© 1999 American Heart Association, Inc.
Vascular Biology |
Expression of CCR2 by Endothelial Cells
Implications for MCP-1 Mediated Wound Injury Repair and In Vivo Inflammatory Activation of Endothelium
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Endothelial cell proliferation and migration may play a central role in angiogenesis, wound healing, and atherosclerosis. Although CXC chemokines can act on endothelial cells by influencing proliferation, an involvement of CC chemokines and endothelial expression of chemokine receptors remains to be elucidated. Reverse transcription-polymerase chain reaction, RNase protection, Western blot, and flow cytometric analysis showed that human umbilical vein endothelial cells express mRNA and surface protein of the monocyte chemotactic protein-1 (MCP-1) receptor CCR2, which was upregulated by inflammatory cytokines. MCP-1 induced migration of endothelial cells in a transwell assay, which was inhibited by the 9-76 MCP-1 receptor antagonist. Increased secretion of MCP-1 or interleukin-8, but not RANTES, on endothelial injury suggested a functional role of CCR2 in wound repair as measured by ELISA. After mechanical injury to endothelial monolayers, which spontaneously closed within 24 hours, wound repair was delayed by the 9-76 antagonist and by a blocking monoclonal antibody to MCP-1, but not to interleukin-8, and was improved by exogenous MCP-1. This was confirmed by quantification of cell migration into the wound area, whereas proliferation and viability were unaltered by MCP-1 or its analogue. Notably, immunohistochemistry of inflamed tissue revealed CCR2 staining on arterial, venous, and venular endothelium affected by cellular infiltration. This is the first demonstration of endothelial CCR2 expression ex vivo, inferring its involvement in inflammatory conditions. Thus endothelial cells express functional CCR2 that may have important implications for endothelial wound repair and inflammatory reactions.
Key Words: chemokine receptors • migration • chemokines • endothelial cells
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Controlled migration and proliferation of endothelial cells is required for angiogenesis and endothelial wound repair.1 2 3 The latter is crucial in preventing vascular damage due to denudation after balloon injury, which may further promote progression of atherosclerotic disease.3 Endothelial wound repair models have revealed a complex response involving migration and spreading of endothelial cells at the wound edge in the first 24 hours and proliferation distal to the wound after 36 hours.4 5 Although the regulation of endothelial migration is known to be influenced by well characterized factors, such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF),2 6 endothelial cells can also respond to chemokines.7 8 9 10 11 12 For example, endothelial cell proliferation can be inhibited by the cysteine-x amino acid-cysteine (CXC) chemokines platelet factor 4 (PF-4), interferon-inducible protein of 10 kd (IP-10), or growth-related oncogene (GRO-ß)7 8 9 10 and, in contrast, induced by interleukin-8 (IL-8).11 12 13
Chemokines are a family of homologous 8-10 kd proteins that direct leukocyte trafficking into areas of inflammation.14 15 16 17 The branches of this family are classified according to the position of the N-terminal cysteine residues. Cysteine-cysteine (CC) chemokines predominantly act on monocytes, T lymphocytes, natural killer cells, basophils, and eosinophils, whereas CXC chemokines act mainly on neutrophils and some lymphocyte subsets. Chemokines interact with G protein-coupled heptahelical receptors on the target cells, which may be regulated by the state of cell differentiation or by activation with various inflammatory mediators.18 19 20
To date, a role for CC chemokines in endothelial cell proliferation or function has not been demonstrated. The CC chemokine MCP-1 has been found in atherosclerotic plaques and areas of endothelial denudation where it may direct mononuclear infiltration.21 22 The infusion of MCP-1 has been reported to increase the conductance after femoral arterial occlusion via vessel growth, implicating its involvement in angiogenesis.23 Furthermore, CCR2, a receptor for MCP-1, has recently been identified on vascular smooth muscle cells where it may influence proliferation and migration.24 Hence, we studied the expression and function of CCR2 on endothelial cells. Our data show that endothelial cells express CCR2, which mediates endothelial cell migration to MCP-1, may contribute to the repair of endothelial wounds, and can be upregulated during inflammatory activation.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cell Culture and Reagents
Human umbilical vein endothelial cells (HUVEC) were maintained in low serum PromoCell endothelial cell growth medium, as described.25 Monoclonal antibodies (mAb) to CCR2 were kindly provided by Dr G. LaRosa (clone 5A11, IgG1) (Leukosite, Cambridge, Mass) or purchased from R&D Systems (clone No. 48607.121, IgG2b), respectively. Neutralizing MCP-1 mAb (clone No. 24822.111, IgG1), IL-8 mAb (clone No. 6217.11, IgG1), or isotype control mAb were from R&D Systems. Recombinant human MCP-1 was from PeproTech. The 9-76 peptide analogue of MCP-126 was a kind gift from Dr I. Clark-Lewis (University of British Colombia, Vancouver). All other reagents were purchased from Sigma Chemical Co, unless otherwise stated.
Reverse Transcription-Polymerase Chain Reaction
Analysis of mRNA expression by reverse
transcription-polymerase chain reaction (RT-PCR) was performed as
described.25 Briefly, total RNA was isolated from
106 HUVEC by phenol/chloroform/isoamylalcohol
extraction, and cDNA was reverse transcribed from 1 µg RNA. Primers
were synthesized according to sequences with minimal homology to yield
products of 766 bp for CCR2 (sense GGATTGA ACAAGGACGCATT,
anti-sense TCTCACTGCCCTATGCCTCT). cDNA was amplified by 32 cycles set
to 95°C (30 seconds), 58°C annealing (60 seconds), and 72°C
extension (60 seconds). PCR products were analyzed by gel
electrophoresis and by restriction enzyme digestion with ApaI and DraI.
The CCR2B cDNA26 kindly provided by Dr I. Charo
(University of California, San Francisco) was used as a control.
RNase Protection Assay
Total RNA was isolated from HUVEC left unstimulated or treated
with IL-1ß (5 ng/mL) for 24 hours as described.25 Twenty
µg of RNA was analyzed according to the manufacturer's
instructions (PharMingen 1996 RiboQuant Multi-Probe RNase Protection
Assay System). The probe standard template hCR-5 allowed determination
of mRNA levels encoding the receptors: CCR1, CCR2, CCR3, CCR4, CCR5,
and CCR8, as well as control mRNA for glycerol aldehyde phosphate
dehydrogenase (GAPDH). The protected mRNA bands were quantitated using
a Molecular Dynamics phosphoimager. Data are expressed as relative
expression of CCR2 mRNA normalized to GAPDH mRNA levels.
Western Blot
HUVEC or Mono Mac 6 cells (106) were lysed
in sample buffer and whole cell lysates separated by 15% sodium
dodecyl sulfate–polyacrylamide gel electrophoresis.
Proteins were transferred to nitrocellulose membrane. Membranes were
blocked overnight at 4°C, incubated with a CCR2 mAb (clone No.
48607.121) and reacted with a peroxidase-labeled sheep anti-mouse Ig
mAb. Blots were developed with chemiluminescence (ECL, Amersham) and
exposed to X-Omat AR film (Amersham).
