Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 2000;20:2288-2296

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zibara, K.
Right arrow Articles by McGregor, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zibara, K.
Right arrow Articles by McGregor, J.
Related Collections
Right arrow Animal models of human disease
Right arrow Pathophysiology
Right arrow Gene expression
Right arrow Genetically altered mice
Right arrow Endothelium/vascular type/nitric oxide
(Arteriosclerosis, Thrombosis, and Vascular Biology. 2000;20:2288.)
© 2000 American Heart Association, Inc.


Atherosclerosis and Lipoproteins

Modulation of Expression of Endothelial Intercellular Adhesion Molecule-1, Platelet–Endothelial Cell Adhesion Molecule-1, and Vascular Cell Adhesion Molecule-1 in Aortic Arch Lesions of Apolipoprotein E–Deficient Compared With Wild-Type Mice

Presented in part at the XVIIth International Society on Thrombosis and Hemostasis Congress, Washington, DC, August 14–21, 1999, and published in abstract form (Thromb Haemost. 1999;82[suppl 1]:344).

Kazem Zibara; Elza Chignier; Chantal Covacho; Robin Poston; Georges Canard; Patrick Hardy; John McGregor

From INSERM U331/Faculté de Médecine RTH Laënnec (K.Z., E.C., C.C., J.M.), Lyon, France; the Department of Experimental Pathology (R.P.), United Medical and Dental Schools of Guy’s and St. Thomas’ Hospitals, London, UK; and Transgenic Alliance (G.C., P.H.), Iffa Credo, L’Arbresle, France.

Correspondence to Kazem Zibara, PhD, INSERM U331, Faculté de Médecine RTH Laënnec, 8 rue Guillaume Paradin, F-69732 Lyon Cedex 08, France. E-mail zibara{at}laennec.univ-lyon 1.fr


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Human vascular adhesion molecules, such as intercellular adhesion molecule-1 (ICAM-1), platelet–endothelial cell adhesion molecule-1 (PECAM-1), and vascular cell adhesion molecule-1 (VCAM-1), are thought to play a critical role in the homing of leukocytes to sites of atherosclerotic lesions. However, very little is known about the expression of adhesion molecules in the vasculature of mice models, such as apolipoprotein E knockout (apoE-/-) mice, the lesions of which closely mimic human atherosclerotic lesions. This study has first quantitatively characterized the mean expression of endothelial adhesion molecules, lining the whole vessel intimal circumference, over a period of time (0 to 20 weeks of diet) in aortic arch lesions of male apoE-deficient compared with wild-type (C57BL/6) mice. These animals were fed a chow or a cholesterol-rich diet. ApoE-/- animals showed first an increase (at 6 weeks) and then a reduction (at 16 weeks) in the mean expression of ICAM-1 (P<0.05) and PECAM-1 (P<0.05) but not VCAM-1 levels. Such modulation of the mean expression of adhesion molecules was not observed in wild-type mice. Confirmation of immunohistochemistry results on ICAM-1 was obtained by Northern blots performed on the aortic arch of apoE and C57BL6 chow-fed mice over a period of 20 weeks. Moreover, the presence of VCAM-1 was also confirmed at the RNA level, on aortas of control and apoE mice, by reverse transcription–polymerase chain reaction. In the second part of the study, we assayed the levels of adhesion molecules, in different types of histologically defined atherosclerotic lesions, in apoE-/- animals fed for 20 weeks. All 3 adhesion molecules (ICAM-1, PECAM-1, and VCAM-1) were observed to be reduced in fibrofatty and complex lesions but not in fatty streaks or in areas without lesions. These results indicate that the expression of these adhesion molecules in apoE-deficient animals varies with the evolution of the plaque from a fatty to a fibrous stage.


Key Words: atherosclerosis • adhesion molecules • apolipoprotein E–deficient mice • quantitative image analysis • Northern blots


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Atherosclerosis may be the result of genetic susceptibility combined with environmental factors, such as diet, lifestyle, and/or possibly microbial infections.1 2 Oxidized LDL, one of the factors thought to affect vessel wall integrity,3 can lead to an inflammatory response.4 Such a response will induce endothelial cell activation, extravasation of leukocytes, and a migratory/reparative process by vascular smooth muscle cells (SMCs).5 Activated endothelium will express, in sequence, a series of adhesion molecules and powerful cofactors, such as growth factors, cytokines, or NO, which will tether and activate integrin complexes, initiate de novo gene transcription, and allow the extravasation of monocytes or T lymphocytes.6 These adhesion molecules include intercellular adhesion molecule-1 (ICAM-1 or CD54),7 platelet–endothelial cell adhesion molecule-1 (PECAM-1 or CD 31),8 vascular cell adhesion molecule-1 (VCAM-1 or CD106),9 and P-selectin (CD 62P).10

Genetic variation at the apoE locus in humans is associated with hyperlipidemia and premature atherosclerotic risk.11 Recently, apoE-null (apoE-/-) mice, generated by gene targeting,12 have been shown to develop pronounced hypercholesterolemia and atherosclerotic lesions13 with certain features resembling those seen in humans14 15 and other species.16 These mice have become accepted as an animal model for the study of factors involved in atherogenesis.17 However, for this model, little is known about the expression of the endothelial adhesion molecules that are implicated in human atherosclerosis.

In the present study, the mean expression of adhesion molecules, lining the whole vessel intimal circumference, over a period of time (0 to 20 weeks of diet) was quantitatively assessed in apoE-/- mice (C57BL/6 background) and wild-type mice fed a chow or a cholesterol-rich diet. Results showed first an increase (at 6 weeks) and then a reduction (at 16 weeks) in ICAM-1 and PECAM-1 (P<0.05) levels in apoE-/- but not in wild-type animals. In the second part of the study, we assayed the levels of adhesion molecules in different types of histologically defined atherosclerotic lesions in apoE-/- animals fed for 20 weeks. All 3 adhesion molecules (ICAM-1, PECAM-1, and VCAM-1) were observed to be reduced in fibrofatty and complex lesions but not in fatty streaks or adjacent to areas without lesions.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Animal Handling
Surgical procedures and animal care strictly conformed to the Guidelines of the National Institute of Health and Medical Research (decree No. 87-848, October 19, 1987). All animals used in this study were ether-anesthetized before organ sampling.

Mice
The apoEm1Unc line was obtained from Dr N. Maeda (University of North Carolina, Chapel Hill). Control C57BL/6JIco and apoE-deficient mice (C57BL/6JIco background) were backcrossed, bred, and housed under specific and opportunistic pathogen-free conditions by Transgenic Alliance (Iffa Credo S.A., a Charles River Co, Lyon, France). Control (n=45) and apoE-deficient (n=45) mice were weaned at 3 weeks of age and maintained on a chow diet for 1 week ("Souriffarat" breeding diet, standard formulation, pellets, irradiated at 25 kGy, from Extralabo). After that stage, they either had access to a chow diet (4% fat, 0% cholesterol) or a Western-type diet (21% fat, 0.15% cholesterol, special high fat formulation powder, irradiated at 25 kGy). Basal observations were made in 3-week-old weaned control or apoE-deficient mice. All animals received water and food ad libitum during the 3-, 6-, 16-, and 20-week schedules.

