Atherosclerosis and Lipoproteins |
Presented in part at the XVIIth International Society on Thrombosis and Hemostasis Congress, Washington, DC, August 1421, 1999, and published in abstract form (Thromb Haemost. 1999;82[suppl 1]:344).
From INSERM U331/Faculté de Médecine RTH Laënnec (K.Z., E.C., C.C., J.M.), Lyon, France; the Department of Experimental Pathology (R.P.), United Medical and Dental Schools of Guys and St. Thomas Hospitals, London, UK; and Transgenic Alliance (G.C., P.H.), Iffa Credo, LArbresle, France.
Correspondence to Kazem Zibara, PhD, INSERM U331, Faculté de Médecine RTH Laënnec, 8 rue Guillaume Paradin, F-69732 Lyon Cedex 08, France. E-mail zibara{at}laennec.univ-lyon 1.fr
| Abstract |
|---|
|
|
|---|
Key Words: atherosclerosis adhesion molecules apolipoprotein Edeficient mice quantitative image analysis Northern blots
| Introduction |
|---|
|
|
|---|
Genetic variation at the apoE locus in humans is associated with hyperlipidemia and premature atherosclerotic risk.11 Recently, apoE-null (apoE-/-) mice, generated by gene targeting,12 have been shown to develop pronounced hypercholesterolemia and atherosclerotic lesions13 with certain features resembling those seen in humans14 15 and other species.16 These mice have become accepted as an animal model for the study of factors involved in atherogenesis.17 However, for this model, little is known about the expression of the endothelial adhesion molecules that are implicated in human atherosclerosis.
In the present study, the mean expression of adhesion molecules, lining the whole vessel intimal circumference, over a period of time (0 to 20 weeks of diet) was quantitatively assessed in apoE-/- mice (C57BL/6 background) and wild-type mice fed a chow or a cholesterol-rich diet. Results showed first an increase (at 6 weeks) and then a reduction (at 16 weeks) in ICAM-1 and PECAM-1 (P<0.05) levels in apoE-/- but not in wild-type animals. In the second part of the study, we assayed the levels of adhesion molecules in different types of histologically defined atherosclerotic lesions in apoE-/- animals fed for 20 weeks. All 3 adhesion molecules (ICAM-1, PECAM-1, and VCAM-1) were observed to be reduced in fibrofatty and complex lesions but not in fatty streaks or adjacent to areas without lesions.
| Methods |
|---|
|
|
|---|
Mice
The apoEm1Unc line was obtained from Dr N.
Maeda (University of North Carolina, Chapel Hill). Control C57BL/6JIco
and apoE-deficient mice (C57BL/6JIco background) were backcrossed,
bred, and housed under specific and opportunistic pathogen-free
conditions by Transgenic Alliance (Iffa Credo S.A., a Charles River Co,
Lyon, France). Control (n=45) and apoE-deficient (n=45) mice were
weaned at 3 weeks of age and maintained on a chow diet for 1 week
("Souriffarat" breeding diet, standard formulation, pellets,
irradiated at 25 kGy, from Extralabo). After that stage, they either
had access to a chow diet (4% fat, 0% cholesterol) or a
Western-type diet (21% fat, 0.15% cholesterol, special
high fat formulation powder, irradiated at 25 kGy). Basal
observations were made in 3-week-old weaned control or apoE-deficient
mice. All animals received water and food ad libitum during the 3-, 6-,
16-, and 20-week schedules.
Cholesterol Level Analysis in ApoE-Deficient
and Wild-Type Mice
This section can be accessed online at www.ahajournals.org.
Organ Isolation and Preparation for Immunohistochemistry and
Molecular Biology Techniques
This section can be accessed online at www.ahajournals.org.
Validation of All Types of Vascular Lesions and Intimal/Media
Thickness Ratio
This section can be accessed online at www.ahajournals.org.
Immunohistochemistry
Five serial sections were immunostained and
quantitatively analyzed for each animal. Briefly, one of these
5 sections, originating from apoE and C57BL6 animals at different time
periods (0 to 20 weeks), was simultaneously stained as
described online at www.ahajournals.org. In addition, 3 positive and 3
negative controls were present in all staining series. Finally,
calibration of the Leica image analyzer, for the whole study,
was kept at the same original setting. The following primary monoclonal
antibodies were used for immunohistochemical studies. Anti-mouse
PECAM-1 (rat IgG2a, 50 µg/mL), anti-mouse VCAM-1 (rat IgG2a, 5
µg/mL), and the nonimmune IgG (rat IgG2a, 5 µg/mL) were purchased
from Pharmingen. Anti-mouse ICAM-1 (rat IgG2a, 4 µg/mL) was obtained
from Seikagaku Co. Anti
-actin monoclonal antibody (mouse IgG2a, 5
µg/mL) was from Boehringer-Mannheim, and anti-mouse
macrophage (rat IgG2b, 5 µg/mL) was from Serotec.
Endothelial cells were identified through the use of an
anti-human von Willebrand factor (rabbit polyclonal), which was
purchased from Dako. Antibodies were detected as described online at
www.ahajournals.org. A nonimmune IgG was used at the place of the
primary antibodies as a negative control. A nuclear counterstaining
with hematoxylin followed immunohistochemistry for the identification
of macrophages and SMCs.
