to its transcapillary escape. Variation in albumin concentration may reflect variation in the nutritional state. In fact, only a small number of factors are known to result in variation in serum albumin. Beside analbuminemia, a rare congenital disease,24 the nephrotic syndrome is the main pathological situation known to lower albumin concentration.25 In addition, it has been reported that serum albumin concentration decreases with age and cigarette smoking,20 2 well-documented oxidative-related conditions.
In the present work, we first investigated the effects of native LDL (N-LDL) and modified LDL on albumin synthesis in the human hepatoma cell line, HepG2. We found that contrary to incubation with N-LDL and acetylated LDL (Ac-LDL), only incubation with oxidatively modified LDL drastically reduced albumin secretion. We then examined the effects of some lipid oxidation products found in oxidized lipoproteins, such as oxysterols and LPC, on albumin synthesis and mRNA expression.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cell Culture
HepG2 cells were grown in a CO2 incubator (5% CO2/95% air) in a 75-cm2 flask (Polylabo). Cultures were maintained in 20 mL DMEM (GIBCO) containing 10% FCS, 1.25% L-glutamine, and 2% penicillin/streptomycin. About 5 or 6 days before each experiment,
1 million cells were
seeded in 6-well tissue clusters (Costar) in 3 mL DMEM containing 10%
FCS. Incubations were performed in 10% lipoprotein-deficient FCS
(LPDS) and with the indicated amounts of LDL preparations or various
molecules. Cell viability was assayed by using lactate dehydrogenase
(LDH) released in the medium (Sigma, procedure
500).
LDL Preparation and Modification
LDLs (1.019 to 1.055 g/mL) were isolated by
sequential ultracentrifugation of pooled plasma from
normolipidemic subjects (Beckman centrifuge). After dialysis
against PBS (pH 7.4), LDLs were assayed for protein content with
bicinchoninic acid (Pierce). Ox-LDLs were obtained by incubating 100
µg/mL protein LDL with 25 µmol/L CuSO4 at
37°C overnight. Ac-LDLs were prepared from N-LDLs by the addition of
acetic anhydride in the presence of cold saturated sodium
acetate.26 LDL
integrity or modifications were evaluated by determining (1) the
content of thiobarbituric acid–reactive substances, (2) lipid
peroxides by using the iodine
reagent,27 and (3)
the chromophore fluorescence at 430 nm after excitation at 355
nm.2 Agarose gel
electrophoresis (0.5%) was performed with a Beckman Paragon
lipoprotein electrophoresis
kit.28 Before use,
LDLs were dialyzed against high-glucose or leucine-poor DMEM (5% of
the leucine of the normal medium).
Cholesterol, Oxysterols, and Fatty
Acid Analysis
Sterols and oxysterols were obtained from Sigma or
Steraloids, except for 7
- and 7ß-cholesterol, which
were synthesized as described in our previous
study.29 When
necessary (purity <95%), the oxysterols were repurified by thin-layer
chromatography on silica gel–impregnated plates
(Merck) with hexane/ethyl acetate (70:30 [vol/vol]), and purity was
checked by gas
chromatography.29
Oxysterols were added to cell media in ethanol (0.05%, final concentration). After incubation with oxysterols (usually for 14 hours at 5 µg/mL), cells were thoroughly washed with PBS. Total lipid extracts were carried out according to Folch et al30 and analyzed according to our previous technique.29
Studies on Secretion of HSA by HepG2
Cells
Assay of HSA by ELISA
Samples of culture medium were assayed for human
serum albumin (HSA) by a competitive ELISA that made use
of a specific peroxidase-conjugated rabbit antihuman albumin
(Dako). The ELISA was linear over a concentration range of 0.15 to 20
µg/mL of HSA with an intraplaque variation coefficient that did not
exceed 6% and with a correlation coefficient >0.990. The
concentration of HSA was expressed as micrograms per microgram of
cellular
DNA.31
Immunoprecipitations
For immunoprecipitation studies, incubation was
performed in leucine-poor DMEM (5% of the leucine of normal medium)
containing 5 µCi/mL [3H]leucine
(Amersham). The antibody was a rabbit monospecific anti-human
albumin antibody (Dako). In brief, medium was first precleared
by 1 hour of incubation with 100 µL washed protein A Sepharose (10
mg/mL, Pharmacia). After centrifugation, 100 µL of
the medium was added to 200 µL PBS and 100 µL anti-HSA antibodies
(1:20 dilution). After a 1-hour incubation on ice, 100 µL of protein
A Sepharose (10 mg/mL) was added to Net buffer, which contained 30
mmol/L Tris-HCl, 150 mmol/L NaCl, 0.5% (vol/vol) NP-40, and
2 mmol/L EDTA (pH 8). The precipitated HSA-immunocomplex was
isolated by centrifugation. After 3 washes in Net
buffer, pellets were dissolved in glycine buffer (0.1 mol/L, pH 3), and
an aliquot was used for radioactivity assay. The incorporation of
[3H]leucine in albumin was
expressed as disintegrations per minute per microgram cellular DNA. The
specificity of this immunoprecipitation technique was examined by
analyzing HSA immunocomplexes by 12% SDS-PAGE.