Cholesterol Level Analysis in ApoE-Deficient and Wild-Type Mice
This section can be accessed online at www.ahajournals.org.

Organ Isolation and Preparation for Immunohistochemistry and Molecular Biology Techniques
This section can be accessed online at www.ahajournals.org.

Validation of All Types of Vascular Lesions and Intimal/Media Thickness Ratio
This section can be accessed online at www.ahajournals.org.

Immunohistochemistry
Five serial sections were immunostained and quantitatively analyzed for each animal. Briefly, one of these 5 sections, originating from apoE and C57BL6 animals at different time periods (0 to 20 weeks), was simultaneously stained as described online at www.ahajournals.org. In addition, 3 positive and 3 negative controls were present in all staining series. Finally, calibration of the Leica image analyzer, for the whole study, was kept at the same original setting. The following primary monoclonal antibodies were used for immunohistochemical studies. Anti-mouse PECAM-1 (rat IgG2a, 50 µg/mL), anti-mouse VCAM-1 (rat IgG2a, 5 µg/mL), and the nonimmune IgG (rat IgG2a, 5 µg/mL) were purchased from Pharmingen. Anti-mouse ICAM-1 (rat IgG2a, 4 µg/mL) was obtained from Seikagaku Co. Anti–{alpha}-actin monoclonal antibody (mouse IgG2a, 5 µg/mL) was from Boehringer-Mannheim, and anti-mouse macrophage (rat IgG2b, 5 µg/mL) was from Serotec. Endothelial cells were identified through the use of an anti-human von Willebrand factor (rabbit polyclonal), which was purchased from Dako. Antibodies were detected as described online at www.ahajournals.org. A nonimmune IgG was used at the place of the primary antibodies as a negative control. A nuclear counterstaining with hematoxylin followed immunohistochemistry for the identification of macrophages and SMCs.

Image Analysis
Endothelial layer staining of the aortic arch sections was quantified by using a color image analyzer (Quantimet 600 Leica analyzer) according to the technique described by Poston et al.7 The technique used is described online at www.ahajournals.org.

Data Comparisons
The Student test or 1-way ANOVA was performed with the use of StatView 4.02 software (Abacus Concept, Inc). Results are expressed as mean±SEM, and a value of P<0.05 was considered significant.

Total RNA Isolation
Aortas and aortic arches from C57BL6 and apoE-/- mice (n=64), isolated at different periods of time (0, 6, 16, and 20 weeks), were snap-frozen in liquid nitrogen and stored at -80°C. Total RNA was extracted from each individual mouse at the indicated times (n=8). Briefly, frozen tissue was ground in a mortar in liquid nitrogen. The frozen powdered sample was immediately mixed with TRIzol (Gibco BRL, Life Technologies) and homogenized with a Polytron (Brinkmann). Total RNA was extracted by using the TRIzol method adapted from the procedure of Chomczynski and Sacchi.18

Probe Synthesis and Labeling
The 625-bp ICAM probe was prepared by reverse transcription (RT)–polymerase chain reaction (PCR) by use of the following primers: ICAM1390U (CATCGGGGTGGTGAAGTCTGT) and ICAM1996L (TGTCGGGGGAAGTGTGGTC). RT-PCR amplification, labeling, and purification are described online at www.ahajournals.org.

Northern Blots
Total RNA (20 µg) was denatured, separated by electrophoresis on a formaldehyde-MOPS-agarose gel, and then transferred to a nylon membrane (Hybond N+, Amersham). Capillary blotting was performed overnight, and then the membrane was baked for 2 hours at 80°C. Prehybridization and hybridization were performed according to standard protocols.19 Blots were exposed against a PhosphorImager screen (Molecular Dynamics) for 24 hours. Scanning was performed under a 100-µ scale, and the ImageQuant software was then used for quantification. Variations in RNA loading were assessed by using the GAPDH probe (Clontech), which allowed normalizing ICAM-1 values. All quantification values were corrected for background levels by using the local median method of the ImageQuant software. The initial scan image (gel format) was transferred into a tif file to provide the Northern blot figures presented in this article.

RT-PCR Analysis of VCAM-1
RNA-extracted aortas of C57BL6 and apoE mice were treated with DNase I to remove genomic contamination (MessageClean, GenHunter). Removal of DNA was verified by performing a PCR, with use of GAPDH as well as VCAM-1 primers, on the extracted RNA (or an RT-PCR without the addition of the reverse transcriptase enzyme). Absence of these transcripts confirmed efficient removal of genomic DNA. The 375-bp GAPDH cDNA was obtained by using the following primers: GPDH-793U21 (ACCTGCCAAGTATGATGACAT) and GPDH-1148L21 (CCTGTTATTATGGGGGTCTG). The 447-bp VCAM-1 cDNA was obtained by using the following primers: VCAM-1660U21 (CAGCTAAATAATGGGGAACTG) and VCAM-2088L19 (GGGCGAAAAATAGTCCTTG). The RT-PCR conditions were the same as for the synthesis of the ICAM-1 probe (see above).


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
Qualitative Results
Qualitative results, with use of immunohistochemical techniques, were obtained with antibodies directed against ICAM-1, PECAM-1, and VCAM-1. Endothelial cells were identified with an anti–von Willebrand factor monoclonal antibody (Figure 1ADown and 1BDown). Such von Willebrand factor labeling allowed the correlation of the endothelial layer staining with monoclonal antibodies directed against adhesion molecules. ICAM-1 was strongly expressed in regions adjacent to the lesions but weakly expressed on endothelial cells overlying fibrofatty or complex lesions (Figure 1CDown and 1DDown). Moreover, SMCs proliferating within the atherosclerotic lesions also expressed ICAM-1. PECAM-1 was qualitatively observed to be expressed by endothelial cells (Figure 1EDown and 1FDown). Endothelial cells overlying fibrofatty and complex lesions weakly expressed VCAM-1. However, the shoulder of lesions expressed VCAM-1. In addition, VCAM-1 was also seen to be expressed by SMCs proliferating within the atherosclerotic lesions (Figure 1GDown and 1HDown).