Image Analysis
Endothelial layer staining of the aortic arch
sections was quantified by using a color image analyzer
(Quantimet 600 Leica analyzer) according to the technique
described by Poston et al.7 The technique used is
described online at www.ahajournals.org.
Data Comparisons
The Student test or 1-way ANOVA was performed with the use of
StatView 4.02 software (Abacus Concept, Inc). Results are expressed as
mean±SEM, and a value of P<0.05 was considered
significant.
Total RNA Isolation
Aortas and aortic arches from C57BL6 and
apoE-/- mice (n=64),
isolated at different periods of time (0, 6, 16, and 20 weeks), were
snap-frozen in liquid nitrogen and stored at -80°C. Total RNA was
extracted from each individual mouse at the indicated times (n=8).
Briefly, frozen tissue was ground in a mortar in liquid nitrogen. The
frozen powdered sample was immediately mixed with TRIzol (Gibco BRL,
Life Technologies) and homogenized with a Polytron
(Brinkmann). Total RNA was extracted by using the TRIzol method
adapted from the procedure of Chomczynski and
Sacchi.18
Probe Synthesis and Labeling
The 625-bp ICAM probe was prepared by reverse transcription
(RT)polymerase chain reaction (PCR) by use of the following primers:
ICAM1390U (CATCGGGGTGGTGAAGTCTGT) and ICAM1996L (TGTCGGGGGAAGTGTGGTC).
RT-PCR amplification, labeling, and purification are described online
at www.ahajournals.org.
Northern Blots
Total RNA (20 µg) was denatured, separated by electrophoresis
on a formaldehyde-MOPS-agarose gel, and then transferred to a nylon
membrane (Hybond N+, Amersham). Capillary blotting was performed
overnight, and then the membrane was baked for 2 hours at 80°C.
Prehybridization and hybridization were performed according to standard
protocols.19 Blots were exposed against a PhosphorImager
screen (Molecular Dynamics) for 24 hours. Scanning was performed under
a 100-µ scale, and the ImageQuant software was then used for
quantification. Variations in RNA loading were assessed by using the
GAPDH probe (Clontech), which allowed normalizing ICAM-1 values. All
quantification values were corrected for background levels by using the
local median method of the ImageQuant software. The initial scan image
(gel format) was transferred into a tif file to provide the
Northern blot figures presented in this article.
RT-PCR Analysis of VCAM-1
RNA-extracted aortas of C57BL6 and apoE mice were treated with
DNase I to remove genomic contamination (MessageClean,
GenHunter). Removal of DNA was verified by performing a PCR,
with use of GAPDH as well as VCAM-1 primers, on the extracted RNA (or
an RT-PCR without the addition of the reverse transcriptase enzyme).
Absence of these transcripts confirmed efficient removal of genomic
DNA. The 375-bp GAPDH cDNA was obtained by using the following primers:
GPDH-793U21 (ACCTGCCAAGTATGATGACAT) and GPDH-1148L21
(CCTGTTATTATGGGGGTCTG). The 447-bp VCAM-1 cDNA was obtained by using
the following primers: VCAM-1660U21 (CAGCTAAATAATGGGGAACTG) and
VCAM-2088L19 (GGGCGAAAAATAGTCCTTG). The RT-PCR conditions were the same
as for the synthesis of the ICAM-1 probe (see above).
| Results |
|---|
|
|
|---|
|
Quantitative Results
Quantitative results, obtained from image analysis of
stained sections, are presented in 2 main parts: (1) the mean
expression of endothelium adhesion molecules, lining
the whole vessel circumference, over a period of time (0 to 20 weeks of
diet in chow- or fat-fed
apoE-/- compared with
wild-type animals), and (2) the mean expression of adhesion molecules,
correlated with the different types of histologically
defined vascular lesions, in 20-week fat-fed
apoE-/- mice.
Mean Expression of Adhesion Molecules Over Time (0 to 20 Weeks
of Diet)
Background expression of adhesion molecules was calculated from
the mean of ICAM-1, PECAM-1, and VCAM-1 expression by
endothelial cells, which were present all around
the intimal vessel circumference.
ApoE-/- mice (n=5) were
compared with C57BL/6 mice (n=5) over a period of time (0 to 20 weeks
of the chow or fat diet, Figure 2
and
Figures I, II, III, which can be accessed online at
www.ahajournals.org).
|
The apoE-/- mice weaned
at 3 weeks of age (no diet) showed moderate expression of ICAM-1
(Figure 2A
). ICAM-1 expression was strongly increased
(P<0.001) in the endothelium of
apoE-/- animals fed either diet for 3 or 6 weeks
compared with weaned mice. Compared with 6 weeks, after 16 or 20 weeks
of either diet, ICAM-1 expression was significantly reduced
(P<0.001). Such lower ICAM-1 expression was particularly
significant in apoE-/- animals fed a fat diet. In
contrast, C57BL/6 mice showed a steady expression of ICAM-1 from 3 to
20 weeks, irrespective of diet. C57BL/6 mice on a fat diet, compared
with those on a chow diet, showed a slight but significant
(P<0.001) increase in ICAM-1 expression (Figure 2B
).