Flow Cytometry
Flow cytometry was performed as described.25 27
Briefly, confluent HUVEC were detached and reacted with isotype control
or CCR2 mAb 5A11 (10 µg/mL) in Hanks' buffered salt solution with
10 mmol/L Hepes, 1 mmol/L Mg2+, 1
mmol/L Ca2+, and 0.5% human serum
albumin for 30 minutes on ice. Cells were stained with
fluorescein isothiocyanate goat anti-mouse IgG mAb for 30
minutes on ice and analyzed in a FACScan (Becton Dickinson)
with appropriate light scatter gates. After correction for unspecific
binding, the specific mean fluorescence intensity was expressed
in channels.
Endothelial Transmigration Assay
HUVEC transmigration assays were performed as
described.28 Briefly, transwell inserts (Costar,
5 µm pores) were coated with 0.2% gelatin for 30 minutes at
37°C. MCP-1 in assay medium (RPMI-1640/M199, 0.5% human serum
albumin) was added at indicated concentrations to 24-well
plates. HUVEC (100 µL at 106 cells/mL) were
added to the top chamber and allowed to transmigrate for 4 hours at
37°C. Some experiments were also performed with MCP-1 (100 nmol/L)
present in the top and in the bottom chamber. Cells remaining in
the upper chamber were removed with a cotton swab. Migrated cells that
had adhered to the bottom surface of the filter were fixed and stained
with 0.1% crystal violet in 0.1 mol/L borate, pH 9.0, and 2% ethanol.
Stained cells were extracted with 10% acetic acid and absorbance
(optical density) at 600 nmol/L was determined as a measure of
transmigration. For inhibition assays, the 9-76 MCP-1 peptide analogue
(125 nmol/L) was added to the top and bottom chamber. Data were
expressed as mean±SD of 3 experiments.
Multiple Injury and Quantification of Chemokine Secretion
For multiple wound injury, HUVEC were grown to confluence in
100 mm petri dishes and injured by dragging a 1 mm-toothed
comb across monolayers in a circular motion, removing 50% of HUVEC and
resulting in concentric injuries to most of the remaining cells. Cells
were washed and fed fresh medium, and after 6 hours supernatants were
collected and sterile filtered. The concentration of MCP-1, IL-8, and
RANTES in the supernatants were quantitated by sandwich ELISA (all R&D
Systems) according to the manufacturer's protocols with the protein
standards provided and were adjusted for the number of cells
remaining.
Endothelial Wound Injury Repair and
Proliferation Assays
Single-path wound repair experiments were performed as
described.29 Briefly, HUVEC monolayers were grown to
confluence in 6-well dishes, and wounds were inflicted by dragging a
sterile pipette tip across the monolayers to create a 1-mm cell-free
path. The 9-76 MCP-1 peptide analogue (1.25 or 125 nmol/L), MCP-1 (50
nmol/L), blocking MCP-1 mAb (clone No. 24822.111), or IL-8 mAb (clone
No. 6217.11, 10 µg/mL each) were added after injury, and cells were
incubated for at least 24 hours. The wound areas were examined and
photographed 6, 12, or 24 hours after injury by phase contrast
microscopy with a 10x objective. The number of cells that had migrated
into 1 mm2 of wound area after 12 hours was
quantitated by counting within defined areas using light microscopy
with a 10x objective and 10x ocular equipped with a 1 mmx1
mm grid. Treatment with the 9-76 peptide (100 nmol/L) for 24 hours did
not affect HUVEC viability, as assessed by trypan blue exclusion
(93±2% viable cells versus 94±4% in controls).
For HUVEC proliferation assay, cells were seeded at a density of 104/cm2. For 3H thymidine incorporation assays, cells were seeded in 96-well plates and were treated for 24 hours with or without indicated concentrations of MCP-1 or the 9-76 MCP-1 peptide analogue. Proliferation of cells grown in 24-well plates was quantitated over 72 hours by counting the number of cells in marked areas by light microscopy using a 10x objective and 10x ocular equipped with a 1 mmx1 mm grid and expressed as cells/mm2.
Immunohistochemistry
Adult kidneys were received after surgical removal due to reflux
nephropathy or renal cell carcinoma. Tumor-free parts were
excised, frozen in isopentane, cooled in liquid nitrogen, and stored at
-70°C. Immunohistochemistry was performed on 5-µm frozen tissue
sections fixed in acetone at -18°C for 10 minutes. Sections were
incubated with 5% goat serum in a Tris buffer (pH 7.6) containing
0.4% Triton-X100, then with a CCR2 mAb (clone No. 48607.121, 1:2
dilution) for 2 hours at 22°C, and finally with a rabbit anti-mouse
IgG antibody (Dako, 1:40 dilution) for 1 hour at 22°C. Alkaline
phosphatase-complexed mouse antialkaline phosphatase mAb (APAAP, Dako)
diluted at 1:40 was then incubated at 22°C for 1 hour. All dilutions
were in phosphate-buffered saline (pH 7.6). For staining, slides were
exposed to a solution of sodium nitrite (28 mmol/L), new fuchsin
(basic fuchsin, 21 mmol/L), naphtol AS-BI phosphate (0.5
mmol/L), dimethylformamide (64 mmol/L), and levamisole (5
mmol/L) in a Tris/HCl buffer (50 mmol/L, pH 8.4) containing
146 mmol/L NaCl for 15 minutes. Control experiments included
immunohistology 1) with nonimmune mouse IgG, 2) without primary mAb,
and 3) without secondary mAb. Sections were evaluated with a Zeiss
Axioplan microscope, and micrographs were recorded with a
Hasselblad camera.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Expression of CCR2 mRNA in Endothelial Cells
To investigate the expression of the MCP-1 receptor CCR2 on endothelium, we performed RT-PCR to amplify RNA isolated from HUVEC using specific primers for CCR2. The PCR products were analyzed by agarose gel electrophoresis (Figure 1
). Using the CCR2 plasmid cDNA
as a positive control template, a band migrating at an expected
molecular weight of 766 kb was observed (Figure 1, lane 2),
whereas analysis of the PCR products generated from HUVEC
cDNA revealed a band migrating at an apparently identical molecular
weight (Figure 1, lane 1). To confirm that this band corresponds
to CCR2 mRNA, PCR products were analyzed by digestion with
the restriction enzymes Apa1 and Dra1. Digestion of PCR products
from control CCR2 plasmid cDNA and from HUVEC cDNA with Apa1 resulted
in 2 fragments with expected molecular weights of 188 and 608 kb,
whereas Dra 1 digestion yielded fragments of 285 and 481 kb (Figure 1, lanes 4 to 7).