View larger version (97K):
[in this window]
[in a new window]
 
Figure 1. Immunohistochemical analysis of adhesion molecules. Serial sections were taken from an apoE-/- mouse after 16 weeks of chow diet. A, C, E, and G, Same fibrofatty lesion at different levels of the aortic arch. B, D, F, and H, Same complex lesion at different levels of the aortic arch. Von Willebrand factor (A and B) was detected by use of a polyclonal anti-rabbit monoclonal antibody. ICAM-1 (C and D), PECAM-1 (E and F), and VCAM-1 (G and H) were detected by use of rat anti-mouse monoclonal antibodies. A corresponding biotinylated secondary monoclonal antibody (mouse-adsorbed) was used before ABC–horseradish peroxidase and AEC chromogen kits (Vector) (see Methods). L indicates lumen; M, media. Bar=100 µm. A, Endothelial cells, overlying a fibrofatty lesion, staining for von Willebrand factor (arrows) are shown. B, Endothelial cells, overlying a complex lesion, staining for von Willebrand factor (arrows) are shown. C, Endothelial cells (e), overlying the same fibrofatty lesion as in panel A, do not stain for ICAM-1. However, SMCs (arrowhead) within the lesions express ICAM-1. D, Endothelial cells (arrows), overlying the same complex lesion as in panel B, stain weakly for ICAM-1. SMCs (arrowhead) within the lesions also express ICAM-1. E, Endothelial cells (arrows), overlying the same fibrofatty lesion as in panel A, stain for PECAM-1. F, Endothelial cells (arrows), overlying the same complex lesion as in panel B, stain for PECAM-1. G, Endothelial cells (e), overlying the same fibrofatty lesion as in panel A, do not stain for VCAM-1. However, SMCs (arrowhead) within the lesions express VCAM-1. H, Endothelial cells (e), overlying the same complex lesion as in panel B, do not stain for VCAM-1. However, SMCs (arrowheads) within the lesions express VCAM-1.

Quantitative Results
Quantitative results, obtained from image analysis of stained sections, are presented in 2 main parts: (1) the mean expression of endothelium adhesion molecules, lining the whole vessel circumference, over a period of time (0 to 20 weeks of diet in chow- or fat-fed apoE-/- compared with wild-type animals), and (2) the mean expression of adhesion molecules, correlated with the different types of histologically defined vascular lesions, in 20-week fat-fed apoE-/- mice.

Mean Expression of Adhesion Molecules Over Time (0 to 20 Weeks of Diet)
Background expression of adhesion molecules was calculated from the mean of ICAM-1, PECAM-1, and VCAM-1 expression by endothelial cells, which were present all around the intimal vessel circumference. ApoE-/- mice (n=5) were compared with C57BL/6 mice (n=5) over a period of time (0 to 20 weeks of the chow or fat diet, Figure 2Down and Figures I, II, III, which can be accessed online at www.ahajournals.org).



View larger version (33K):
[in this window]
[in a new window]
 
Figure 2. Background expression of adhesion molecules over time. The expression of ICAM-1 (n=45), VCAM-1 (n=45), and PECAM-1 (n=45) by the endothelium all around the vessel circumference was quantified by using a color image Quantimet 600 Leica analyzer. The analysis was displayed by use of a x40 objective. Results are expressed as mean±SEM of 6 to 24 measurements obtained from 5 individuals per group. *Significantly different from week 0. A, Expression of ICAM-1 was significantly increased (P<0.001) between weaned apoE-/- mice (represented by 0) and animals fed either diet for 3 or 6 weeks. However, at 16 and 20 weeks, compared with 6 weeks, the expression is reduced. ICAM-1 expression, at 16 and 20 weeks, was comparable to that of weaned animals for fat-fed apoE-/- mice but significantly higher for chow-fed apoE-/- animals (P<0.001). B, In the C57BL6 mice, there was a steady expression of ICAM-1 from 3 to 20 weeks, irrespective of diet. On the other hand, there was a slight but significant (P<0.001) increase in ICAM-1 expression in fat-fed compared with chow-fed C57BL6 animals. This increase was unchanged from 3 to 20 weeks. C, Expression of PECAM-1 was significantly increased (P<0.05) between weaned apoE-/- mice and mice fed 3 weeks of either diet. At 6 weeks, only chow-fed apoE-/- mice showed an enhanced expression (P<0.05). However, at 20 weeks of diet, the expression was significantly (P<0.05) decreased in fat-fed apoE-/- compared with weaned mice.

The apoE-/- mice weaned at 3 weeks of age (no diet) showed moderate expression of ICAM-1 (Figure 2AUp). ICAM-1 expression was strongly increased (P<0.001) in the endothelium of apoE-/- animals fed either diet for 3 or 6 weeks compared with weaned mice. Compared with 6 weeks, after 16 or 20 weeks of either diet, ICAM-1 expression was significantly reduced (P<0.001). Such lower ICAM-1 expression was particularly significant in apoE-/- animals fed a fat diet. In contrast, C57BL/6 mice showed a steady expression of ICAM-1 from 3 to 20 weeks, irrespective of diet. C57BL/6 mice on a fat diet, compared with those on a chow diet, showed a slight but significant (P<0.001) increase in ICAM-1 expression (Figure 2BUp).

A high basal PECAM-1 expression, measured in the endothelium of the apoE-/- mice weaned at 3 weeks of age (no diet), was observed. Moreover, upregulated expression of PECAM-1 (P<0.05) was observed for apoE-/- animals on either diet for 3 weeks. In addition, after 6 weeks of the chow diet, endothelial PECAM-1 expression was significantly (P<0.05) increased. PECAM-1 expression was significantly decreased (P<0.001) for apoE-/- animals fed a chow diet for 16 and 20 weeks compared with those fed a chow diet for 6 weeks (Figure 2CUp). C57BL/6 mice showed a major increase (P<0.001) in PECAM-1 expression after 3 weeks of either type of diet compared with weaned mice. Then, after 6 to 20 weeks of either diet, the expression of PECAM-1 was found to be more or less steady. One should note a consistently higher level of PECAM-1 expression (P<0.05) in the fat-fed compared with the chow-fed animals (FigureUp I, which can be accessed online at www.ahajournals.org).

VCAM-1 basal expression, measured in the endothelium of the weaned apoE-/- mice (3 weeks of age and no diet), showed variable levels. VCAM-1 expression did not show a significant modulation pattern, as was observed for ICAM-1 and PECAM-1. Moreover, the VCAM-1 expression levels were consistently lower compared with those of ICAM-1 and PECAM-1. No significant differences in VCAM-1 expression were observed between apoE animals fed a fat or chow diet (FigureUp II, which can be accessed at www.ahajournals.org). In addition, compared with weaned mice, wild-type mice showed no significant changes in VCAM-1 expression by endothelial cells over time (FigureUp III, which can be accessed online at www.ahajournals.org).

Mean Expression of Adhesion Molecules Correlated With Vascular Lesions (ApoE-/- Mice After 20 Weeks of Diet)
Background expression of adhesion molecules correlated with vascular lesions was calculated from the expression of ICAM-1, PECAM-1, and VCAM-1 by endothelial cells. Such endothelial cells overlay vessels that showed either fatty-streak, fibrofatty, complex, or no lesions in apoE-/- mice (n=5) fed a fat diet for 20 weeks or apoE-/- animals (n=5) aged 3 weeks of age that were not on a diet (Figure 3Down and FigureUp IV, which can be accessed online at www.ahajournals.org).