Pulse Labeling
In pulse-chase protocol, and for each sample, two
6-well plates (plate A for pulse labeling and plate B for pulse-chase
labeling) were seeded with HepG2 cells. The cells were grown in
DMEM/FCS until they reached confluence, and each plate was washed with
PBS. DMEM with 10% LPDS containing 200 µg/mL native LDL, Ac-LDL, or
Ox-LDL was added, and incubation was continued for 14 hours. The medium
was then removed, and cells were incubated for 20 minutes in
leucine-depleted DMEM. Thereafter, leucine-poor medium containing 5
µCi/mL [3H]leucine was added for pulse
labeling for a 15-minute incubation period. After pulse labeling of
plate A, the medium was removed, and the cells were washed with cold
PBS. After being pelleted, the cells were mixed with 1 mL lysis buffer
containing 100 µL 10x protease-inhibitor mix (PIM,
containing 186 mg EDTA, 35 mg phenylmethylsulfonyl fluoride, 1
mg antipain, and 1 mg pepstatin A per 50 mL) and 250 µL 5-fold
concentrated PBS-TDS (containing 47.25 g NaCl, 7 g
Na2HPO4, 1.08 g
KH2PO4, 5 mL Triton
X-100, and 2.5 g desoxycholate). After
centrifugation for 5 minutes at 4000g,
the supernatants were kept frozen at -20°C for later
analysis. After pulse labeling of plate B, the hot medium was
removed, and the cells were washed with DMEM and then incubated for 2
hours with DMEM–10% LPDS containing 200 µg/mL N-LDL, Ac-LDL, or
Ox-LDL (chase incubation). Then the cells were mixed/lysed with
PBS-TDS/PIM as described above. The medium was collected and
centrifuged (5 minutes, 4000g), and 900 µL
of the medium was mixed with 100 µL of 10x PIM. After pretreatment
with protein A Sepharose, the media and cell extracts were subjected to
immunoprecipitation as described above.
Quantification of HSA and GAPDH mRNA in HepG2
Cells
Total cellular RNA was isolated from cells with
Trizol reagent (Pharmacia). Northern blots were performed as described:
20 µg total RNA in 7 µL DEPC water was mixed with 26 µL sample
mix containing 3 µL 10x MOPS, 6 µL formaldehyde, and 17 µL
formamide. After 15 minutes at 55°C, samples were loaded with 10 µL
formaldehyde loading buffer. Electrophoresis was performed in a 1%
agarose gel containing 10x MOPS and formaldehyde (15 and 27 mL,
respectively, in 108 mL deionized water). Transfer to nylon membrane
(0.45 µm, Amersham) was realized by capillarity overnight. After
being washed and UV-fixed (Stratagene), membranes were stored and dried
at room temperature before analysis.
A 258-bp HSA DNA fragment was amplified from human cDNA
obtained from HepG2 cells by using the oligonucleotides
5'ATG ACAACCCAAACCTCCCC3' and 5'CCTACTTCTCCCCT GAAGCA3'. The HSA DNA
fragment was ligated into the multiple cloning site of the vector
pGEM-T (Promega) SphI plus SalI for
the digestion of the cloned fragment and sequenced with the
Thermosequenase dye terminator cycle sequencing premix kit (Amersham).
The same procedure was used for GAPDH by using the
oligonucleotides 5'GGAAGGTGAAGGTCGGAGTC3' and
5'GGATGAAGGGAAGGCTTCGT3' (SacI plus
PstI). Probes were created by labeling DNA fragments
with [-32P]dCTP by use of a random
priming kit (Boehringer). Membranes were prehybridized for 3
hours at 42°C in buffer (50% formamide, 5x Denhardt’s solution,
5x SSPE, 0.1% SDS, and 100 µg/mL salmon sperm DNA). Hybridization
was carried out overnight at 42°C in the same buffer to which
1.106 cpm/mL boiled probe was added.
Finally, the membranes were washed 2 times in 6x SSPE/0.5% SDS at
room temperature during 15 minutes, 2 times in 1x SSPE/0.5% SDS at
37°C during 15 minutes, and 1 time in 0.1x SSPE/0.1% SDS at 65°C.
After film exposure (Kodak X-oMat) and development, radioactive signals
were quantified by using Bio1D Software (Vilber-Lourmat). In several
occasions, digoxigenin labeling was also used according to the
manufacturer’s instructions
(Boehringer).