|
To confirm these results, RNase protection assays were used to study
whether mRNA for CCR2 or other CC chemokine receptors were transcribed
in HUVEC. Analysis of total RNA isolated from untreated HUVEC
in comparison with the probe standard template hCR-5 revealed a band
corresponding to the CCR2 A and B subtypes (Figure 2A). A more intense band of identical
size was found when analyzing the RNA from monocytic Mono Mac 6 cells
(not shown). HUVEC isolates also expressed a weakly detectable band
corresponding to CCR1 but not mRNA transcripts encoding CCR3, CCR4,
CCR5, and CCR8 (not shown). Treatment of HUVEC with IL-1ß (5 ng/mL)
for 24 hours markedly increased the intensity of the band corresponding
to CCR2 mRNA (Figure 2A). Quantification confirmed upregulation
of CCR2 mRNA by IL-1ß relative to GAPDH mRNA expression (Figure 2B). Differences in the amount of RNA loaded may account for the
relatively less dramatic induction of CCR2 mRNA expression after
normalization in Figure 2B. Because CCR2 mRNA in monocytes is
downregulated by inflammatory cytokines,18 19 this
excludes potential contaminations with monocyte mRNA. Hence this
demonstrates that human endothelial cells express
inducible mRNA for the MCP-1 receptor CCR2.
|
Surface Expression of CCR2 Protein as a Functional Receptor on
HUVEC
We next studied whether CCR2 protein was present in
endothelial cells. Immunoblotting of
HUVEC lysates revealed a band migrating at 38kDa consistent
with the expression of CCR2 protein in endothelial
cells, whereas Mono Mac 6 cell lysates were used as a positive and
chinese hamster ovary cell lysates as a negative control (Figure 3A). The findings are consistent
with similar bands observed for immunoblotting of CCR2
in B cells or Mono Mac 6 cells.30 31 To test whether CCR2
is detectable on the endothelial surface, we performed
flow cytometric analysis. HUVEC showed a distinct surface
expression of CCR2 (Figure 3B), which was lower than that found
on freshly isolated blood monocytes (not shown).32
Consistent with mRNA analysis, CCR2 protein and surface
expression was upregulated by activation of HUVEC with inflammatory
cytokines, eg, IL-1ß (5 ng/mL) or TNF-
(50 U/mL) for 24
hours, as indicated by immunoblotting (Figure 3A) or flow cytometry (Table 1).
These data show that CCR2 protein is expressed and regulated on the
endothelial surface.
|
) or without (
) 9-76 MCP-1 peptide analogue were
added to the top chamber and allowed to transmigrate for 4 hours at
37°C. Cells that migrated to the bottom side of filters were stained
with 0.1% crystal violet, extracted with 10% acetic acid, and
absorbance was read at 600 nm. Data represent mean±SD of 3
independent experiments.
|
To study whether CCR2 surface expression was associated with functional
responses of endothelial cells to MCP-1, we
analyzed transmigration of HUVEC in a gelatin-coated
transwell filter assays. CCR2 mediates MCP-1-induced signaling and
transmigration in leukocytes, eg, in mononuclear cells, which
characteristically occurs in a bell-shaped dose-response curve and for
monocytes, is optimal at 1 nmol/L of MCP-1.33 34 35 36 Addition
of MCP-1 to the bottom chamber only (ie, presence of a MCP-1 gradient)
elicited HUVEC transmigration with a maximum index (ratio of stimulated
migration/spontaneous migration) of 2.84±0.68 (mean±SD, n=3) at 100
nmol/L; however, a bell-shaped dose-response curve was difficult to
demonstrate (Figure 3C
). Transmigration induced by MCP-1 was
blocked by the 9-76 MCP-1 analogue receptor
antagonist,26 inferring a dependence on CCR2
(Figure 3C). The presence of MCP-1 (100 nmol/L) in both top and
bottom chamber (ie, absence of a MCP-1 gradient) induced transmigration
of HUVEC with an index (1.97±0.46, mean±SD) that was lower than that
in the presence of a gradient (ie, MCP-1 in the bottom chamber only).
This indicates that migration induced by MCP-1 was both chemotactic
(directed) and chemokinetic (nondirected). Thus
endothelial CCR2 is a functional receptor for
MCP-1.
MCP-1 Facilitates Endothelial Cell Migration in
Wound Injury Repair Without Affecting Proliferation
Because endothelial migration is crucial for
angiogenesis and wound injury repair and MCP-1 has been found at the
wound edge in areas of endothelial
denudation,37 it was intriguing to speculate whether MCP-1
was involved in this process by inducing endothelial
migration via CCR2. To determine whether endothelial
monolayers produce more MCP-1 or other chemokines in response to
injury, soluble MCP-1 protein in HUVEC supernatants was quantitated by
ELISA. A comb constructed to create multiple 1 mm-wide,
concentrical wounds was dragged across confluent HUVEC monolayers so
that most of the remaining cells were affected by the injuries. After 6
hours in culture, endothelial secretion of MCP-1 and
IL-8 was increased after multiple injuries to the HUVEC monolayers
(Table 2), whereas that of RANTES was
hardly detectable and not altered by wound injury (data not shown).
Induction of IL-8 secretion was less marked, possibly due to
immobilization. Thus endothelial cells respond to
mechanical injury by secreting MCP-1 and IL-8.
|
To study whether MCP-1 may contribute to endothelial
wound injury repair via CCR2 expressed on endothelial
cells, we created a single path wound by dragging a sterile pipette tip
across HUVEC monolayers (Figure 4A).
After 6 or 12 hours in culture, cells at the wound edge were found to
form cytoplasmic extensions protruding into the wound
area,29 a process resulting in the spreading and migration
of cells to close the injury (Figure 4B). After 24 hours, wound
closure was complete in almost all cases (not shown). The presence of
the 9-76 peptide (125 nmol/L) after the wound injury markedly inhibited
the ability of HUVEC to migrate into wound areas and clearly delayed
the wound closure at 12 hours in comparison with untreated cells
(Figure 4C). Nevertheless, at 12 hours, some protrusions at the
edge were apparent, and the wounds eventually closed at 36 hours or
later. In contrast, the addition of MCP-1 (50 nmol/L) at the time of
wound injury induced a more disorganized appearance of cells that had
migrated to close the wound and resulted in a more efficient closure
that was almost complete at 12 hours (Figure 4D). This was
confirmed by quantitating the number of HUVEC that had migrated into
the wound area 12 hours after the injury (Figure 5A). In untreated monolayers, 171±32
cells/mm2 had migrated into the wound area. The
presence of the 9-76 MCP-1 receptor antagonist
dose-dependently and substantially reduced, whereas addition of MCP-1
markedly increased the number of cells present in the wound area
(Figure 5A). Notably, the number of cells in the wound area was
also reduced by a neutralizing MCP-1 but not IL-8 mAb (Figure 5A).
Isotype control mAb had no effect (not shown). Our data
indicate that MCP-1 and endothelial receptors, such as
CCR2, are involved in directing endothelial migration
required to accomplish efficient endothelial wound
injury repair.
|
|
Endothelial wound injury repair within the first 24
hours is mediated by migration, whereas cell proliferation occurs after
36 hours.4 5 Hence we investigated whether MCP-1 affects
HUVEC proliferation. HUVEC were seeded at 104
cells/cm2 and the number of cells was determined
over 72 hours in the presence of various concentrations of MCP-1 and/or
the 9-76 peptide analogue. Although the proliferation rate increased
after 48 hours, it was unaltered by MCP-1 or 9-76 peptide analogue
(Figure 5B). These findings were confirmed by
3H thymidine incorporation assays under the above
conditions (data not shown).