View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Expression of adhesion molecules over lesions. Expression levels of adhesion molecules were measured on the endothelium overlying vessels from weaned chow-fed apoE-/- animals (n=5) and animals after 20 weeks of fat diet. Ten to 53 measurements per mouse were used for the analysis of the 3 adhesion molecules expressed by the endothelium over the described areas. A, ICAM-1 showed a low expression in weaned mice (no diet). ICAM-1 expression was significantly elevated in areas with no lesions in apoE-/- animals fed 20 weeks of fat diet compared with weaned mice. This high level of ICAM-1 expression, associated with histologically identified atherosclerotic lesions, was also present in endothelium overlying fatty streaks. However, fibrofatty plaques and complex lesions showed a significant decrease of ICAM-1 expression (P<0.05) compared with areas with no lesions. B, VCAM-1 expression levels in the endothelium of weaned apoE-/- mice were quite variable. Fatty streak areas, obtained from apoE-/- mice fed 20 weeks of fat diet, showed significantly increased levels of VCAM-1 compared with areas with no lesions. With the increased severity of atherosclerosis, VCAM-1 expression was diminished (P<0.001 and 0.05), compared with areas with no lesions, in the endothelium of 20-week fat-fed apoE-/- mice.

ICAM-1 expression in weaned animals not on a diet was low (Figure 3AUp). In contrast, in animals fed 20 weeks of the fat diet, compared with weaned animals, ICAM-1 expression was significantly elevated in areas with no lesions. This high level of ICAM-1 expression, associated with histologically identified atherosclerotic lesions, was also present in endothelium overlying fatty streaks. However, ICAM-1 levels were significantly (P<0.05) reduced in fibrofatty and complex lesions compared with areas with no lesions (Figure 3AUp).

PECAM-1 expression by endothelium from weaned animals was very high. No difference was observed between areas showing no lesions or fatty-streak lesions. In contrast, PECAM-1 expression was significantly reduced in endothelial cells overlying fibrofatty or complex lesions compared with areas with no lesions (FigureUp IV, which can be accessed online at www.ahajournals.org).

VCAM-1 expression by endothelium from weaned animals was low (Figure 3BUp). VCAM-1 levels in histologically identified lesions in animals fed 20 weeks of the fat diet were markedly increased (P<0.05) in the endothelium overlying the fatty streaks and decreased in a very significant way (P<0.001) in fibrofatty or complex lesions compared with areas with no lesions.

Northern Blots
Confirmation of immunohistochemical results on ICAM-1 was obtained by Northern blots performed on aortic arch samples of apoE and C57BL6 chow-fed mice over a period of 20 weeks. Samples from 8 different animals (C57BL6 and apoE) at different time points (0, 6, 16, and 20 weeks) were separately investigated (Figure 4ADown). This overall analysis of aortic arch samples was performed on a total of 64 animals. Results show that ICAM-1, in aortic arch samples of apoE mice at 6 weeks of chow diet, is upregulated (by at least 2-fold) compared with C57BL6 and apoE animals at 0 and 16 weeks (Figure 4BDown). However, an increase in ICAM-1 transcription was observed in the aortic arch at 20 weeks. There was no particular pattern for ICAM-1 expression in C57BL6. The present study shows for the first time, with use of Northern blots, that the ICAM-1 transcription level is modulated in the aortic arch of 6-week chow-fed apoE but not C57BL6 mice. One should note that Northern blot results are obtained from RNAs extracted from whole vessels. In contrast, immunohistochemistry is performed on endothelial cells lining the vessel wall.



View larger version (49K):
[in this window]
[in a new window]
 
Figure 4. Northern blot analysis of ICAM-1. A, Typical Northern blot experiment showing samples from 4 different animals (C57BL6 and apoE mice) at different time points (0, 6, 16, and 20 weeks). Northern blot analysis of aortic arch samples was performed on a total of 64 animals. GAPDH expression served as a control for loading. B, Quantification of ICAM-1 signals, performed on a total of 64 animals, in relation to GAPDH levels is shown. Results show that ICAM-1 gene expression is upregulated in aortic arch samples of 6-week chow-fed apoE but not C57BL6 mice. Quantification of ICAM-1 signals showed an overexpression by at least 2-fold in apoE mice at 6 weeks compared with controls and apoE animals at 0 and 16 weeks. However, an increase in ICAM-1 transcription was observed in aortic arches of chow-fed apoE mice at 20 weeks. Results are represented in a quantitative way, with mean±SEM.

RT-PCR Analysis of VCAM-1
In the present study, we report for the first time the presence of VCAM-1 mRNA transcripts in murine aortas at different periods of time (Figure 5ADown). The presence of VCAM-1 mRNA was tested by RT-PCR on aortas, aortic arches, and hearts of C57BL6 and apoE mice. All these tissues showed the presence of VCAM-1 mRNA after genomic DNA removal (Figure 5BDown). A GAPDH-positive control in the RT-PCR experiments is shown in FigureUp V (which can be accessed online at www.ahajournals.org). The above-mentioned VCAM-1 data confirm that detection of VCAM-1 by immunological methods is not a background noise. These observations are very much in line with those obtained by immunological techniques as shown in the present study.



View larger version (43K):
[in this window]
[in a new window]
 
Figure 5. RT-PCR analysis of VCAM-1. A, Typical RT-PCR experiment shows the presence of VCAM-1 transcripts in C57BL6 and apoE aortic murine tissues. Lanes 1, 2, 3, and 4 correspond to VCAM-1 cDNA after amplification from RNAs of C57BL6 aortas at 0, 6, 16, and 20 weeks, respectively, of chow diet. Lanes 5, 6, 7, and 8 correspond to VCAM-1 cDNA after amplification from RNAs of apoE aortas at 0, 6, 16, and 20 weeks, respectively, of chow diet. B, Removal of genomic DNA was verified by PCR, with use of GAPDH primers, on the extracted RNAs. Absence of GAPDH transcript confirmed efficient removal of genomic DNA. Lower band corresponds to free nucleotides.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
The present study reports, for the first time, a quantitative analysis of major adhesion molecules expressed by endothelial cells from the aortic arch of apoE-deficient mice compared with wild-type mice (C57BL/6). The following results were observed: (1) The mean expression of 2 major vascular adhesion molecules (ICAM-1 and PECAM-1), lining the whole intimal vessel circumference, over a period of time (0 to 20 weeks of diet) is modulated in the atherosclerotic lesions of apoE-/- mice but not in C57BL/6 control mice. Confirmation of immunohistochemical results on ICAM-1 was obtained by Northern blots performed on the aortas of apoE and C57BL6 chow-fed mice over a period of 20 weeks. (2) The intensity of expression of 3 major vascular adhesion molecules (ICAM-1, PECAM-1, and VCAM-1) by the endothelium, lining different types of histologically defined atherosclerotic lesions after 20 weeks of diet, is correlated with the progression and severity of atherosclerotic lesions. In line with previously published data, our results involving atherosclerotic lesions are characterized by typical lipid deposition, cellular infiltration, and SMC proliferation.14 20 In addition, plasma cholesterol levels and an increase of the intima/media ratio, significantly higher in apoE-/- compared with wild-type animals, did vary with the type of diet used.