Statistical Analyses
Data are expressed as mean±SD of at least 3
experiments performed in triplicate. Differences between group means
were compared by using either the unpaired Student t
test for single comparisons or 1-way ANOVA (followed by the Bonferroni
test) for multiple
comparisons.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Preliminary studies confirmed previous data32 indicating that HSA was best secreted into the medium when cells reached confluence. Time-course studies of the effects of the various LDL preparations on HSA secretion by confluent HepG2 cells measured by ELISA are illustrated in Figure I (which can be accessed online at http://atvb.ahajournals.org). In the presence of 150 µg/mL N-LDL, we observed a significant decrease in HSA compared with control (no LDL), which reached statistical significance (P<0.05) only for long (48-hour) incubation times, whereas a marked inhibitory effect of Ox-LDL was obtained as soon as 8 hours (-22%, P=0.07). The tested LDL concentrations were chosen to be representative of what is encountered in patients with coronary heart disease.33 It is noteworthy that the secretion was linear for the entire time period studied, with diminishing production rates of 108, 87, and 70 ng/µg per hour for control, N-LDL, and Ox-LDL, respectively. The effect of LDL oxidation on HSA production rate was highly significant (P<0.001). Conversely, the time dependence of incubations with Ac-LDL led to results similar to those obtained for N-LDL (not shown).
Results of a 14-hour incubation with 2 different amounts of
the various LDL preparations on HSA secretion
(Figure 1
) show that the inhibitory effect of
Ox-LDL was dose dependent: -21% and -45% for 100 and 200 µg/mL,
respectively. Under the same incubation conditions (14 hours), Ac-LDL
induced a decrease (-24%) in the secretion of HSA only at a
concentration of 200 µg/mL.
|
Additional experiments were designed to examine this HSA
secretion by measuring the incorporation of
[3H]leucine into HSA secreted into the
medium. As assessed by specific immunoprecipitation
(Figure 2), a significant concentration-dependent decrease in
secretion (-23% and -34%, respectively; P<0.05;
n=6) was found in the presence of 100 and 200 µg/mL protein of Ox-LDL
compared with N-LDL. No significant decrease was noted with 200 µg/mL
Ac-LDL.
|
Total protein synthesis was measured by trichloroacetic acid precipitation of HepG2 cells incubated with the various LDL preparations after [3H]leucine incorporation (Figure II, which can be accessed online at http://atvb.ahajournals.org). The results show that the total proteins synthesized did not change with 200 µg/mL but, in contrast, increased at 100 µg/mL. Theses results confirm the data obtained with LDH release indicating no change between N-LDL and Ox-LDL (Figure II, which can be accessed online at http://atvb.ahajournals.org). This demonstrates clearly that the Ox-LDL–mediated reduction in HSA secretion was specific and not the result of some general toxic effect affecting protein synthesis.
To assess whether Ox-LDL directly affects the rate of
protein synthesis and/or intracellular protein turnover, pulse-chase
experiments were conducted. The cells were first incubated for 14 hours
with or without modified LDL, then washed, and pulse-labeled for 15
minutes with [3H]leucine (pulse); the
label was then removed, and the cells were either directly processed
for synthesized proteins or further incubated for 2 hours in fresh
medium without label (chase). As shown in the
Table,
incorporation of label into HSA during the pulse was lower in cells
preincubated with Ox-LDL than in cells incubated with N-LDL (-22%,
P<0.01; n=6). After the chase incubation, the
labeling of HSA in the medium was lower (-35% versus N-LDL,
P<0.05; n=6) than when cells were preincubated with
Ox-LDL. This loss was accounted by a decrease in HSA synthesis because
no variation in cellular degradation of HSA (chase as percentage of
pulse) was observed in cells preincubated with Ox-LDL. These data
clearly indicated that Ox-LDLs lead to a reduced synthesis of HSA
rather than an increase in its degradation.
|
To explore the mechanisms by which Ox-LDL decreases HSA
synthesis, we then studied their effects on the level of HSA mRNA by
Northern blot analysis. After 14 hours of incubation in the
presence of 100 or 200 µg/mL Ox-LDL, we found that HSA mRNA levels
relative to GAPDH mRNA were decreased by 34%
(P<0.05) and 46% (P<0.01),
respectively
(Figure 3A and 3B). Comparison analysis indicated
that under our conditions, N-LDL tended to enhance the HSA/GAPDH mRNA
ratio, whereas Ac-LDL slightly inhibited it, particularly at 200
µg/mL.
|
To further understand the difference between the various LDL
preparations used, oxidation parameters were
analyzed (Table
I, which can be accessed online at
http://atvb.ahajournals.org). Our data confirm that Ac-LDLs and
copper-oxidized LDLs have enhanced electrophoretic mobility, relative
to that of N-LDLs. Ox-LDLs also have significantly higher conjugated
dienes, lipoperoxides, and thiobarbituric acid–reactive substances
than do Ac-LDLs and N-LDLs. The level of the chromophore (excitation
355 nm, emission 430 nm) that resulted from the reaction of aldehydic
lipid peroxidation products with free amino groups of apoB was
strongly enhanced in Ox-LDLs. The lipid composition, summarized in
Table II (which can be accessed online at http://atvb.ahajournals.org),
indicated that no significant change in Ac-LDL occurred compared with
N-LDL, whereas the unsaturation index of Ox-LDL phospholipids was
markedly diminished. The total phospholipids were decreased,
whereas a significant increase in LPC was observed in Ox-LDL (>15
times). These changes were also associated with a significant decrease
in total cholesterol and a marked appearance of various
oxysterols. In particular, as assessed by gas
chromatography, we found that 7ß-OH
cholesterol, 25-OH cholesterol,
7-ketocholesterol, -epoxy-cholesterol, and
cholestanetriol, became massively present in Ox-LDLs.