Expression of CCR2 in Activated Endothelium
In Vivo
Immunohistochemistry of heavily inflamed renal peripelvic tissue
with CCR2 mAb revealed a distinct cytoplasmic staining of
activated endothelial cells in irritated
venules (Figure 6A), whereas negative
control samples showed no specific red staining (Figure 6B). In
addition, positive staining for CCR2 was found on arterial
and vein endothelial cells (Figure 6C and data
not shown). A robust CCR2 staining on endothelial cells
appeared to be associated with subendothelial
infiltrates of mononuclear cells in their vicinity (Figure 6A).
Particularly intense CCR2 staining was detected on luminal mononuclear
cells (Figure 6A), whereas less marked staining was detectable
in the cytoplasmic periphery of extravasated mononuclear cells and in
directly subintimal cells (Figures 6A and 6C). Moreover, some
sections showed docking of strongly stained mononuclear cells to
CCR2-positive endothelial cells in the initial stages
of attachment and extravasation (Figure 6A). No staining for
CCR2 could be detected on endothelial cells of arteries
or venules in kidneys without signs of inflammation, whereas positively
stained mononuclear cells served as an internal positive control
(Figure 6D and data not shown). Thus our data clearly indicate
that CCR2 is expressed on activated endothelium
in tissue affected by chronic inflammatory reactions with mononuclear
cell infiltrates, suggesting important implications for inflammatory
conditions in vivo.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
We found that endothelial cells express mRNA and surface protein for the MCP-1 receptor CCR2. This was associated with a migratory response to MCP-1 that may play a role in directing cell migration during endothelial wound injury. To our knowledge, this is also the first demonstration of CCR2 expression on inflamed endothelium in vivo. Although effects of CC chemokines and their receptors on endothelial cells have not yet been elucidated, various CXC chemokines have been shown to modulate endothelial cell proliferation.7 8 9 10 11 12 For example, PF-4 and IP-10 can suppress angiogenesis, possibly by competing with known growth factors, such as bFGF and TGF-ß, for heparan sulfate proteoglycan binding sites and inhibiting the proliferative effects of these growth factors. Endothelial cells express CXCR1 and CXCR4, which can mediate effects of the CXC chemokines IL-8 and stromal cell–derived factor-1 (SDF-1), respectively.13 38 39 40 The ability of IL-8 to induce angiogenesis in association with the presence of CXCR1 on endothelial cells was paralleled and expanded by our findings that MCP-1 and endothelial CCR2 participate in direct receptor-mediated functions.
Our results show that endothelial cells expressed low levels of CCR2 mRNA and to a lesser extent, CCR1 mRNA. Previously, the expression of CXCR1 but not CXCR2 mRNA has been described in HUVEC.13 In a recent report,38 generation of a cDNA plasmid library from HUVEC mRNA using consensus region PCR primers for chemokine receptors and sequencing of random clones revealed the presence of mRNA for CXCR4 and CCR3 as well as for CXCR1, CCR1, and CCR2. Northern blot analysis confirmed the abundance of CXCR4 mRNA; however, it failed to detect mRNA for CCR1 or CCR2. A more recent study did not reveal CCR2 mRNA in HUVEC using only RT-PCR or MCP-1-induced chemotaxis of HUVEC.40 In contrast, our data clearly demonstrate the expression of CCR2 mRNA in endothelial cells. Immunoblotting, surface staining, and migration assays further confirmed the expression of functional CCR2 on HUVEC. Similarly, flow cytometric analysis and migration assays indicated expression of functional CXCR4, but endothelial responses to MCP-1 or IL-8 were not seen38 in contrast to this and other reports.11 12 Contrasting findings may be due to differences in the sensitivity of RT-PCR, as well as the migration assays used or due to the heterogeneity of chemokine receptor expression in distinct HUVEC preparations or under culture conditions with different media.41
The CCR2 mRNA and surface protein expression could be upregulated by
activation of HUVEC with inflammatory cytokines, such as
IL-1ß or TNF-. This is in accordance with findings that IL-1ß or
TNF- cause a biphasic regulation of endothelial
CXCR4 mRNA expression with an initial inhibition and subsequent
prolonged induction.38 In contrast, IL-1ß or TNF-
downregulated CCR2 expression and MCP-1-mediated transmigration in
monocytes, whereas IFN-
decreased CXCR4 mRNA stability in HUVEC but
did not affect CCR2 in monocytes.18 19 38 Moreover,
IL-1 did not alter CXCR1 expression in HUVEC, and TNF- did not
regulate CCR1 and CCR2 in smooth muscle cells.13 24 The
differential regulation of chemokine receptors by various
cytokines in distinct cellular systems may indicate a
cell-specific involvement in various
pathophysiological conditions. Our results suggest
that regulation of endothelial CCR2 by inflammatory
cytokines, which induce endothelial secretion
of MCP-1, may promote endothelial migration under
conditions such as inflammatory reactions or wound injury repair after
angioplasty.
We found that MCP-1 induced a maximum index of HUVEC migration at 100
nmol/L, whereas leukocyte chemotaxis to MCP-1 is optimal at 1
nmol/L.35 36 Inhibition with the 9-76 MCP-1 receptor
antagonist26 confirmed that MCP-1–induced
migration of endothelial cells was dependent on CCR2,
as seen in monocytes.18 26 Endothelial
cell migration and Ca2+ mobilization in response
to the CXC chemokines IL-8 and SDF-1 also occurred more effectively at
higher concentrations than those required for leukocyte
responses.11 38 In addition, Ca2+
mobilization in smooth muscle cells was only induced by MCP-1 or
MIP-1 at concentrations of 500 nmol/L,24 inferring cell
type-specific differences in chemokine responsiveness. Flow cytometry
revealed that surface expression of CCR2 on HUVEC was lower than on
monocytes.32 Moreover, specific binding sites for IL-8 on
HUVEC have been suggested to be of lower affinity and density than on
neutrophils.13 Thus migratory responses may vary with
differences in chemokine receptor characteristics. A bell-shaped
dose-response curve was difficult to demonstrate for HUVEC migration to
SDF-1.38 Moreover, transmigration of HUVEC was induced by
a MCP-1 gradient and, to a lesser extent, in the presence of
nongradient MCP-1, showing that it was both chemotactic (directed) and
chemokinetic (nondirected), as has been shown with
transferrin.42 This suggests that MCP-1 increases overall
movement of HUVEC.
We have used a previously described HUVEC wound injury
model,29 which reproducibly exhibited migration of a
comparable number of endothelial cells into the wound
area and closure of the wound path within 24 hours to 36 hours, thus
representing a suitable model to study wound healing and
repair of vascular endothelium in vitro. The presence
of 9-76 MCP-1 receptor antagonist or neutralizing MCP-1 mAb
impaired the ability of HUVEC to migrate and close the wound, whereas
addition of MCP-1 appeared to facilitate the repair, suggesting a role
for MCP-1–induced migration in endothelial wound
repair. Moreover, endothelial MCP-1 secretion was
increased by multiple wound injury. This clearly extends findings that
MCP-1 mRNA expression was increased by endothelial
denudation after balloon angioplasty, particularly evident at the
migrating cell front, and that higher levels of MCP-1 mRNA were found
in migrating subconfluent than quiescent confluent
endothelial cells, which was attributed to effects of
endothelial bFGF.37 Secretion of
chemokines and their immobilization to matrix proteins being
established by the endothelial cell front may create a
naturally occurring gradient to direct migration. Notably, exogenous
MCP-1 resulted in a more efficient wound injury repair despite a more
haphazard appearance of the monolayer. This may be due to a
immobilization of MCP-1 to continuously generated matrix components at
high concentrations (P.J.N. et al, unpublished data, 1999).