Atherosclerotic lesions may be the result of some form of inflammation, induced by the presence of oxidized LDL, Chlamydia pneumoniae,21 or viral or other factors, occurring at the level of the vessel wall.22 Vascular endothelial cells, activated at sites of inflammation, interact with different leukocyte subtypes via adhesion molecules and different cofactors and are thought to play a key role in the initiation and perpetuation of atherosclerotic lesions.23 24 Among a number of adhesion molecules implicated in the homing of leukocytes to sites of inflammation, endothelial ICAM-1 and its leukocyte ligand CD11a/CD18 (also known as {alpha}Lß2 or lymphocyte function–associated antigen-1) play a major role in this process.25 26 In the present study, a significant modulation of ICAM-1 expression over time by endothelial cells lining the whole vessel wall circumference was observed for the aortic arch region of apoE-deficient mice fed a fat or chow diet. Northern blots on aortic arch samples, for determination of ICAM-1 gene expression, showed an increase at 6 weeks (by at least 2-fold) compared with 0 and 16 weeks in C57BL6 and apoE animals. However, an increase in ICAM-1 transcription was observed in the aortic arch at 20 weeks. These Northern data results are in line with those obtained by immunohistochemistry at 0, 6, and 16 weeks but not at 20 weeks. One should note that Northern blots are performed on whole vessels, whereas immunohistochemistry was performed on endothelial cells lining the vessel circumference. Additional transcription of ICAM-1 may take place in other cells, such as SMCs, present in the vessel. It is interesting that such an increase of ICAM-1 transcription levels at 20 weeks in aortic arch samples is not present in aortas (data not shown). Reduced endothelial ICAM-1 expression coincided with the presence of a significant number of more advanced fibrotic lesions. A decrease in ICAM-1 expression may be matched with a reduced influx of leukocytes within atherosclerotic walls. Indeed, Roselaar et al27 indicate that the number of T lymphocytes, immunoreactive for Thy 1.2, CD4, CD5, and CD8, in atherosclerotic lesions of 16-week-old apoE-/- and LDL receptor–deficient mice is very significantly decreased from the levels present in 4-week-old mice. Interestingly, blocking the access of ICAM-1 to leukocytes by monoclonal antibodies in apoE-deficient animals on a chow diet reduced the homing of macrophages to atherosclerotic plaques by 65%.28 Our results are supported by a recent study that used qualitative analysis and reported increased ICAM-1 expression in apoE-deficient animals.29 Moreover, and very significantly, observations made on human coronaries and carotids show ICAM-1 expression to be correlated with vascular lesions.7 ICAM-1, as well as VCAM-1, is expressed in a flow-dependent manner.30 Upregulation of ICAM-1 from its constitutive levels of expression on cultured human and rabbit arterial endothelial cells has been shown to occur after lysophosphatidylcholine treatment.31 Moreover, lysophosphatidylcholine induced the expression of ICAM-1 on endothelium derived from human iliac arteries but not from umbilical veins.31 It is of interest to note that high levels of lysophosphatidylcholine are present in a hyperlipidemic state.

Endothelial adhesion molecules, together with other important cofactors, such as chemoattractants, play a critical role in the homing of monocytes to sites of vascular lesions. In apoE-/- compared with wild-type animals, a significant modulation of ICAM-1 expression over time is observed. Other factors, in addition to adhesion molecules, appear to be implicated in the swift initiation and perpetuation of vascular lesions. Indeed, knocking out monocyte chemoattractant protein-1 (MCP-1) or its receptor, in LDL receptor–deficient or apoE-/- mice, respectively, will also significantly decrease lesion formation.32 33 Blocking nuclear factor-{kappa}B activity in endothelial cells by anti-sense oligonucleotides will affect not only ICAM-1 upregulation but also MCP-1 production and, ultimately, the homing of monocytes.34 Adhesion and transmigration, mediated by several interacting molecular mechanisms, appear to be essential for monocyte traffic in atherosclerosis. Some of these factors, such as nuclear factor-{kappa}b, MCP-1, interleukin-8/neutrophil-activating peptide, platelet-activating factor, and RANTES, may be activated or upregulated at an early stage in apoE-/- but not wild-type mice.

PECAM-1 is one of the most abundant constitutively expressed endothelial cell adhesion molecules (up to 106 molecules per cell).7 There is good evidence to suggest that it is a key participant in the adhesion cascade leading to extravasation of leukocytes to sites of inflammation.35 However, the mechanism explaining PECAM-1 implication in leukocyte transmigration is not yet completely elucidated. PECAM-1 molecules expressed by leukocytes and endothelial cells are known to allow homophilic interactions.36 In addition, it has been suggested that PECAM-1 can interact with upregulated {alpha}vß3.37 38 In the present study, a significant modulation of endothelial PECAM-1 expression, lining the whole vessel wall circumference, was observed for apoE-deficient but not wild-type mice. It is of interest to note that PECAM-1 expression can be significantly modulated after treatment of human umbilical vein endothelial cells with inflammatory cytokines. Indeed, tumor necrosis factor-{alpha} and interferon-{gamma} can lead to the disappearance of PECAM-1 from cell junctions and a very significant reduction in the migration of leukocytes through endothelial cells.39 In a recently published report31 on apoE, it was stated that PECAM-1 appears not to be differentially regulated. Differences between our results and those of Nakashima et al29 may conceivably be due to the fact that we have used a quantitative technique to assay the mean expression level of PECAM-1. It is conceivable that the increased expression of PECAM-1 and ICAM-1 is the result of either a continuous insult of endothelial cells or repeated insult and injury, which may result in endothelial cell regeneration.1 Albelda et al35 36 inhibited in vitro confluence of cultured endothelial cells by using anti-PECAM-1 antibodies. Such data strongly indicate that PECAM-1, through its homotypic mechanism of adhesion, is actively involved in the regulation of cell-cell adhesion.36 The cooperation between adhesion molecules may enhance cell-cell cross talk and subsequent interactions. It was recently suggested that homophilic adhesion of PECAM-1 might lead to integrin upregulation.40