These data led us to propose that the lipid moiety may play
a role in the Ox-LDL–induced decrease in HSA expression. To further
examine which lipid fraction would be responsible for this activity,
lipids were extracted from N-LDL and Ox-LDL and separated as previously
described.29 These
experiments were carried out under an oxygen-deprived atmosphere
enriched with argon to protect isolated fractions from artifactual
oxidation. Results of incubations with these various lipid fractions on
HSA secretion by HepG2 cells were analyzed by radioleucine
incorporation and immunoprecipitation and are described in Table III
(which can be accessed online at http://atvb.ahajournals.org). We found
that only the lipid fraction extracted from Ox-LDL was active as
compared with that from N-LDL (not shown). The sterol- and the
phospholipid-containing fractions, in concentrations encountered in
lipoproteins, were able to inhibit the HSA secretion and to reproduce
the inhibition observed with Ox-LDL. Furthermore, inhibitions of HSA
biosynthesis occurred when cells were incubated with LPC (2 µg/mL)
and 7-ketocholesterol (5 µg/mL) in amounts equivalent to
what was measured in 100 µg/mL Ox-LDL (Table III, which can be
accessed online at http://atvb.ahajournals.org). These results suggest
that oxysterols, which are present in high amounts in the
sterol-containing fraction, might be the active components involved in
the Ox-LDL–mediated impairment of HSA biosynthesis and secretion. To
examine this hypothesis, the HSA secretion by HepG2 cells was then
studied after incubations with some oxysterols, such as those oxidized
either on the sterol ring or on the side chain. As seen in Table III
(which can be accessed online at http://atvb.ahajournals.org), the
oxysterol concentration found in Ox-LDL was 9 µg per 100 µg LDL
proteins. Therefore, incubations were carried out for 14 hours with 5
to 10 µg/mL of each with ethanol used as a vehicle. The results
(Figure 4) indicate that contrary to cholesterol,
the different oxysterols, oxidized either on the sterol ring or on the
side chain, all reduced HSA secretion by 16% to 32%, as assessed by
ELISA, with no evident structure-activity relationship. Similar
results, confirming those obtained in
Figure 4, were obtained when HSA production was
measured by radiolabeled leucine incorporation and specific
immunoprecipitation (not shown). Furthermore, we have measured
oxysterol incorporation into HepG2 cells after a 14-hour incubation.
Our results indicated that oxysterols did incorporate into cells but in
variable amounts (ranging from 16% to 33%), and we found a
significant inverse correlation (P<0.0025) between
levels incorporated and HSA production, as illustrated by the
plot of Figure III (which can be accessed online at
http://atvb.ahajournals.org).
|
Northern blot analysis of the HSA mRNA performed for
LPC and some oxysterols (25-OH and 7-ketocholesterol)
indicated that HSA transcripts were reduced in a dose-dependent manner
relative to GAPDH mRNA
(Figure 5A). Cholesterol has no effect compared
with control incubations. These observations were confirmed by
densitometric quantification of RNA
(Figure 5B).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The purpose of the present study was to examine the influence of Ox-LDL on HSA secretion by liver cells to determine whether HSA concentration in plasma is directly associated with mortality risk. We demonstrate that Ox-LDL impairs HSA secretion and synthesis. We also report that some components found in Ox-LDL, such as oxysterols and LPC, are able to reproduce these effects in vitro.
There is now ample evidence of a significant antioxidant activity by serum albumin.21 23 Thus, albumin may represent a quantitatively important component in the efficient antioxidant defense that organisms have developed to protect against oxidative attack.22 The beneficial effects of high albumin concentrations hold also for cardiovascular disease after adjustment for the usual risk factors.20
Most in vitro studies dealing with cell interactions with Ox-LDL have been performed with circulating, endothelial, or vascular cells. In the present study, we report on the effects of Ox-LDL on HSA synthesis by liver cells. Using the human hepatoma-derived cell line HepG2, we found a significant dose-dependent decrease in HSA secretion on incubations with Ox-LDL. This altered synthesis was observed for short incubation times (8 hours). It was not the result of an overall cytotoxic effect, because no change in cell viability was observed, and it was not accompanied by LDH release and by a reduction in total protein synthesis and secretion (Figure II, which can be accessed online at http://atvb.ahajournals.org), as assessed by normal leucine incorporation. Moreover, these effects on HSA secretion were observed with only 100 µg/mL of Ox-LDLs, which constitute a level commonly encountered in dyslipoproteinemic patients.33 This strengthens the pathophysiological relevance of the findings because it may be possible that liver cells are exposed to such conditions.