A high basal PECAM-1 expression, measured in the
endothelium of the
apoE-/- mice weaned at 3
weeks of age (no diet), was observed. Moreover, upregulated expression
of PECAM-1 (P<0.05) was observed for
apoE-/- animals on either diet for 3 weeks. In
addition, after 6 weeks of the chow diet, endothelial
PECAM-1 expression was significantly (P<0.05) increased.
PECAM-1 expression was significantly decreased (P<0.001)
for apoE-/- animals fed a chow diet for 16 and 20 weeks
compared with those fed a chow diet for 6 weeks (Figure 2C
).
C57BL/6 mice showed a major increase (P<0.001) in PECAM-1
expression after 3 weeks of either type of diet compared with weaned
mice. Then, after 6 to 20 weeks of either diet, the expression of
PECAM-1 was found to be more or less steady. One should note a
consistently higher level of PECAM-1 expression
(P<0.05) in the fat-fed compared with the chow-fed animals
(Figure
I, which can be accessed online at www.ahajournals.org).
VCAM-1 basal expression, measured in the endothelium of
the weaned apoE-/- mice
(3 weeks of age and no diet), showed variable levels. VCAM-1
expression did not show a significant modulation pattern, as was
observed for ICAM-1 and PECAM-1. Moreover, the VCAM-1 expression levels
were consistently lower compared with those of ICAM-1 and
PECAM-1. No significant differences in VCAM-1 expression were observed
between apoE animals fed a fat or chow diet (Figure
II, which can be
accessed at www.ahajournals.org). In addition, compared with weaned
mice, wild-type mice showed no significant changes in VCAM-1 expression
by endothelial cells over time (Figure
III, which can
be accessed online at www.ahajournals.org).
Mean Expression of Adhesion Molecules Correlated With Vascular
Lesions (ApoE-/- Mice After 20 Weeks of
Diet)
Background expression of adhesion molecules correlated with
vascular lesions was calculated from the expression of ICAM-1, PECAM-1,
and VCAM-1 by endothelial cells. Such
endothelial cells overlay vessels that showed either
fatty-streak, fibrofatty, complex, or no lesions in
apoE-/- mice (n=5) fed a
fat diet for 20 weeks or
apoE-/- animals (n=5)
aged 3 weeks of age that were not on a diet (Figure 3
and Figure
IV, which can be accessed
online at www.ahajournals.org).
|
ICAM-1 expression in weaned animals not on a diet was low (Figure 3A
). In contrast, in animals fed 20 weeks of the fat diet,
compared with weaned animals, ICAM-1 expression was significantly
elevated in areas with no lesions. This high level of ICAM-1
expression, associated with histologically identified
atherosclerotic lesions, was also present in
endothelium overlying fatty streaks. However, ICAM-1
levels were significantly (P<0.05) reduced in fibrofatty
and complex lesions compared with areas with no lesions (Figure 3A
).
PECAM-1 expression by endothelium from weaned animals
was very high. No difference was observed between areas showing no
lesions or fatty-streak lesions. In contrast, PECAM-1 expression was
significantly reduced in endothelial cells overlying
fibrofatty or complex lesions compared with areas with no lesions
(Figure
IV, which can be accessed online at www.ahajournals.org).
VCAM-1 expression by endothelium from weaned animals
was low (Figure 3B
). VCAM-1 levels in
histologically identified lesions in animals fed 20
weeks of the fat diet were markedly increased (P<0.05) in
the endothelium overlying the fatty streaks and
decreased in a very significant way (P<0.001) in fibrofatty
or complex lesions compared with areas with no lesions.
Northern Blots
Confirmation of immunohistochemical results on ICAM-1 was obtained
by Northern blots performed on aortic arch samples of apoE and C57BL6
chow-fed mice over a period of 20 weeks. Samples from 8 different
animals (C57BL6 and apoE) at different time points (0, 6, 16, and 20
weeks) were separately investigated (Figure 4A
). This overall analysis of
aortic arch samples was performed on a total of 64 animals. Results
show that ICAM-1, in aortic arch samples of apoE mice at 6 weeks of
chow diet, is upregulated (by at least 2-fold) compared with C57BL6 and
apoE animals at 0 and 16 weeks (Figure 4B
). However, an increase
in ICAM-1 transcription was observed in the aortic arch at 20 weeks.
There was no particular pattern for ICAM-1 expression in C57BL6. The
present study shows for the first time, with use of Northern blots,
that the ICAM-1 transcription level is modulated in the aortic arch of
6-week chow-fed apoE but not C57BL6 mice. One should note that Northern
blot results are obtained from RNAs extracted from whole vessels. In
contrast, immunohistochemistry is performed on
endothelial cells lining the vessel wall.
|
RT-PCR Analysis of VCAM-1
In the present study, we report for the first time the
presence of VCAM-1 mRNA transcripts in murine aortas at different
periods of time (Figure 5A
). The
presence of VCAM-1 mRNA was tested by RT-PCR on aortas, aortic arches,
and hearts of C57BL6 and apoE mice. All these tissues showed the
presence of VCAM-1 mRNA after genomic DNA removal (Figure 5B
). A
GAPDH-positive control in the RT-PCR experiments is shown in Figure
V
(which can be accessed online at www.ahajournals.org). The
above-mentioned VCAM-1 data confirm that detection of VCAM-1 by
immunological methods is not a background noise. These observations are
very much in line with those obtained by immunological techniques as
shown in the present study.