Endothelial VCAM-1, an inducible cell surface adhesion molecule of the immunoglobulin gene superfamily, interacts with cells expressing the integrin {alpha}4ß1 ligand.41 VCAM-1 has been identified as a very early event in the development of atherosclerotic lesions in experimental animal models.42 Our results show that over time the profile of endothelial VCAM-1 mean expression, lining the whole vessel intimal circumference, did not significantly change for either apoE-/- or wild-type mice. However, endothelial VCAM-1 was highly expressed over fatty streaks and was decreased on fibrofatty and complex lesions. In our samples, VCAM-1 not only was identified on endothelial cells but also was present on proliferating SMCs. These data report for the first time the presence of VCAM-1 mRNA levels in murine control C57BL6, as well as apoE, aortas. All murine tissues tested (aortas, aortic arches, and hearts) showed the presence of VCAM-1 mRNA after genomic DNA removal. Great care should be taken in the selection of primers, PCR product length, and PCR conditions to be able to detect murine VCAM-1 mRNA. These observations are very much in line with those obtained with the use of immunological techniques, as shown in the present study and in those reported by a number of authors. In fact, by use of in vivo radiolabeled monoclonal antibody techniques, constitutive murine (C57BL/6Jstrain) VCAM-1 expression was shown to be present in the heart vasculature. Moreover, murine constitutive VCAM-1 expression is quite heterogeneous, with the highest level present in the heart, followed by the mesentery, brain, and small intestine.43 Another study showed the presence of constitutive VCAM-1 expression by the endothelium of the coronary artery and the endocardium in C57BL/6 mice.44 In addition, scattered endothelial cells in normal murine aorta express VCAM-1.45 Moreover, Ando et al46 demonstrated that cultured murine endothelial cells show constitutive high levels of VCAM-1 expression. Furthermore, Li et al47 found similar results within arteriosclerotic plaques from rabbits fed a 0.3% cholesterol–containing diet. Moreover, a recent study involving apoE-deficient mice31 very much supports the present observations. In human tissues, different workers showed VCAM-1 expression to be either present or weakly detected in atherosclerotic lesions. To explain such discrepancies, it is conceivable that lesions examined by different teams may have been at slightly different stages of evolution of the plaque or ages of the patients. De novo expression of VCAM-1 may be induced, as it is for ICAM-1, by the generation of lysophosphatidylcholine during hyperlipidemia, leading preferentially for mononuclear recruitment to sites of atherogenesis.48 Finally, VCAM-1 may play a vital role in the vasa vasorum, by modulating the extravasation of leukocytes.11 25

One possible way to investigate the role of adhesion molecules in initiating and perpetuating vascular lesions over time is by measuring their mean expression level present around the whole vessel circumference. Conceivably, such an analysis may have its limitations, with an increase of an adhesion molecule at one site of lesion neutralized by a decrease at another. However, results in the present study show that the mean level of adhesion molecule expression, assayed by measurements on healthy and diseased endothelium over time, show a significantly different pattern for apoE-/- and wild-type mice. ICAM-1 and PECAM-1 are adhesion molecules that are constitutively expressed, as opposed to VCAM-1, which is inducible, by vascular endothelial cells. Such differences may perhaps give a clue to the results that have been obtained in the present study. Great care should be taken in evaluating the role of these adhesion molecules, inasmuch as a number of other adhesion molecules, such as P-selectin and E-selectin, have not been taken in consideration in the present study.49 In addition, caution has to be taken in extrapolating results from mice to humans because of the considerable differences in genetic, metabolic, and other pathways leading to atherosclerosis. Indeed, an absence of cholesteryl ester transfer protein and Lp(a) is observed in mice. Moreover, most studies in mice are performed on the aorta instead of the coronary arteries. Genes implicated in diseased coronaries are thought to differ from those implicated in aortic lesions.50

In conclusion, our results suggest that ICAM-1, PECAM-1, and VCAM-1 expressions may provide a background to the atherosclerotic plaque formation in this model. Specifically, they would greatly facilitate monocyte adhesion to the endothelium and subsequent extravasation. However, the complexity of the interplay of biomechanical and humoral stimuli in the induction and modulation of adhesion molecules and their cofactors remains far from being clear. Expressions of these adhesion molecules in knockout animals were correlated with the evolution of the plaque from a fatty to a fibrous stage.


*    Acknowledgments
 
This work was supported by the French Ministry of Education Scientific Research (grant MESR ACC-SV9) and by the European Network on Atherosclerosis (ENA, BIOMED 2, grant PL 1195). The authors are indebted to Dr Catherine Souchier, Center Commun de Quantimétrie, Université Claude Bernard (Lyon-1), for helping with the computing studies.

Received December 13, 1999; accepted February 14, 2000.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Ross R. The pathogenesis of atherosclerosis. Nature.. 1993;362:801–809.[Medline] [Order article via Infotrieve]

2. Suzuki H, Kuriara Y, Takeya M, Kamada N, Kataoka M, Jishage K, Ueda O, Sagakuchi H, Higashi T, Suzuki T, et al. A role for macrophage scavenger receptors in atherosclerosis and susceptibility to infection. Nature.. 1997;386:292–296.[Medline] [Order article via Infotrieve]

3. Hajjar DP, Nicholson AC. Atherosclerosis. Am Scientist.. 1995;83:460–467.

4. Munro JM, Cotran RS. Biology of the disease: the pathogenesis of atherosclerosis: atherogenesis and inflammation. Lab Invest.. 1988;58:249–261.[Medline] [Order article via Infotrieve]

5. Ohno T, Gordon D, San H, Pompili VJ, Imperiale MJ, Nabel GJ, Nabel EG. Gene therapy for vascular smooth muscle cell proliferation after arterial injury. Science.. 1994;265:781–784.[Abstract/Free Full Text]

6. Springer TA. Adhesion receptors of the immune system. Nature.. 1990;346:425–434.[Medline] [Order article via Infotrieve]

7. Poston RN, Haskard DO, Coucher JR, Gall NP, Johnson-Tidey RR. Expression of intercellular adhesion molecule-1 in atherosclerotic plaques. Am J Pathol.. 1992;140:665–673.[Abstract]

8. Bogen S, Pak J, Garifallou M, Deng X, Muller WA. Monoclonal antibody to murine PECAM-1 (CD31) blocks acute inflammation in vivo. J Exp Med.. 1994;179:1059–1064.[Abstract/Free Full Text]

9. Cybulsky MI, Gimbrone MA Jr. Endothelial expression of a mononuclear leukocyte adhesion molecule during atherogenesis. Science.. 1991;251:788–791.[Abstract/Free Full Text]

10. Johnson-Tidey RR, McGregor JL, Taylor PR, Poston RN. Increase in the adhesion molecule P-selectin in endothelium overlaying atherosclerotic plaques: coexpression with intercellular adhesion molecule-1. Am J Pathol.. 1994;144:952–961.[Abstract]

11. Schaefer EJ, Gregg RE, Ghiselli G, Forte TM, Ordovas JM, Zech LA, Brewer HB Jr. Familial apolipoprotein deficiency. J Clin Invest.. 1986;78:1206–1219.