Ox-LDLs can promote or suppress expression of different
genes. For example, Ox-LDL suppresses the expression of tumor necrosis
factor- and interleukin-1 in murine peritoneal
macrophages and platelet-derived growth factor in human
monocytes in
cultures.34 These
effects have been convincingly linked to oxidized forms of LDL, whereas
N-LDL, Ac-LDL, and malondialdehyde-modified LDL were all inactive. More
recently, mildly oxidized LDL has been reported to enhance the genetic
expression of extracellular matrix
protein35 and
transcription
factors.36 A number
of studies also showed that mildly oxidized LDL has important
proinflammatory properties that may be responsible for the induction of
important inflammatory genes, such as the expression of chemotactic
factors, colony-stimulating factors, and tissue factor
genes.37 38
The products of these genes are known to control recruitment,
differentiation, and growth of a number of different cell types found
in the artery.39 In
our experimental conditions, the decrease in albumin secretion
observed especially with Ox-LDL is due to a decrease in HSA synthesis
caused by a reduced level of mRNA encoding for the protein.
During the oxidation process, the various lipids of the LDL
particle undergo modification, and an array of oxidation products
are generated. Not only do the polyunsaturated fatty acids become
oxidized, leading to peroxides, aldehydes, and hydroxy fatty acids, but
also part of the cholesterol is transformed into
oxysterols, and phospholipids are transformed into lysoderivatives
(Table II, which can be accessed online at
http://atvb.ahajournals.org). Several of these compounds have important
biological properties related to the alteration of vascular lipid
metabolism. Cytotoxicity and chemotactic activity have been
reported for oxysterols, LPC, and
4-hydroxynonenal.14 40 41
Not surprisingly, many of the various proatherogenic and cell-injuring
capacities of Ox-LDL have been attributed to a vast array of these
products.
We confirm that LPC is abundant in Ox-LDL, and the presence
of this lysoderivative has also been reported in atherosclerotic
plaque.42 LPC is
supposed to be generated by the hydrolysis of phosphatidylcholine via
LDL-associated phospholipase A2
activity.43 We have
also recently proposed that LPC present in LDL might result from
the activity of secretory phospholipase A2
released after platelet
activation.44 Several
research groups have demonstrated that LPC alters various
endothelial functions and induces several
endothelial genes expressed in the atherosclerotic
arterial wall. Reports describe the induction of
intracellular adhesion molecule-1, macrophage chemoattractant
protein-1, cyclooxygenase-2, and growth factors in
endothelial
cells,16 17
possibly through modulation of transcription of nuclear factor 
B via
a protein kinase C–mediated
pathway.45 However,
some reports suggest that Ox-LDL has opposing effects on the activities
of transcription factor activator protein-1, suggesting
involvement of mechanisms for transcriptional regulation that are
strongly affected by oxysterols rather than
LPC.36 In the
present study, we report that a low concentration of LPC,
compatible with that found in Ox-LDL from patients, was able to
downregulate the HSA biosynthesis and secretion in HepG2
cells.
In our experimental conditions, inhibitory
effects of Ox-LDL on albumin synthesis were reproduced with the
same concentration of oxysterols found in these modified lipoproteins.
Furthermore, we found that oxysterols were incorporated into HepG2
cells, and a significant inverse relationship has been established
between cellular oxysterols after incubation and HSA secretion (Figure
III). Although no simple structure-function relation has been
successfully established between oxysterols and HSA secretion, these
data also indicate that effects of oxysterols may be related not only
to their concentrations but also to their specific incorporation in
relation to their physicochemical properties. The mechanism for the
downregulation of HSA synthesis appears to be at the transcriptional
level, because we found a decrease in the corresponding mRNA. Although
specific experiments have to be performed to understand the precise
effects of oxysterols in HSA secretion, several in vitro experiments
have already shown that oxysterols can reduce protein expression and
mRNA levels in cultured
cells.46 47
Different transcription factors have been shown to be involved in the
sterol-mediated regulation of genes involved in cholesterol
homeostasis. Most extensive studies have been carried out on the sterol
regulatory element binding proteins 1 and 2, which are responsible for
the sterol-mediated suppression of the LDL receptor,
3-hydroxy-3-methylglutaryl coenzyme A synthase, and fatty acid synthase
genes.48 49
More recently, a new class of oxysterol receptors, the liver X nuclear
receptor, was shown to be activated by oxysterols, including
7-OH, 25-OH, and 22(R)-OH
cholesterol.50 51
Although several transcription factors (hepatocyte nuclear
factors) are involved in the regulation of HSA gene expression, no data
are available on the effects of compounds from Ox-LDL on this
regulatory pathway. The albumin promoter is well known to
interact with the hepatocyte nuclear factor-1 transcription
factor, which plays a pivotal role in mediating liver-specific
transcription of the
gene.52 Further
specific studies should be addressed to determine whether sterol
regulatory element binding protein 1 or 2 can interact with the
albumin promoter or whether Ox-LDLs, lysoderivatives, and
oxysterols can affect hepatocyte nuclear factor-1 levels in
HepG2 cells.