Endothelial cells have been shown to respond by
migrating and spreading within 24 hours after wound injury, whereas
proliferation becomes prominent only after 36 hours.4
Unlike the CXC chemokines IL-8 and PF-4, we observed that MCP-1 or its
receptor antagonist did not affect HUVEC proliferation.
Moreover, inhibition by the MCP-1 receptor antagonist was
obvious within the first 12 hours. This suggests that MCP-1
predominantly acts by inducing migration during
endothelial wound injury. Our results expand findings
that MCP-1 and MIP-1 are critical in wound repair by mediating
macrophage recruitment43 44 and that MCP-1 may
facilitate angiogenesis,23 implying that these processes
are in part due to endothelial mechanisms.
Notably, immunohistochemistry revealed CCR2 expression on activated endothelium of venules, veins, and arteries in chronically inflamed tissue, demonstrating for the first time endothelial expression of a CC chemokine receptor in vivo. The most prominent CCR2 staining on endothelial cells appeared to occur in the proximity of mononuclear infiltration. This may suggest an upregulation of endothelial CCR2 in association with secretion of inflammatory cytokines by mononuclear cells, whereas CCR2 staining on subendothelial mononuclear cells appeared to be less prominent than in cells before extravasation, consistent with the differential regulation of CCR2 by cytokines in distinct cell types. A chronic inflammatory irritation may result in a disturbed endothelial integrity, which may require endothelial CCR2 expression to maintain vascular hemostasis under conditions of inflammatory activation. Conversely, excessive endothelial CCR2 levels may contribute to vascular damage. Vascular injury, eg, by angioplasty, can also trigger inflammatory reactions leading to dysregulated wound repair and ultimately restenosis. Our data may thus have important implications for many inflammatory reactions in vivo.
Our findings exemplify the diverse functions of chemokines that appear to play an increasingly evident role in vascular pathology. The identification of CCR2 in endothelial cells shown here and in vascular smooth muscle cells24 indicates that MCP-1 may not only mediate monocyte infiltration but may participate in endothelial or smooth muscle cell migration and proliferation during processes, such as atherosclerosis, restenosis, and chronic stages of inflammatory diseases. Intimal hyperplasia of vein grafts, which involves an exaggerated vascular wound healing response, has been associated with increased MCP-1 levels that may stimulate monocyte infiltration as well as promote endothelial migration.45 The advent of chemokine peptide antagonists, eg, the 9-76 MCP-1 analogue, which has already been tested in a murine arthritis model,46 47 may offer encouraging novel approaches in the treatment of inflammatory conditions, restenosis, or angiogenic tumors.
|
Acknowledgments |
|---|
This work was supported by Deutsche Forschungsgemeinschaft grants We-1913/2 (C.W.), Gr-728/5 (H.-J.G.), SFB 464/469 (P.J.N.), and by the August-Lenz Stiftung (K.S.C.W.).
Received August 14, 1998; accepted February 24, 1999.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Folkman J, Klagsburn M. Angiogenic factors. Science. 1987;235:442–447.
2. Risau W. Mechanisms of angiogenesis. Nature. 1997;386:671–674.[Medline] [Order article via Infotrieve]
3. Ross R. The pathogenesis of atherosclerosis: A perspective for the 1990s. Nature. 1993;362:801–809.[Medline] [Order article via Infotrieve]
4. Sholley MM, Gimbrone MA, Cotran RS. Cellular migration and replication in endothelial regeneration: A study using irradiated endothelial cultures. Lab Invest. 1977;36:18–25.[Medline] [Order article via Infotrieve]
5.
Coomber BL, Gotlieb AI. In vitro
endothelial wound repair: interaction of cell migration
and proliferation. Arteriosclerosis. 1990;10:215–222.
6. Lindner V, Majacek RA, Reidy MR. Basic fibroblast growth factor stimulates endothelial regrowth and proliferation in denuded arteries. J Clin Invest. 1990;85:2004–2008.
7.
Maione TE, Gray GS, Petro J, Hunt AJ, Donner AL, Bauer
SI, Carson HF, Sharpe RJ. Inhibition of angiogenesis by
recombinant human platelet factor-4 and related peptides.
Science. 1990;247:77–79.
8.
Gupta SK, Hassel T, Singh JP. A potent
inhibitor of endothelial cell proliferation
is generated by proteolytic cleavage of the chemokine platelet
factor 4. Proc Natl Acad Sci U S A. 1995;92:7799–7803.
9.
Cao Y, Chen C, Weatherbee JA, Tsang M, Folkman J.
Gro-ß, a C-X-C chemokine, is an angiogenesis
inhibitor that suppresses the growth of Lewis lung
carcinoma in mice. J Exp Med. 1995;182:2069–2077.
10.
Luster AD, Greenberg SM, Leder P. The IP-10 chemokine
binds to a specific cell surface heparan sulfate site shared with
platelet factor 4 and inhibits endothelial cell
proliferation. J Exp Med. 1995;182:219–231.
11.
Strieter RM, Polverini PJ, Kunkel SL, Arenberg DA,
Burdick MD, Kasper J, Dzuiba J, Van Damme J, Walz A, Marriot D, Chan
S-Y, Rocznial S, Shanafelt AB. The functional role of the ELR motif in
CXC chemokine-mediated angiogenesis. J Biol Chem. 1995;270:27348–27357.
12.
Koch AE, Polverini PJ, Kunkel SL, Harlow SL, DiPietro
LA, Elner VM, Elner SG, Strieter RM. Interleukin-8 as a
macrophage-derived mediator of angiogenesis.
Science. 1992;258:1798–1801.
13. Schönbeck U, Brandt E, Peterson F, Flad H-D, Loppnow H. IL-8 specifically binds to endothelial but not to smooth muscle cells. J Immunol. 1995;154:2375–2383.[Abstract]
14. Baggiolini M, Dewald B, Moser B. Interleukin-8 and related chemotactic cytokines: CXC and CC chemokines. Adv Immunol. 1994;55:97–179.[Medline] [Order article via Infotrieve]
15. Gerard C. Gerard NP. The pro-inflammatory seven-transmembrane segment receptors of the leukocyte. Curr Opin Immunol. 1994;6:140–145.[Medline] [Order article via Infotrieve]
16.
Rollins BJ. Chemokines. Blood. 1997;90:909.
17.
Luster AD. Chemokines: Chemotactic cytokines
that mediate inflammation. N Engl J Med. 1998;338:436–445.
18.
Sica A, Saccani A, Borsatti A, Power CA, Wells
TNC, Luini W, Polentarutti N, Sozzani S, Mantovani A. Bacterial
lipopolysaccharide rapidly inhibits expression of C-C chemokine
receptors in human monocytes. J Exp Med. 1997;185:969–974.