|
| Discussion |
|---|
|
|
|---|
Atherosclerotic lesions may be the result of some form of inflammation,
induced by the presence of oxidized LDL, Chlamydia
pneumoniae,21 or viral or other factors,
occurring at the level of the vessel wall.22 Vascular
endothelial cells, activated at sites of
inflammation, interact with different leukocyte subtypes via adhesion
molecules and different cofactors and are thought to play a key role in
the initiation and perpetuation of atherosclerotic
lesions.23 24 Among a number of adhesion molecules
implicated in the homing of leukocytes to sites of inflammation,
endothelial ICAM-1 and its leukocyte ligand CD11a/CD18
(also known as
Lß2 or
lymphocyte functionassociated antigen-1) play a major role in this
process.25 26 In the present study, a significant
modulation of ICAM-1 expression over time by
endothelial cells lining the whole vessel wall
circumference was observed for the aortic arch region of apoE-deficient
mice fed a fat or chow diet. Northern blots on aortic arch samples, for
determination of ICAM-1 gene expression, showed an increase at 6 weeks
(by at least 2-fold) compared with 0 and 16 weeks in C57BL6 and apoE
animals. However, an increase in ICAM-1 transcription was observed in
the aortic arch at 20 weeks. These Northern data results are in line
with those obtained by immunohistochemistry at 0, 6, and 16 weeks but
not at 20 weeks. One should note that Northern blots are performed on
whole vessels, whereas immunohistochemistry was performed on
endothelial cells lining the vessel circumference.
Additional transcription of ICAM-1 may take place in other cells, such
as SMCs, present in the vessel. It is interesting that such an
increase of ICAM-1 transcription levels at 20 weeks in aortic arch
samples is not present in aortas (data not shown). Reduced
endothelial ICAM-1 expression coincided with the
presence of a significant number of more advanced fibrotic lesions. A
decrease in ICAM-1 expression may be matched with a reduced influx of
leukocytes within atherosclerotic walls. Indeed, Roselaar et
al27 indicate that the number of T lymphocytes,
immunoreactive for Thy 1.2, CD4, CD5, and CD8, in atherosclerotic
lesions of 16-week-old apoE-/- and LDL
receptordeficient mice is very significantly decreased from the
levels present in 4-week-old mice. Interestingly, blocking the
access of ICAM-1 to leukocytes by monoclonal antibodies in
apoE-deficient animals on a chow diet reduced the homing of
macrophages to atherosclerotic plaques by 65%.28
Our results are supported by a recent study that used qualitative
analysis and reported increased ICAM-1 expression in
apoE-deficient animals.29 Moreover, and very
significantly, observations made on human coronaries and carotids show
ICAM-1 expression to be correlated with vascular lesions.7
ICAM-1, as well as VCAM-1, is expressed in a flow-dependent
manner.30 Upregulation of ICAM-1 from its constitutive
levels of expression on cultured human and rabbit arterial
endothelial cells has been shown to occur after
lysophosphatidylcholine treatment.31 Moreover,
lysophosphatidylcholine induced the expression of ICAM-1 on
endothelium derived from human iliac arteries but not
from umbilical veins.31 It is of interest
to note that high levels of lysophosphatidylcholine are present in
a hyperlipidemic state.
Endothelial adhesion molecules, together with other
important cofactors, such as chemoattractants, play a critical role in
the homing of monocytes to sites of vascular lesions. In
apoE-/- compared with wild-type animals, a significant
modulation of ICAM-1 expression over time is observed. Other factors,
in addition to adhesion molecules, appear to be implicated in the swift
initiation and perpetuation of vascular lesions. Indeed, knocking out
monocyte chemoattractant protein-1 (MCP-1) or its receptor, in LDL
receptordeficient or apoE-/- mice, respectively, will
also significantly decrease lesion formation.32 33
Blocking nuclear factor-
B activity in endothelial
cells by anti-sense oligonucleotides will affect not
only ICAM-1 upregulation but also MCP-1 production and,
ultimately, the homing of monocytes.34 Adhesion and
transmigration, mediated by several interacting molecular mechanisms,
appear to be essential for monocyte traffic in
atherosclerosis. Some of these factors, such as nuclear
factor-
b, MCP-1, interleukin-8/neutrophil-activating peptide,
platelet-activating factor, and RANTES, may be activated or
upregulated at an early stage in
apoE-/- but not wild-type
mice.
PECAM-1 is one of the most abundant constitutively expressed
endothelial cell adhesion molecules (up to
106 molecules per cell).7 There is
good evidence to suggest that it is a key participant in the adhesion
cascade leading to extravasation of leukocytes to sites of
inflammation.35 However, the mechanism explaining PECAM-1
implication in leukocyte transmigration is not yet completely
elucidated. PECAM-1 molecules expressed by leukocytes and
endothelial cells are known to allow homophilic
interactions.36 In addition, it has been suggested that
PECAM-1 can interact with upregulated
vß3.37 38 In
the present study, a significant modulation of
endothelial PECAM-1 expression, lining the whole vessel
wall circumference, was observed for apoE-deficient but not wild-type
mice. It is of interest to note that PECAM-1 expression can be
significantly modulated after treatment of human umbilical vein
endothelial cells with inflammatory cytokines.