It is tempting to extrapolate our findings to in vivo situations. Among the great number of pathologies possibly related to an alteration of the redox status, only a few, such as diabetes, have been linked to reduced transcription of the albumin gene in experimental models.52 Moreover, when albuminuria occurs, such as in the nephrotic syndrome, hypoalbuminemia might actually be in part due to an inability of the liver to increase its albumin synthesis. These situations, which are related to a decrease in the antioxidant defense, could be due to the presence of high levels of circulating Ox-LDLs.25 53 This is also in line with observations that serum albumin decreases with age and cigarette smoking, 2 other situations well characterized by enhanced free radical attack.20 54 55
In conclusion, Ox-LDLs induce a dose-dependent and significant decrease of albumin synthesis in HepG2 cells. This effect can be ascribed to oxysterols and LPC. Therefore, we propose that the occurrence of Ox-LDLs can be involved in the reduced synthesis of HSA that is often observed in hypercholesterolemia and diabetes. We are currently investigating this hypothesis in in vivo situations with the use of several models of high levels of circulating Ox-LDLs. Our results also demonstrate that antioxidants, by limiting the noxious influence of Ox-LDLs, may help to preserve the normal function of the liver through a normal synthesis rate of albumin. On the basis of epidemiological data and because of its key biological properties, a high circulating concentration of albumin seems to be a valuable goal that might be a target for new therapeutic strategies.
|
Acknowledgments |
|---|
This work was supported by the Institut National de la Santé et de la Recherche Médicale (INSERM), the Conseil Régional de Bourgogne, the Université de Bourgogne, and a grant from ARCOL. E.B. was supported by a fellowship from the Ministère de l’Education Nationale, de l’Enseignement Supérieure, et de la Recherche. The authors wish to thank Drs Juaneda and Sebedio (INRA, Dijon) for facilities in phospholipid quantification. The excellent technical help of Ann Chamberland and Jacques Lavigne is greatly acknowledged.
Received March 27, 2000; accepted June 22, 2000.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. 1. Berliner JA, Heinecke JW. The role of oxidized lipoproteins in atherogenesis. Free Radic Biol Med. 1996;20:707–727. [Medline] [Order article via Infotrieve]
2. 2. Esterbauer H, Gebicki J, Puhl H, Jürgens G. The role of lipid peroxidation and antioxidants in oxidative modification of LDL. Free Radic Biol Med. 1992;13:341–390. [Medline] [Order article via Infotrieve]
3. 3. Aviram M. Modified forms of low density lipoprotein and atherosclerosis. Atherosclerosis. 1993;98:1–9. [Medline] [Order article via Infotrieve]
4. 4. Goldstein JL, Ho YK, Basu SK, Brown MS. Binding site on macrophages that mediates uptake and degradation of acetylated low density lipoprotein, producing massive cholesterol deposition. J Biol Chem. 1979;76:333–337.
5.
5. Björkhem
I, Henriksson-Freyschuss A, Breuer O, Diczfalusy U, Berglund L,
Henriksson P. The antioxidant butylated hydroxytoluene protects against
atherosclerosis.
Arteriosclerosis. 1991;11:15–22.
6.
6. Reaven
PD, Parthasarathy S, Beltz WF, Witztum JL. Effect of probucol dosage on
plasma lipid and lipoprotein levels and on protection of low density
lipoprotein against in vitro oxidation in humans. Arterioscler
Thromb. 1992;12:318–324.
7.
7. Stampfer
MJ, Rimm EB. Epidemiologic evidence for vitamin E in prevention of
cardiovascular disease. Am J Clin
Nutr. 1995;62:1365S–1369S.
8. 8. Peng S-K, Hu B, Morin RJ. Angiotoxicity and atherogenicity of cholesterol oxides. J Clin Lab Anal. 1991;5:144–152. [Medline] [Order article via Infotrieve]
9. 9. Kubow S. Lipid oxidation products in food and atherogenesis. Nutr Rev. 1993;51:33–40.[Medline] [Order article via Infotrieve]
10. Peng SK, Phillips GA, Xia GZ, Morin RJ. Transport of cholesterol autoxidation products in rabbit lipoproteins. Atherosclerosis. 1987;64:1–6.[Medline] [Order article via Infotrieve]
11. Smith LL. Cholesterol autoxidation 1981–1986. Chem Phys Lipids. 1987;44:87–125.[Medline] [Order article via Infotrieve]
12. Smith LL, Johnson BH. Biological activities of oxysterols. Free Radic Biol Med. 1989;7:285–332.[Medline] [Order article via Infotrieve]
13. Kummerow FA. Modification of cell membrane composition by dietary lipids and its implications for atherosclerosis. Ann N Y Acad Sci. 1983;414:29–43.