19.
Tangirala RK, Murao K, Quehenberger O. Regulation of
expression of the human monocyte chemotactic protein-1 receptor (hCCR2)
by cytokines. J Biol Chem. 1997;272:8050–8056.
20.
Tiffany HL, Alkhatib G, Combadiere C, Berger EA, Murphy
PM. CC chemokine receptors 1 and 3 are differentially regulated by IL-5
during maturation of eosinophilic HL-60 cells. J
Immunol. 1998;160:1385–1392.
21. Nelken NA, Coughlin SR, Gordon D, Wilcox JN. Monocyte chemoattractant protein-1 in human atheromatous plaques. J Clin Invest. 1991;88:1121–1127.
22.
Ylä-Herttuala S, Lipton BA, Sarkioja ME,
Yoshimura T, Leonard EJ, Witztum JL, Steinberg D. Expression of
monocyte chemotactic protein-1 in macrophage-rich areas of
human and rabbit atherosclerotic lesions. Proc Natl Acad Sci
U S A. 1991;88:5252–5256.
23.
Ito WD, Arras M, Winkler B, Scholz D, Schaper J,
Schaper W. Monocyte chemotactic protein-1 increases collateral and
peripheral conductance after femoral artery occlusion.
Circ Res. 1997;80:829–837.
24.
Hayes IM, Jorda NJ, Towers S, Smith G, Paterson JR,
Earnshaw JJ, Roach AG, Westwick J, Williams RJ. Human vascular smooth
muscle cells express receptors for CC chemokines. Arterioscler
Thromb Vasc Biol. 1998;18:397–403.
25.
Weber C, Erl W, Pietsch A, Ströbel M,
Ziegler-Heitbrock HWL, Weber PC. Antioxidants inhibit monocyte adhesion
by suppressing nuclear factor-
B mobilization and induction of
vascular cell adhesion molecule-1 in endothelial cells
stimulated to generate radicals. Arterioscler Thromb. 1994;14:1665–1673.
26.
Hong JH, Clark-Lewis I. Antagonists of
monocyte chemoattractant protein 1 identified by modification of
functionally critical NH2-terminal residues.
J Exp Med. 1995;181:631–640.
27.
Weber C, Erl W, Pietsch A, Weber PC. Aspirin inhibits
nuclear factor-B mobilization and monocyte adhesion in
stimulated human endothelial cells.
Circulation. 1995;91:1914–1917.
28.
Kähler CM, Kirchmaier R, Kaufmann G, Kähler
ST, Reinisch N, Fischer-Colbrie R, Hogue-Angeletti R, Winkler H,
Wiedermann CJ. Inhibition of proliferation and stimulation of
migration of endothelial cells by secretoneurin in
vitro. Arterioscler Thromb Vasc Biol. 1997;17:932–939.
29.
Aepfelbacher M, Essler M, Huber E, Sugai M, Weber PC.
Bacterial toxins block endothelial wound repair.
Evidence that rho GTPases control cytoskeletal rearrangements in
migrating endothelial cells. Arterioscler Thromb
Vasc Biol. 1997;17:1623–1629.
30. Frade JMR, Mellado M, del Real G, Gutierrez-Ramos JC, Lind P, Martinez-A C. Characterization of the CCR2 chemokine receptor: functional CCR2 receptor expression in B cells. J Immunol. 1997;159:5576–5584.[Abstract]
31.
Mellado M, Rodriguez-Frade JM, Aragay A, del Real G,
Martin AM, Vila-Coro AJ, Serrano A, Mayor F, Martinez-A. C. The
chemokine monocyte chemotactic protein 1 triggers janus kinase 2
activation and tyrosine phosphorylation of CCR2B
receptor. J Immunol. 1998;161:805–813.
32. Qin S, LaRosa G, Campbell JJ, Smith-Heath H, Kassam N, Shi X, Zheng L, Butcher EC, Mackay CR. Expression of monocyte chemoattractant protein-1 and interleukin-8 receptors on subsets of T cells: Correlation with transendothelial chemotactic potential. Eur J Immunol. 1996;26:640–647.[Medline] [Order article via Infotrieve]
33.
Charo IF, Meyers SJ, Herman A, Franci C, Connolly AJ,
Coughlin SR. Molecular cloning and functional expression of two
monocyte chemoattractant protein 1 receptors reveals alternative
splicing of the carboxy-terminal tails. Proc Natl Acad Sci
U S A. 1994;91:2752–2756.
34.
Weber C, Lu CF, Casasnovas J, Springer TA. Role of
Lß2 integrin avidity in transendothelial
chemotaxis of mononuclear cells. J Immunol. 1997;159:3968–3975.[Abstract]
35. Yoshimura T, Leonard EJ. Identification of high affinity receptors for human monocyte chemoattractant protein-1 on human monocytes. J Immunol. 1990;145:292–297.[Abstract]
36. Sozzani S, Luni W, Molino M, Jilek P, Bottazzi B, Cerletti C, Matsushima K, Mantovani A. The signal transduction pathway involved in the migration induced by a monocyte chemotactic cytokine. J Immunol. 1991;14:2215–2221.
37. Wempe F, Lindner V, Augustin HG. Basic fibroblast growth factor (bFGF) regulates the expression of the CC chemokine monocyte chemoattractant protein-1 (MCP-1) in autocrine-activated endothelial cells. Arterioscler Vasc Biol Thromb. 1997;17:2471–2478.
38.
Gupta S, Lysko PG, Pillarisetti K, Ohlstein E, Stadel
JM. Chemokine receptors in human endothelial cells.
Functional expression of CXCR4 and its transcriptional regulation by
inflammatory cytokines. J Biol Chem. 1998;273:4282–4287.
39. Volin MV, Joseph L, Shockley MS, Davies PF. Chemokine receptor CXCR4 expression in endothelium. Biochem Biophys Res Commun. 1998;242:46–53.[Medline] [Order article via Infotrieve]
40. Feil C, Augustin HG. Endothelial cells differentially express functional CXC-chemokine receptor-4 (CXCR4/fusin) under the control of autocrine activity and exogenous cytokines. Biochem Biophys Res Commun. 1998;247:38–45.[Medline] [Order article via Infotrieve]
41.
Watson CA, Camera-Benson L, Palmer-Crocker R, Pober JS.
Variability among human umbilical vein endothelial
cultures. Science. 1995;268:447–448.
42.
Carlevaro MF, Albini A, Ribatti D, Gentili C, Benelli
R, Cermelli S, Cancedda R, Cancedda FD. Transferrin promotes
endothelial cell migration and invasion: Implication in
cartilage neovascularization. J Cell Biol. 1997;136:1375–1384.
43.
DiPietro LA, Burdick M, Low QE, Kunkel SL, Strieter RM.
MIP-1 as a critical macrophage chemoattractant in
murine wound repair. J Clin Invest. 1998;101:1693–1698.[Medline]
[Order article via Infotrieve]
44. DiPietro LA, Polverini PJ, Rahbe SM, Kovacs EJ. Modulation of JE/MCP-1 expression in dermal wound repair. Am J Pathol. 1995;146:868–875.[Abstract]
45.