12. Piedrahita JA, Zhang SH, Hagaman JR, Oliver PM, Maeda N. Generation of mice carrying a mutant apolipoprotein E gene inactivated by gene targeting in embryonic stem cells. Proc Natl Acad Sci U S A.. 1992;89:4471–4475.[Abstract/Free Full Text]

13. Reddick RL, Zhang SH, Maeda N. Atherosclerosis in mice lacking apo E: evaluation of lesional development and progression. Arterioscler Thromb.. 1994;14:141–147.[Abstract/Free Full Text]

14. Nakashima Y, Plump AS, Raines EW, Breslow JL, Ross R. ApoE-deficient mice develop lesions of all phases of atherosclerosis throughout the arterial tree. Arterioscler Thromb.. 1994;14:133–140.[Abstract/Free Full Text]

15. Davies MJ, Woolf N, Rowles PM, Pepper J. Morphology of the endothelium over atherosclerotic plaques in human coronary arteries. Br Heart J.. 1988;60:459–464.[Abstract/Free Full Text]

16. Rosenfeld ME, Tsukada T, Gown AM, Ross R. Fatty streak initiation in a Watanabe heritable hyperlipemic and comparably hypercholesterolemic fat-fed rabbits. Arteriosclerosis.. 1987;7:9–23.[Abstract]

17. Shih DM, Welch C, Lusis AJ. New insights into atherosclerosis from studies with mouse models. Mol Med Today.. 1995;1:364–372.[Medline] [Order article via Infotrieve]

18. Chomczynski P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem.. 1987;162:156–159.[Medline] [Order article via Infotrieve]

19. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989.

20. Plump AS, Breslow JL. Apolipoprotein E and the apolipoprotein E-deficient mouse. Annu Rev Nutr.. 1995;15:495–518.[Medline] [Order article via Infotrieve]

21. Shor A, Kuo CC, Patton DL. Detection of Chlamydia pneumoniae in aortic lesions of atherosclerosis by immunocytochemical stain. Arterioscler Thromb.. 1993;13:1501–1504.[Abstract/Free Full Text]

22. Ross R. Atherosclerosis: a problem of the biology of arterial wall cells and their interactions with blood components. Arteriosclerosis.. 1981;1:293–311.[Free Full Text]

23. O’Brien KD, McDonald TO, Chait A, Allen MD, Alpers CE. Neovascular expression of E-selectin, intercellular adhesion molecule-1, and vascular cell adhesion molecule-1 in human atherosclerosis and their relation to intimal leukocyte content. Circulation.. 1996;93:672–682.[Abstract/Free Full Text]

24. Poston RN, Johnson-Tidey RR. Localized adhesion of monocytes to human atherosclerotic plaques demonstrated in vitro. Am J Pathol.. 1996;149:73–80.[Abstract]

25. Marlin SD, Springer TA. Purified intercellular adhesion molecule (ICAM-1) is a ligand for lymphocyte function-associated antigen 1 (LFA-1). Cell.. 1987;51:813–819.[Medline] [Order article via Infotrieve]

26. Makgoba MW, Sanders ME, Ginther Luce GEG, Dustin ML, Springer TA, Clark EA, Mannoni P, Shaw S. ICAM-1 a ligand for LFA-1 dependent adhesion of B, T and myeloid cells. Nature.. 1988;331:86–88.[Medline] [Order article via Infotrieve]

27. Roselaar SE, Kakkanathu PX, Daugherty A. Lymphocyte populations in atherosclerotic lesions of apoE-/- and LDL receptor-/- mice: decreasing density with disease progression. Arterioscler Thromb Vasc Biol.. 1996;16:1013–1018.[Abstract/Free Full Text]

28. Patel SS, Thiagarajan R, Willerson JT, Yeh ET. Inhibition of alpha4 integrin and ICAM-1 markedly attenuate macrophage homing to atherosclerotic plaques in ApoE-deficient mice. Circulation.. 1998;97:75–81.[Abstract/Free Full Text]

29. Nakashima Y, Raines EW, Plump AS, Breslow JL, Ross R. Upregulation of VCAM-1 and ICAM-1 at atherosclerosis-prone sites on the endothelium in the apoE-deficient mouse. Arterioscler Thromb Vasc Biol.. 1998;18:842–851.[Abstract/Free Full Text]

30. Walpola PL, Gotlieb AI, Cybulsky MI, Langille BL. Expression of ICAM-1 and VCAM-1 and monocyte adherence in arteries exposed to altered shear stress. Arterioscler Thromb Vasc Biol.. 1995;15:2–10.[Abstract/Free Full Text]

31. Kume N, Cybulsky MI, Gimbrone MA Jr. Lysophosphatidylcholine, a component of atherogenic lipoproteins, induces mononuclear leukocyte adhesion molecules in cultured human and rabbit arterial endothelial cells. J Clin Invest.. 1992;90:1138–1144.

32. Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion formation in CCR2-/- mice reveals a role for chemokines in the initiation of atherosclerosis. Nature.. 1998;394:894–897.[Medline] [Order article via Infotrieve]

33. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, Rollins BJ. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell.. 1998;2:275–281.[Medline] [Order article via Infotrieve]

34. Gawaz M, Neuman F-J, Dickfeld T, Koch W, Laugwitz K-L, Adelsberger H, Langenbrink K, Page S, Neumeier D, Schömig A, et al. Activated platelets induce monocyte chemotactic protein-1 secretion and surface expression of intercellular adhesion molecule-1 on endothelial cells. Circulation.. 1998;98:1151–1152.[Free Full Text]

35. Vaporcyian AA, DeLisser HM, Yan H, Mendiguren II, Thom SR, Jones PA, Ward PA, Albelda SM. Involvement of platelet endothelial cell adhesion molecule-1 in neutrophil recruitment in vivo. Science.. 1993;262:1580–1582.[Abstract/Free Full Text]

36. Albelda SM, Muller WA, Buck CA, Newman PJ. Molecular and cellular properties of PECAM-1 (endoCam/CD 31): a novel vascular cell-cell adhesion molecule. J Cell Biol.. 1991;114:1059–1068.[Abstract/Free Full Text]

37. Piali L, Hammel P, Uherek C, Bachmann F, Gisler RH, Dunon D, Imhof BA. CD31/PECAM-1 is a ligand for {alpha}vß3 integrin involved in adhesion of leukocytes to endothelium. J Cell Biol.. 1995;130:451–460.[Abstract/Free Full Text]

38. Buckley CD, Doyonnas R, Newton JP, Blystone SD Brown EJ, Watt SM, Simmons DL. Identification of {alpha}vß3 as a heterotopic ligand for CD31/PECAM-1. J Cell Sci.. 1996;109:437–445.[Abstract]