14. Blache D, Bontoux G. Biological effects of oxysterols on platelet function. Thromb Res. 1988;50:221–230.[Medline] [Order article via Infotrieve]
15. Imai H, Werthenssen NT, Tham P, Lee KT. Angiotoxicity and arteriosclerosis due to contaminants of USP grade cholesterol. Arch Pathol Lab Med. 1976;100:565–572.[Medline] [Order article via Infotrieve]
16. Gimbrone MA Jr, Cybulsky MI, Kume N, Collins T, Resnick N. Vascular endothelium: an integrator of pathophysiological stimuli in atherogenesis. Ann N Y Acad Sci. 1995;748:122–132.
17. Zembowicz A, Jones SL, Wu KK. Induction of cyclooxygenase-2 in human umbilical vein endothelial cells by lysophosphatidylcholine. J Clin Invest. 1995;96:1688–1692.
18. Yla-Herttuala S. Biochemistry of the arterial wall in developing atherosclerosis. Ann N Y Acad Sci. 1991;623:40–59.
19. Goldwasser P, Feldman J. Association of serum albumin and mortality risk. J Clin Epidemiol. 1997;50:693–703.[Medline] [Order article via Infotrieve]
20. Phillips A, Shaper AG, Whincup PH. Association between serum albumin and mortality from cardiovascular disease, cancer and other causes. Lancet. 1989;16:1434–1436.
21. Soriani M, Pietraforte D, Minetti M. Antioxidant potential of anaerobic human plasma: role of serum albumin and thiols as scavengers of carbon radicals. Arch Biochem Biophys. 1994;312:180–188.[Medline] [Order article via Infotrieve]
22. Halliwell B. Antioxidants in human health and disease. Annu Rev Nutr. 1996;16:33–50.[Medline] [Order article via Infotrieve]
23.
Bourdon
E, Loreau N, Blache D. Glucose and free radicals impair the antioxidant
properties of serum albumin. FASEB J. 1999;13:233–244.
24. Dammaco F, Miglietta A, D’Addabbo A, Fratello A, Moschetta R, Bonomo L. Analbuminemia: report of a case and review of the literature. Vox Sang. 1980;39:153–161.[Medline] [Order article via Infotrieve]
25. Wheeler DC, Bernard DB. Lipid abnormalities in the nephrotic syndrome: causes, consequences, and treatment. Am J Kidney Dis. 1994;23:331–346.[Medline] [Order article via Infotrieve]
26.
Basu
SK, Goldstein JL, Anderson RGW, Brown MS. Degradation of cationized low
density lipoprotein and regulation of cholesterol
metabolism in homozygous familial
hypercholesterolemia fibroblasts. Proc
Natl Acad Sci U S A. 1976;73:3178–3182.
27. El-Saadani M, Esterbauer H, El-Sayed M, Goher M, Nassar AY, Jürgens G. A spectrophotometric assay for lipid peroxides in serum lipoproteins using a commercially available reagent. J Lipid Res. 1989;30:627–630.[Abstract]
28. Blache D, Rodriguez C, Davignon J. Pro-oxidant effects of 7-hydroperoxycholest-5-en-3ß-ol on the copper-initiated oxidation of low density lipoprotein. FEBS Lett. 1995;357:135–139.[Medline] [Order article via Infotrieve]
29. Blache D, Durand P, Girodon F, Gesquière L, Loreau N. Determination of sterols, oxysterols and fatty acids of phospholipids in cells and lipoproteins: a one sample method. J Am Oil Chem Soc. 1998;75:107–113.
30.
Folch
J, Lees M, Sloane-Stanley GH. A simple method for the isolation and
purification of total lipids from animal tissues. J Biol
Chem. 1957;226:497–509.
31. Hill TB, Whatley S. A simple, rapid microassay for DNA. FEBS Lett. 1975;56:20–23.[Medline] [Order article via Infotrieve]
32.
Knowles
BB, Howe CC, Aden DP. Human hepatocellular carcinoma cell lines secrete
the major plasma proteins and hepatitis B surface antigen.
Science. 1980;209:497–499.
33. Hodis HN, Kramsch DM, Avogaro P, Bittolo-Bon G, Cazzolato G, Hwang J, Peterson H, Sevanian A. Biochemical and cytotoxic characteristics of an in vivo circulating oxidized low density lipoprotein (LDL-). J Lipid Res. 1994;35:669–677.[Abstract]
34.
Malden
LT, Chait A, Raines EW, Ross R. The influence of oxidatively modified
low density lipoproteins on expression of platelet-derived growth
factor by human monocyte-derived macrophages. J
Biol Chem. 1991;266:13901–13907.
35. Roh DD, Kamanna VS, Kirschenbaum MA. Oxidative modification of low-density lipoprotein enhances mesangial cell protein synthesis and gene expression of extracellular matrix proteins. Am J Nephrol. 1998;18:344–350.[Medline] [Order article via Infotrieve]
36.
Ares
MPS, Kallin B, Eriksson P, Nilsson J. Oxidized LDL induces
transcription factor activator protein-1 but inhibits
activation of nuclear factor-B in human vascular smooth muscle
cells. Arterioscler Thromb Vasc Biol. 1995;15:1584–1590.