Indeed, tumor necrosis factor-
and interferon-
can lead to the
disappearance of PECAM-1 from cell junctions and a very significant
reduction in the migration of leukocytes through
endothelial cells.39 In a recently
published report31 on apoE, it was stated that PECAM-1
appears not to be differentially regulated. Differences between our
results and those of Nakashima et al29 may
conceivably be due to the fact that we have used a quantitative
technique to assay the mean expression level of PECAM-1. It is
conceivable that the increased expression of PECAM-1 and ICAM-1 is the
result of either a continuous insult of endothelial
cells or repeated insult and injury, which may result in
endothelial cell regeneration.1 Albelda et
al35 36 inhibited in vitro confluence of cultured
endothelial cells by using anti-PECAM-1 antibodies.
Such data strongly indicate that PECAM-1, through its homotypic
mechanism of adhesion, is actively involved in the regulation of
cell-cell adhesion.36 The cooperation between adhesion
molecules may enhance cell-cell cross talk and subsequent interactions.
It was recently suggested that homophilic adhesion of PECAM-1 might
lead to integrin upregulation.40
Endothelial VCAM-1, an inducible cell surface adhesion
molecule of the immunoglobulin gene superfamily, interacts with cells
expressing the integrin
4ß1
ligand.41 VCAM-1 has been identified as a very early event
in the development of atherosclerotic lesions in experimental animal
models.42 Our results show that over time the profile of
endothelial VCAM-1 mean expression, lining the whole
vessel intimal circumference, did not significantly change for either
apoE-/- or wild-type
mice. However, endothelial VCAM-1 was highly expressed
over fatty streaks and was decreased on fibrofatty and complex lesions.
In our samples, VCAM-1 not only was identified on
endothelial cells but also was present on
proliferating SMCs. These data report for the first time the presence
of VCAM-1 mRNA levels in murine control C57BL6, as well as apoE,
aortas. All murine tissues tested (aortas, aortic arches, and hearts)
showed the presence of VCAM-1 mRNA after genomic DNA removal. Great
care should be taken in the selection of primers, PCR product
length, and PCR conditions to be able to detect murine VCAM-1 mRNA.
These observations are very much in line with those obtained with the
use of immunological techniques, as shown in the present study and
in those reported by a number of authors. In fact, by use of in vivo
radiolabeled monoclonal antibody techniques, constitutive murine
(C57BL/6Jstrain) VCAM-1 expression was shown to be present in the
heart vasculature. Moreover, murine constitutive VCAM-1 expression is
quite heterogeneous, with the highest level present in
the heart, followed by the mesentery, brain, and small
intestine.43 Another study showed the presence of
constitutive VCAM-1 expression by the endothelium of
the coronary artery and the endocardium in C57BL/6
mice.44 In addition, scattered endothelial
cells in normal murine aorta express VCAM-1.45 Moreover,
Ando et al46 demonstrated that cultured murine
endothelial cells show constitutive high levels of
VCAM-1 expression. Furthermore, Li et al47 found similar
results within arteriosclerotic plaques from
rabbits fed a 0.3% cholesterolcontaining diet. Moreover,
a recent study involving apoE-deficient mice31 very much
supports the present observations. In human tissues, different
workers showed VCAM-1 expression to be either present or weakly
detected in atherosclerotic lesions. To explain such discrepancies, it
is conceivable that lesions examined by different teams may have been
at slightly different stages of evolution of the plaque or ages of the
patients. De novo expression of VCAM-1 may be induced, as it is for
ICAM-1, by the generation of lysophosphatidylcholine during
hyperlipidemia, leading preferentially for mononuclear
recruitment to sites of atherogenesis.48 Finally, VCAM-1
may play a vital role in the vasa vasorum, by modulating the
extravasation of leukocytes.11 25
One possible way to investigate the role of adhesion molecules in initiating and perpetuating vascular lesions over time is by measuring their mean expression level present around the whole vessel circumference. Conceivably, such an analysis may have its limitations, with an increase of an adhesion molecule at one site of lesion neutralized by a decrease at another. However, results in the present study show that the mean level of adhesion molecule expression, assayed by measurements on healthy and diseased endothelium over time, show a significantly different pattern for apoE-/- and wild-type mice. ICAM-1 and PECAM-1 are adhesion molecules that are constitutively expressed, as opposed to VCAM-1, which is inducible, by vascular endothelial cells. Such differences may perhaps give a clue to the results that have been obtained in the present study. Great care should be taken in evaluating the role of these adhesion molecules, inasmuch as a number of other adhesion molecules, such as P-selectin and E-selectin, have not been taken in consideration in the present study.49 In addition, caution has to be taken in extrapolating results from mice to humans because of the considerable differences in genetic, metabolic, and other pathways leading to atherosclerosis. Indeed, an absence of cholesteryl ester transfer protein and Lp(a) is observed in mice. Moreover, most studies in mice are performed on the aorta instead of the coronary arteries. Genes implicated in diseased coronaries are thought to differ from those implicated in aortic lesions.50
In conclusion, our results suggest that ICAM-1, PECAM-1, and VCAM-1 expressions may provide a background to the atherosclerotic plaque formation in this model. Specifically, they would greatly facilitate monocyte adhesion to the endothelium and subsequent extravasation. However, the complexity of the interplay of biomechanical and humoral stimuli in the induction and modulation of adhesion molecules and their cofactors remains far from being clear. Expressions of these adhesion molecules in knockout animals were correlated with the evolution of the plaque from a fatty to a fibrous stage.