Stark VK, Hoch JR, Warner TF, Hullet DA. Monocyte
chemotactic protein-1 expression is associated with the development of
vein graft intimal hyperplasia. Arterioscler Thromb Vasc
Biol. 1997;17:1614–1621.
46.
Baggiolini M, Moser BM. Blocking chemokine receptors.
J Exp Med. 1997;186:1189–1191.
47.
Gong JH, Ratkay LG, Waterfield JD, Clark-Lewis I. An
antagonist of monocyte chemoattractant protein 1 (MCP-1)
inhibits arthritis in the MRL-lpr mouse model. J Exp Med. 1997;186:131–137.
This article has been cited by other articles:
 |
|
 |
|
  C. A. Reichel, M. Rehberg, M. Lerchenberger, N. Berberich, P. Bihari, A. G. Khandoga, S. Zahler, and F. Krombach Ccl2 and Ccl3 Mediate Neutrophil Recruitment via Induction of Protein Synthesis and Generation of Lipid Mediators Arterioscler Thromb Vasc Biol, November 1, 2009; 29(11): 1787 - 1793. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Nickerson, J. Song, J. K. Meisner, S. Bajikar, C. W. Burke, C. W. Shuptrine, G. K. Owens, T. C. Skalak, and R. J. Price Bone Marrow-Derived Cell-Specific Chemokine (C-C Motif) Receptor-2 Expression is Required for Arteriolar Remodeling Arterioscler Thromb Vasc Biol, November 1, 2009; 29(11): 1794 - 1801. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Tarabra, S. Giunti, F. Barutta, G. Salvidio, D. Burt, G. Deferrari, R. Gambino, D. Vergola, S. Pinach, P. C. Perin, et al. Effect of the Monocyte Chemoattractant Protein-1/CC Chemokine Receptor 2 System on Nephrin Expression in Streptozotocin-Treated Mice and Human Cultured Podocytes Diabetes, September 1, 2009; 58(9): 2109 - 2118. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 X. Li, R. Loberg, J. Liao, C. Ying, L. A. Snyder, K. J. Pienta, and L. K. McCauley A Destructive Cascade Mediated by CCL2 Facilitates Prostate Cancer Growth in Bone Cancer Res., February 15, 2009; 69(4): 1685 - 1692. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. C. Keeley, B. Mehrad, and R. M. Strieter Chemokines as Mediators of Neovascularization Arterioscler Thromb Vasc Biol, November 1, 2008; 28(11): 1928 - 1936. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. J. Capoccia, A. D. Gregory, and D. C. Link Recruitment of the inflammatory subset of monocytes to sites of ischemia induces angiogenesis in a monocyte chemoattractant protein-1-dependent fashion J. Leukoc. Biol., September 1, 2008; 84(3): 760 - 768. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Barilli, R. Visigalli, R. Sala, G. C. Gazzola, A. Parolari, E. Tremoli, S. Bonomini, A. Simon, E. I. Closs, V. Dall'Asta, et al. In human endothelial cells rapamycin causes mTORC2 inhibition and impairs cell viability and function Cardiovasc Res, June 1, 2008; 78(3): 563 - 571. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Burt, G. Salvidio, E. Tarabra, F. Barutta, S. Pinach, P. Dentelli, G. Camussi, P. C. Perin, and G. Gruden The Monocyte Chemoattractant Protein-1/Cognate CC Chemokine Receptor 2 System Affects Cell Motility in Cultured Human Podocytes Am. J. Pathol., December 1, 2007; 171(6): 1789 - 1799. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.-J. You, C.-H. Yang, J.-S. Huang, M.-S. Chen, and C.-M. Yang Fractalkine, a CX3C Chemokine, as a Mediator of Ocular Angiogenesis Invest. Ophthalmol. Vis. Sci., November 1, 2007; 48(11): 5290 - 5298. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. Ochoa, D. Sun, S. M. Reyes-Reyna, L. L. Waite, J. E. Michalek, L. M. McManus, and P. K. Shireman Delayed angiogenesis and VEGF production in CCR2 / mice during impaired skeletal muscle regeneration Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2007; 293(2): R651 - R661. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Caselli, S. Fiorentini, C. Amici, D. Di Luca, A. Caruso, and M. G. Santoro Human herpesvirus 8 acute infection of endothelial cells induces monocyte chemoattractant protein 1-dependent capillary-like structure formation: role of the IKK/NF-{kappa}B pathway Blood, April 1, 2007; 109(7): 2718 - 2726. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-J. Lee, S. Namkoong, Y.-M. Kim, C.-K. Kim, H. Lee, K.-S. Ha, H.-T. Chung, Y.-G. Kwon, and Y.-M. Kim Fractalkine stimulates angiogenesis by activating the Raf-1/MEK/ERK- and PI3K/Akt/eNOS-dependent signal pathways Am J Physiol Heart Circ Physiol, December 1, 2006; 291(6): H2836 - H2846. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. M. Stamatovic, R. F. Keep, M. Mostarica-Stojkovic, and A. V. Andjelkovic CCL2 Regulates Angiogenesis via Activation of Ets-1 Transcription Factor J. Immunol., August 15, 2006; 177(4): 2651 - 2661. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Bidzhekov, A. Zernecke, and C. Weber MCP-1 Induces a Novel Transcription Factor With Proapoptotic Activity Circ. Res., May 12, 2006; 98(9): 1107 - 1109. [Full Text] [PDF]
|
|
|
|
|
|
N. Sakai, T. Wada, K. Furuichi, K. Shimizu, S. Kokubo, A. Hara, J. Yamahana, T. Okumura, K. Matsushima, H. Yokoyama, et al. MCP-1/CCR2-dependent loop for fibrogenesis in human peripheral CD14-positive monocytes J. Leukoc. Biol., March 1, 2006; 79(3): 555 - 563. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Ryschich, P. Lizdenis, C. Ittrich, A. Benner, S. Stahl, A. Hamann, J. Schmidt, P. Knolle, B. Arnold, G. J. Hammerling, et al. Molecular Fingerprinting and Autocrine Growth Regulation of Endothelial Cells in a Murine Model of Hepatocellular Carcinoma Cancer Res., January 1, 2006; 66(1): 198 - 211. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Spring, T. Schuler, B. Arnold, G. J. Hammerling, and R. Ganss Chemokines direct endothelial progenitors into tumor neovessels PNAS, December 13, 2005; 102(50): 18111 - 18116. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Goser, R. Ottl;, A. Brodner, T. J. Dengler, J. Torzewski, K. Egashira, N. R. Rose, H. A. Katus, and Z. Kaya Critical Role for Monocyte Chemoattractant Protein-1 and Macrophage Inflammatory Protein-1{alpha} in Induction of Experimental Autoimmune Myocarditis and Effective Anti-Monocyte Chemoattractant Protein-1 Gene Therapy Circulation, November 29, 2005; 112(22): 3400 - 3407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Sakamoto, T. Ishibashi, N. Sakamoto, K. Sugimoto, K. Egashira, H. Ohkawara, K. Nagata, K. Yokoyama, M. Kamioka, T. Ichiki, et al. Endogenous NO Blockade Enhances Tissue Factor Expression via Increased Ca2+ Influx Through MCP-1 in Endothelial Cells by Monocyte Adhesion Arterioscler Thromb Vasc Biol, September 1, 2005; 25(9): 2005 - 2011. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. H. Hong, J. Ryu, and K. H. Han Monocyte chemoattractant protein-1-induced angiogenesis is mediated by vascular endothelial growth factor-A Blood, February 15, 2005; 105(4): 1405 - 1407. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Liehn, A. Schober, and C. Weber Blockade of Keratinocyte-Derived Chemokine Inhibits Endothelial Recovery and Enhances Plaque Formation After Arterial Injury in ApoE-Deficient Mice Arterioscler Thromb Vasc Biol, October 1, 2004; 24(10): 1891 - 1896. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. M. Gordillo, D. Onat, M. Stockinger, S. Roy, M. Atalay, F. M. Beck, and C. K. Sen A key angiogenic role of monocyte chemoattractant protein-1 in hemangioendothelioma proliferation Am J Physiol Cell Physiol, October 1, 2004; 287(4): C866 - C873. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Niiyama, H. Kai, T. Yamamoto, T. Shimada, K.-I. Sasaki, T. Murohara, K. Egashira, and T. Imaizumi Roles of endogenous monocyte chemoattractant protein-1 in ischemia-induced neovascularization J. Am. Coll. Cardiol., August 4, 2004; 44(3): 661 - 666. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z.-M. Bian, S. G. Elner, A. Yoshida, and V. M. Elner Differential Involvement of Phosphoinositide 3-Kinase/Akt in Human RPE MCP-1 and IL-8 Expression Invest. Ophthalmol. Vis. Sci., June 1, 2004; 45(6): 1887 - 1896. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Schecter, A. B. Berman, L. Yi, H. Ma, C. M. Daly, K. Soejima, B. J. Rollins, I. F. Charo, and M. B. Taubman MCP-1-dependent signaling in CCR2-/- aortic smooth muscle cells J. Leukoc. Biol., June 1, 2004; 75(6): 1079 - 1085. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Babiak, A.-M. Schumm, C. Wangler, M. Loukas, J. Wu, S. Dombrowski, C. Matuschek, J. Kotzerke, C. Dehio, and J. Waltenberger Coordinated activation of VEGFR-1 and VEGFR-2 is a potent arteriogenic stimulus leading to enhancement of regional perfusion Cardiovasc Res, March 1, 2004; 61(4): 789 - 795. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Speyer, T. A. Neff, R. L. Warner, R.-F. Guo, J. V. Sarma, N. C. Riedemann, M. E. Murphy, H. S. Murphy, and P. A. Ward Regulatory Effects of iNOS on Acute Lung Inflammatory Responses in Mice Am. J. Pathol., December 1, 2003; 163(6): 2319 - 2328. [Abstract] [Full Text]
|
|
|
|
 |
|
 S. M. Stamatovic, R. F. Keep, S. L. Kunkel, and A. V. Andjelkovic Potential role of MCP-1 in endothelial cell tight junction `opening': signaling via Rho and Rho kinase J. Cell Sci., November 15, 2003; 116(22): 4615 - 4628. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Middleton, A. M. Patterson, L. Gardner, C. Schmutz, and B. A. Ashton Leukocyte extravasation: chemokine transport and presentation by the endothelium Blood, December 1, 2002; 100(12): 3853 - 3860. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Wolf, T. Jocks, G. Zahner, U. Panzer, and R. A. K. Stahl Existence of a regulatory loop between MCP-1 and TGF-beta in glomerular immune injury Am J Physiol Renal Physiol, November 1, 2002; 283(5): F1075 - F1084. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Werle, U. Schmal, K. Hanna, and J. Kreuzer MCP-1 induces activation of MAP-kinases ERK, JNK and p38 MAPK in human endothelial cells Cardiovasc Res, November 1, 2002; 56(2): 284 - 292. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Viedt, J. Vogel, T. Athanasiou, W. Shen, S. R. Orth, W. Kubler, and J. Kreuzer Monocyte Chemoattractant Protein-1 Induces Proliferation and Interleukin-6 Production in Human Smooth Muscle Cells by Differential Activation of Nuclear Factor-{kappa}B and Activator Protein-1 Arterioscler Thromb Vasc Biol, June 1, 2002; 22(6): 914 - 920. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yamashita, S. Kawashima, M. Ozaki, M. Namiki, N. Inoue, K.-i. Hirata, and M. Yokoyama Propagermanium Reduces Atherosclerosis in Apolipoprotein E Knockout Mice via Inhibition of Macrophage Infiltration Arterioscler Thromb Vasc Biol, June 1, 2002; 22(6): 969 - 974. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. I. de Boer Cytokines and Therapy in COPD* : A Promising Combination? Chest, May 1, 2002; 121 (2009): 209S - 218S. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Cheng, N. W. Lukacs, and S. L. Kunkel Eotaxin/CCL11 Suppresses IL-8/CXCL8 Secretion from Human Dermal Microvascular Endothelial Cells J. Immunol., March 15, 2002; 168(6): 2887 - 2894. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Dzenko, A. V. Andjelkovic, W. A. Kuziel, and J. S. Pachter The Chemokine Receptor CCR2 Mediates the Binding and Internalization of Monocyte Chemoattractant Protein-1 along Brain Microvessels J. Neurosci., December 1, 2001; 21(23): 9214 - 9223. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. V. Volin, J. M. Woods, M. A. Amin, M. A. Connors, L. A. Harlow, and A. E. Koch Fractalkine: A Novel Angiogenic Chemokine in Rheumatoid Arthritis Am. J. Pathol., October 1, 2001; 159(4): 1521 - 1530. [Abstract] [Full Text]
|
|
|
|
|
|
Q. E. H. Low, I. A. Drugea, L. A. Duffner, D. G. Quinn, D. N. Cook, B. J. Rollins, E. J. Kovacs, and L. A. DiPietro Wound Healing in MIP-1{alpha}-/- and MCP-1-/- Mice Am. J. Pathol., August 1, 2001; 159(2): 457 - 463. [Abstract] [Full Text]
|
|
|
|
 |
|
 H.-J. ANDERS, V. VIELHAUER, M. KRETZLER, C. D. COHEN, S. SEGERER, B. LUCKOW, L. WELLER, H.-J. GRÖNE, and D. SCHLÖNDORFF Chemokine and Chemokine Receptor Expression during Initiation and Resolution of Immune Complex Glomerulonephritis J. Am. Soc. Nephrol., May 1, 2001; 12(5): 919 - 931. [Abstract] [Full Text]
|
|
|
|
|
|
R. Gillitzer and M. Goebeler Chemokines in cutaneous wound healing J. Leukoc. Biol., April 1, 2001; 69(4): 513 - 521. [Abstract] [Full Text]
|
|
|
|
|
|
N. S. Haque, J. T. Fallon, M. B. Taubman, and P. C. Harpel The chemokine receptor CCR8 mediates human endothelial cell chemotaxis induced by I-309 and Kaposi sarcoma herpesvirus-encoded vMIP-I and by lipoprotein(a)-stimulated endothelial cell conditioned medium Blood, January 1, 2001; 97(1): 39 - 45. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||