37.
Fei H,
Berliner JA, Parhami F, Drake TA. Regulation of
endothelial cell tissue factor expression by minimally
oxidized LDL and lipopolysaccharide. Arterioscler
Thromb. 1993;13:1711–1717.
38. Khan BV, Parthasarathy S, Alexander RW, Medford RM. Modified low density lipoprotein and its constituents augment cytokine-activated vascular cell adhesion molecule-1 gene expression in human vascular endothelial cells. J Clin Invest. 1995;95:1262–1270.
39. Holvoet P, Collen D. Oxidized lipoproteins in atherosclerosis and thrombosis. FASEB J. 1994;8:1279–1284.[Abstract]
40.
Chisolm
GM, Ma G, Irwin KC, Martin LL, Gunderson KG, Linberg LF, Morel DW,
DiCorleto PE. 7ß-Hydroperoxycholest-5-en-3ß-ol, a component of
human atherosclerotic lesions, is the primary cytotoxin of oxidized
human low density lipoprotein. Proc Natl Acad Sci
U S A. 1994;91:11452–11456.
41. Esterbauer H, Schaur RJ, Zollner H. Chemistry and biochemistry of 4-hydroxynonenal, malonaldehyde and related aldehydes. Free Radic Biol Med. 1991;11:81–128.[Medline] [Order article via Infotrieve]
42. Witztum JL, Steinberg D. Role of oxidized low density lipoprotein in atherogenesis. J Clin Invest. 1991;88:1785–1792.
43.
Parthasarathy
S, Steinbrecher UP, Barnett J, Witztum JL, Steinberg D. Essential role
of phospholipase A2 activity in endothelial
cell-induced modification of low density lipoprotein. Proc Natl
Acad Sci U S A. 1985;82:3000–3004.
44. Blache D, Larnaudie B, Loreau N, Durand P. Atherogenic properties of platelet secretory phospholipase A2: influence of oxidised LDL and some oxidation products (oxysterols). C R Soc Biol. 1997;191:845–859.
45.
Sugiyama
S, Kugiyama K, Ogata N, Doi H, Ota Y, Ohgushi M, Matsumura T, Oka
H, Yasue H. Biphasic regulation of transcription factor nuclear
factor-B activity in human endothelial cells by
lysophosphatidylcholine through protein kinase C–mediated pathway.
Arterioscler Thromb Vasc Biol. 1998;18:568–576.
46. Srivastava RAK, Ito H, Hess M, Srivastava N, Schonfeld G. Regulation of low density lipoprotein receptor gene expression in HepG2 and Caco2 cells by palmitate, oleate, and 25-hydroxycholesterol. J Lipid Res. 1995;36:1434–1446.[Abstract]
47.
Fielding
CJ, Bist A, Fielding PE. Caveolin mRNA levels are up-regulated by free
cholesterol and down-regulated by oxysterols in fibroblast
monolayers. Proc Natl Acad Sci
U S A. 1997;94:3753–3758.
48.
Strömstedt
M, Rozman D, Waterman MR. The ubiquitously expressed human CYP51
encodes lanosterol 14-demethylase, a cytochrome P450 whose
expression is regulated by oxysterols. Arch Biochem
Biophys. 1996;329:73–81.[Medline]
[Order article via Infotrieve]
49. Brown MS, Goldstein JL. The SREBP pathway: regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell. 1997;89:331–340.[Medline] [Order article via Infotrieve]
50.
Peet
DJ, Turley SD, Ma WZ, Janowski BA, Lobaccaro JMA, Hammer RE,
Mangelsdorf DJ. Cholesterol and bile acid
metabolism are impaired in mice lacking the nuclear
oxysterol receptor LXR. Cell. 1998;93:693–704.[Medline]
[Order article via Infotrieve]
51.
Janowski
BA, Willy PJ, Devi TR, Falck JR, Mangelsdorf DJ. An oxysterol
signalling pathway mediated by the nuclear receptor LXR.
Nature. 1996;383:728–731.[Medline]
[Order article via Infotrieve]
52.
Barrera-Hernandez
G, Wanke IE, Wong NCW. Effects of diabetes mellitus on
hepatocyte nuclear factor 1 decrease albumin gene
transcription. J Biol Chem. 1996;271:9969–9975.
53. Harris RC, Ismail N. Extrarenal complications of the nephrotic syndrome. Am J Kidney Dis. 1994;23:477–497.[Medline] [Order article via Infotrieve]
54.
Blache
D. Involvement of hydrogen and lipid peroxides in the acute tobacco
smoking-induced platelet hyperactivity. Am J
Physiol. 1995;268:H679–H685.
55. Girodon F, Blache D, Monget AL, Lombart M, Brunet-Lecompte P, Arnaud J, Richard MJ, Galan P. Effect of two year supplementation with low dose antioxidant vitamins and/or minerals in elderly subjects on levels of nutrients and on antioxidant defense parameters. J Am Coll Nutr. 1997;16:357–365.[Abstract]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||