| Acknowledgments |
|---|
Received December 13, 1999; accepted February 14, 2000.
| References |
|---|
|
|
|---|
2. Suzuki H, Kuriara Y, Takeya M, Kamada N, Kataoka M, Jishage K, Ueda O, Sagakuchi H, Higashi T, Suzuki T, et al. A role for macrophage scavenger receptors in atherosclerosis and susceptibility to infection. Nature.. 1997;386:292296.[Medline] [Order article via Infotrieve]
3. Hajjar DP, Nicholson AC. Atherosclerosis. Am Scientist.. 1995;83:460467.
4. Munro JM, Cotran RS. Biology of the disease: the pathogenesis of atherosclerosis: atherogenesis and inflammation. Lab Invest.. 1988;58:249261.[Medline] [Order article via Infotrieve]
5.
Ohno T, Gordon D, San H, Pompili VJ, Imperiale MJ,
Nabel GJ, Nabel EG. Gene therapy for vascular smooth muscle cell
proliferation after arterial injury. Science.. 1994;265:781784.
6. Springer TA. Adhesion receptors of the immune system. Nature.. 1990;346:425434.[Medline] [Order article via Infotrieve]
7. Poston RN, Haskard DO, Coucher JR, Gall NP, Johnson-Tidey RR. Expression of intercellular adhesion molecule-1 in atherosclerotic plaques. Am J Pathol.. 1992;140:665673.[Abstract]
8.
Bogen S, Pak J, Garifallou M, Deng X, Muller WA.
Monoclonal antibody to murine PECAM-1 (CD31) blocks acute inflammation
in vivo. J Exp Med.. 1994;179:10591064.
9.
Cybulsky MI, Gimbrone MA Jr.
Endothelial expression of a mononuclear leukocyte
adhesion molecule during atherogenesis. Science.. 1991;251:788791.
10. Johnson-Tidey RR, McGregor JL, Taylor PR, Poston RN. Increase in the adhesion molecule P-selectin in endothelium overlaying atherosclerotic plaques: coexpression with intercellular adhesion molecule-1. Am J Pathol.. 1994;144:952961.[Abstract]
11. Schaefer EJ, Gregg RE, Ghiselli G, Forte TM, Ordovas JM, Zech LA, Brewer HB Jr. Familial apolipoprotein deficiency. J Clin Invest.. 1986;78:12061219.
12.
Piedrahita JA, Zhang SH, Hagaman JR, Oliver PM, Maeda
N. Generation of mice carrying a mutant apolipoprotein E gene
inactivated by gene targeting in embryonic stem cells.
Proc Natl Acad Sci U S A.. 1992;89:44714475.
13.
Reddick RL, Zhang SH, Maeda N.
Atherosclerosis in mice lacking apo E: evaluation of
lesional development and progression. Arterioscler Thromb.. 1994;14:141147.
14.
Nakashima Y, Plump AS, Raines EW, Breslow JL, Ross R.
ApoE-deficient mice develop lesions of all phases of
atherosclerosis throughout the arterial
tree. Arterioscler Thromb.. 1994;14:133140.
15.
Davies MJ, Woolf N, Rowles PM, Pepper J. Morphology of
the endothelium over atherosclerotic plaques in human
coronary arteries. Br Heart J.. 1988;60:459464.
16. Rosenfeld ME, Tsukada T, Gown AM, Ross R. Fatty streak initiation in a Watanabe heritable hyperlipemic and comparably hypercholesterolemic fat-fed rabbits. Arteriosclerosis.. 1987;7:923.[Abstract]
17. Shih DM, Welch C, Lusis AJ. New insights into atherosclerosis from studies with mouse models. Mol Med Today.. 1995;1:364372.[Medline] [Order article via Infotrieve]
18. Chomczynski P, Sacchi N. Single step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem.. 1987;162:156159.[Medline] [Order article via Infotrieve]
19. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory; 1989.
20. Plump AS, Breslow JL. Apolipoprotein E and the apolipoprotein E-deficient mouse. Annu Rev Nutr.. 1995;15:495518.[Medline] [Order article via Infotrieve]
21.
Shor A, Kuo CC, Patton DL. Detection of Chlamydia
pneumoniae in aortic lesions of atherosclerosis by
immunocytochemical stain. Arterioscler Thromb.. 1993;13:15011504.
22.
Ross R. Atherosclerosis: a problem of
the biology of arterial wall cells and their interactions
with blood components. Arteriosclerosis.. 1981;1:293311.
23.
OBrien KD, McDonald TO, Chait A, Allen MD, Alpers CE.
Neovascular expression of E-selectin, intercellular adhesion
molecule-1, and vascular cell adhesion molecule-1 in human
atherosclerosis and their relation to intimal leukocyte
content. Circulation.. 1996;93:672682.