39. Rival Y, Del Maschio A, Rabiet MJ, Dejana E, Duperray A. Inhibition of platelet endothelial cell adhesion molecule-1 synthesis and leukocyte transmigration in endothelial cells by the combined action of TNF-{alpha} and IFN-{gamma}. J Immunol.. 1996;157:1233–1241.[Abstract]

40. Newman PJ. Perspectives series on cell adhesion in vascular biology: the biology of PECAM-1. J Clin Invest.. 1997;99:3–7.[Medline] [Order article via Infotrieve]

41. Elices MJ, Osborn L, Takada Y, Crouse C, Luhowskyl S, Hemler ME, Lobb RR. VCAM-1 on activated endothelium interacts with the leukocyte integrin VLA-4 at a site distinct from the VLA-fibrinogen binding site. Cell.. 1990;60:577–584.[Medline] [Order article via Infotrieve]

42. Cybulsky MI, Gimbrone MA. Endothelial expression of a mononuclear leukocyte adhesion molecule during atherogenesis. Science.. 1991;251:788–791.

43. Henninger DD, Panes J, Eppihimer M, Russell J, Gerritsen M, Anderson DC, Granger DN. Cytokine-induced VCAM-1 and ICAM-1 expression in different organs of the mouse. J Immunol.. 1997;158:1825–1832.[Abstract]

44. Russell PS, Chase CM, Colvin RB. Accelerated atheromatous lesions in mouse hearts transplanted to apolipoprotein-E-deficient recipients. Am J Pathol.. 1996;149:91–99.[Abstract]

45. Lindner V, Collins T. Expression of NF-kappa B and I kappa B-alpha by aortic endothelium in an arterial injury model. Am J Pathol.. 1996;148:427–438.[Abstract]

46. Ando J, Tsuboi H, Korenaga R, Takada Y, Toyama Sorimachi N, Miyasaka M, Kamiya A. Shear stress inhibits adhesion of cultured mouse endothelial cells to lymphocytes by downregulating VCAM-1 expression. Am J Physiol.. 1994;267:C679–C687.[Abstract/Free Full Text]

47. Li H, Cybulsky MI, Gimbrone MA Jr, Libby P. Inducible expression of vascular cell adhesion molecule-1 by vascular smooth muscle cells in vitro and within rabbit atheroma. Am J Pathol.. 1993;143:1551–1559.[Abstract]

48. Carlos TM, Harlan JM. Leukocyte-endothelial adhesion molecules. Blood.. 1994;84:2068–2101.[Abstract/Free Full Text]

49. Dong ZM, Chapman SM, Brown AA, Frenette PS, Hynes RO, Wagner DD. The combined role of P- and E-selectins in atherosclerosis. J Clin Invest.. 1998;102:1,145–152.[Medline] [Order article via Infotrieve]

50. Shih DM, Welch C, Lusis AJ. New insights into atherosclerosis from studies with mouse models. Mol Med Today.. 1995;1:364–373.




This article has been cited by other articles:


Home page
Evid Based Complement Alternat MedHome page
K. A. O'Brien, S. Ling, E. Abbas, A. Dai, J. Zhang, W. C. Wang, A. Bensoussan, R. Luo, Z.-X. Guo, and P. A. Komesaroff
A Chinese Herbal Preparation Containing Radix Salviae Miltiorrhizae, Radix Notoginseng and Borneolum Syntheticum Reduces Circulating Adhesion Molecules
Evid. Based Complement. Altern. Med., September 27, 2008; (2008) nen060v1.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
R. M. Mansouri, E. Bauge, B. Staels, and P. Gervois
Systemic and Distal Repercussions of Liver-Specific Peroxisome Proliferator-Activated Receptor-{alpha} Control of the Acute-Phase Response
Endocrinology, June 1, 2008; 149(6): 3215 - 3223.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
L. Shelly, L. Royer, T. Sand, H. Jensen, and Y. Luo
Phospholipid transfer protein deficiency ameliorates diet-induced hypercholesterolemia and inflammation in mice
J. Lipid Res., April 1, 2008; 49(4): 773 - 781.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Collot-Teixeira, J. Martin, C. McDermott-Roe, R. Poston, and J. L. McGregor
CD36 and macrophages in atherosclerosis
Cardiovasc Res, August 1, 2007; 75(3): 468 - 477.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
S. Nourshargh, F. Krombach, and E. Dejana
The role of JAM-A and PECAM-1 in modulating leukocyte infiltration in inflamed and ischemic tissues
J. Leukoc. Biol., October 1, 2006; 80(4): 714 - 718.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
M. Rajesh, A. Kolmakova, and S. Chatterjee
Novel Role of Lactosylceramide in Vascular Endothelial Growth Factor-Mediated Angiogenesis in Human Endothelial Cells
Circ. Res., October 14, 2005; 97(8): 796 - 804.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
J.-S. Choi, Y.-J. Choi, S.-H. Park, J.-S. Kang, and Y.-H. Kang
Flavones Mitigate Tumor Necrosis Factor-{alpha}-Induced Adhesion Molecule Upregulation in Cultured Human Endothelial Cells: Role of Nuclear Factor-{kappa}B
J. Nutr., May 1, 2004; 134(5): 1013 - 1019.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. M. Troen, E. Lutgens, D. E. Smith, I. H. Rosenberg, and J. Selhub
The atherogenic effect of excess methionine intake
PNAS, December 9, 2003; 100(25): 15089 - 15094.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
B. OSTERUD and E. BJORKLID
Role of Monocytes in Atherogenesis
Physiol Rev, October 1, 2003; 83(4): 1069 - 1112.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
N. van Royen, I. Hoefer, M. Bottinger, J. Hua, S. Grundmann, M. Voskuil, C. Bode, W. Schaper, I. Buschmann, and J.J. Piek
Local Monocyte Chemoattractant Protein-1 Therapy Increases Collateral Artery Formation in Apolipoprotein E-Deficient Mice but Induces Systemic Monocytic CD11b Expression, Neointimal Formation, and Plaque Progression
Circ. Res., February 7, 2003; 92(2): 218 - 225.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M.-C. Bourdillon, R. N. Poston, C. Covacho, E. Chignier, G. Bricca, and J. L. McGregor
ICAM-1 Deficiency Reduces Atherosclerotic Lesions in Double-Knockout Mice (ApoE-/-/ICAM-1-/-) Fed a Fat or a Chow Diet
Arterioscler. Thromb. Vasc. Biol., December 1, 2000; 20(12): 2630 - 2635.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Data Supplement
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zibara, K.
Right arrow Articles by McGregor, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zibara, K.
Right arrow Articles by McGregor, J.
Related Collections
Right arrow Animal models of human disease
Right arrow Pathophysiology
Right arrow Gene expression
Right arrow Genetically altered mice
Right arrow Endothelium/vascular type/nitric oxide