24. Poston RN, Johnson-Tidey RR. Localized adhesion of monocytes to human atherosclerotic plaques demonstrated in vitro. Am J Pathol.. 1996;149:7380.[Abstract]
25. Marlin SD, Springer TA. Purified intercellular adhesion molecule (ICAM-1) is a ligand for lymphocyte function-associated antigen 1 (LFA-1). Cell.. 1987;51:813819.[Medline] [Order article via Infotrieve]
26. Makgoba MW, Sanders ME, Ginther Luce GEG, Dustin ML, Springer TA, Clark EA, Mannoni P, Shaw S. ICAM-1 a ligand for LFA-1 dependent adhesion of B, T and myeloid cells. Nature.. 1988;331:8688.[Medline] [Order article via Infotrieve]
27.
Roselaar SE, Kakkanathu PX, Daugherty A. Lymphocyte
populations in atherosclerotic lesions of
apoE-/- and LDL
receptor-/- mice:
decreasing density with disease progression. Arterioscler Thromb
Vasc Biol.. 1996;16:10131018.
28.
Patel SS, Thiagarajan R, Willerson JT, Yeh ET.
Inhibition of alpha4 integrin and ICAM-1 markedly attenuate
macrophage homing to atherosclerotic plaques in ApoE-deficient
mice. Circulation.. 1998;97:7581.
29.
Nakashima Y, Raines EW, Plump AS, Breslow JL, Ross R.
Upregulation of VCAM-1 and ICAM-1 at
atherosclerosis-prone sites on the
endothelium in the apoE-deficient mouse.
Arterioscler Thromb Vasc Biol.. 1998;18:842851.
30.
Walpola PL, Gotlieb AI, Cybulsky MI, Langille BL.
Expression of ICAM-1 and VCAM-1 and monocyte adherence in arteries
exposed to altered shear stress. Arterioscler Thromb Vasc
Biol.. 1995;15:210.
31. Kume N, Cybulsky MI, Gimbrone MA Jr. Lysophosphatidylcholine, a component of atherogenic lipoproteins, induces mononuclear leukocyte adhesion molecules in cultured human and rabbit arterial endothelial cells. J Clin Invest.. 1992;90:11381144.
32. Boring L, Gosling J, Cleary M, Charo IF. Decreased lesion formation in CCR2-/- mice reveals a role for chemokines in the initiation of atherosclerosis. Nature.. 1998;394:894897.[Medline] [Order article via Infotrieve]
33. Gu L, Okada Y, Clinton SK, Gerard C, Sukhova GK, Libby P, Rollins BJ. Absence of monocyte chemoattractant protein-1 reduces atherosclerosis in low density lipoprotein receptor-deficient mice. Mol Cell.. 1998;2:275281.[Medline] [Order article via Infotrieve]
34.
Gawaz M, Neuman F-J, Dickfeld T, Koch W, Laugwitz K-L,
Adelsberger H, Langenbrink K, Page S, Neumeier D, Schömig A, et
al. Activated platelets induce monocyte chemotactic
protein-1 secretion and surface expression of intercellular adhesion
molecule-1 on endothelial cells.
Circulation.. 1998;98:11511152.
35.
Vaporcyian AA, DeLisser HM, Yan H, Mendiguren II, Thom
SR, Jones PA, Ward PA, Albelda SM. Involvement of platelet
endothelial cell adhesion molecule-1 in neutrophil
recruitment in vivo. Science.. 1993;262:15801582.
36.
Albelda SM, Muller WA, Buck CA, Newman PJ. Molecular
and cellular properties of PECAM-1 (endoCam/CD 31): a novel vascular
cell-cell adhesion molecule. J Cell Biol.. 1991;114:10591068.
37.
Piali L, Hammel P, Uherek C, Bachmann F, Gisler RH,
Dunon D, Imhof BA. CD31/PECAM-1 is a ligand for
vß3 integrin involved
in adhesion of leukocytes to endothelium. J
Cell Biol.. 1995;130:451460.
38.
Buckley CD, Doyonnas R, Newton JP, Blystone SD Brown
EJ, Watt SM, Simmons DL. Identification of
vß3 as a heterotopic
ligand for CD31/PECAM-1. J Cell Sci.. 1996;109:437445.[Abstract]
39.
Rival Y, Del Maschio A, Rabiet MJ, Dejana E, Duperray
A. Inhibition of platelet endothelial cell adhesion
molecule-1 synthesis and leukocyte transmigration in
endothelial cells by the combined action of
TNF-
and IFN-
. J Immunol.. 1996;157:12331241.[Abstract]
40. Newman PJ. Perspectives series on cell adhesion in vascular biology: the biology of PECAM-1. J Clin Invest.. 1997;99:37.[Medline] [Order article via Infotrieve]
41. Elices MJ, Osborn L, Takada Y, Crouse C, Luhowskyl S, Hemler ME, Lobb RR. VCAM-1 on activated endothelium interacts with the leukocyte integrin VLA-4 at a site distinct from the VLA-fibrinogen binding site. Cell.. 1990;60:577584.[Medline] [Order article via Infotrieve]
42. Cybulsky MI, Gimbrone MA. Endothelial expression of a mononuclear leukocyte adhesion molecule during atherogenesis. Science.. 1991;251:788791.
43. Henninger DD, Panes J, Eppihimer M, Russell J, Gerritsen M, Anderson DC, Granger DN. Cytokine-induced VCAM-1 and ICAM-1 expression in different organs of the mouse. J Immunol.. 1997;158:18251832.[Abstract]
44. Russell PS, Chase CM, Colvin RB. Accelerated atheromatous lesions in mouse hearts transplanted to apolipoprotein-E-deficient recipients. Am J Pathol.. 1996;149:9199.[Abstract]
45. Lindner V, Collins T. Expression of NF-kappa B and I kappa B-alpha by aortic endothelium in an arterial injury model. Am J Pathol.. 1996;148:427438.[Abstract]
46.
Ando J, Tsuboi H, Korenaga R, Takada Y, Toyama
Sorimachi N, Miyasaka M, Kamiya A. Shear stress inhibits adhesion of
cultured mouse endothelial cells to lymphocytes by
downregulating VCAM-1 expression. Am J Physiol.. 1994;267:C679C687.
47. Li H, Cybulsky MI, Gimbrone MA Jr, Libby P. Inducible expression of vascular cell adhesion molecule-1 by vascular smooth muscle cells in vitro and within rabbit atheroma. Am J Pathol.. 1993;143:15511559.[Abstract]
48.
Carlos TM, Harlan JM.
Leukocyte-endothelial adhesion molecules.
Blood.. 1994;84:20682101.
49. Dong ZM, Chapman SM, Brown AA, Frenette PS, Hynes RO, Wagner DD. The combined role of P- and E-selectins in atherosclerosis. J Clin Invest.. 1998;102:1,145152.[Medline] [Order article via Infotrieve]
50. Shih DM, Welch C, Lusis AJ. New insights into atherosclerosis from studies with mouse models. Mol Med Today.. 1995;1:364373.
This article has been cited by other articles:
![]() |
K. A. O'Brien, S. Ling, E. Abbas, A. Dai, J. Zhang, W. C. Wang, A. Bensoussan, R. Luo, Z.-X. Guo, and P. A. Komesaroff A Chinese Herbal Preparation Containing Radix Salviae Miltiorrhizae, Radix Notoginseng and Borneolum Syntheticum Reduces Circulating Adhesion Molecules Evid. Based Complement. Altern. Med., September 27, 2008; (2008) nen060v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Mansouri, E. Bauge, B. Staels, and P. Gervois Systemic and Distal Repercussions of Liver-Specific Peroxisome Proliferator-Activated Receptor-{alpha} Control of the Acute-Phase Response Endocrinology, June 1, 2008; 149(6): 3215 - 3223. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Shelly, L. Royer, T. Sand, H. Jensen, and Y. Luo Phospholipid transfer protein deficiency ameliorates diet-induced hypercholesterolemia and inflammation in mice J. Lipid Res., April 1, 2008; 49(4): 773 - 781. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Collot-Teixeira, J. Martin, C. McDermott-Roe, R. Poston, and J. L. McGregor CD36 and macrophages in atherosclerosis Cardiovasc Res, August 1, 2007; 75(3): 468 - 477. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nourshargh, F. Krombach, and E. Dejana The role of JAM-A and PECAM-1 in modulating leukocyte infiltration in inflamed and ischemic tissues J. Leukoc. Biol., October 1, 2006; 80(4): 714 - 718. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Rajesh, A. Kolmakova, and S. Chatterjee Novel Role of Lactosylceramide in Vascular Endothelial Growth Factor-Mediated Angiogenesis in Human Endothelial Cells Circ. Res., October 14, 2005; 97(8): 796 - 804. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-S. Choi, Y.-J. Choi, S.-H. Park, J.-S. Kang, and Y.-H. Kang Flavones Mitigate Tumor Necrosis Factor-{alpha}-Induced Adhesion Molecule Upregulation in Cultured Human Endothelial Cells: Role of Nuclear Factor-{kappa}B J. Nutr., May 1, 2004; 134(5): 1013 - 1019. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Troen, E. Lutgens, D. E. Smith, I. H. Rosenberg, and J. Selhub The atherogenic effect of excess methionine intake PNAS, December 9, 2003; 100(25): 15089 - 15094. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. OSTERUD and E. BJORKLID Role of Monocytes in Atherogenesis Physiol Rev, October 1, 2003; 83(4): 1069 - 1112. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. van Royen, I. Hoefer, M. Bottinger, J. Hua, S. Grundmann, M. Voskuil, C. Bode, W. Schaper, I. Buschmann, and J.J. Piek Local Monocyte Chemoattractant Protein-1 Therapy Increases Collateral Artery Formation in Apolipoprotein E-Deficient Mice but Induces Systemic Monocytic CD11b Expression, Neointimal Formation, and Plaque Progression Circ. Res., February 7, 2003; 92(2): 218 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Bourdillon, R. N. Poston, C. Covacho, E. Chignier, G. Bricca, and J. L. McGregor ICAM-1 Deficiency Reduces Atherosclerotic Lesions in Double-Knockout Mice (ApoE-/-/ICAM-1-/-) Fed a Fat or a Chow Diet Arterioscler Thromb Vasc Biol, December 1, 2000; 20(12): 2630 - 2635. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 2000 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |