© 1999 American Heart Association, Inc.
Thrombosis |
A Transcriptional Repressor of the Tissue Factor Gene in Endothelial Cells
From the Department of Vascular Biology and Thrombosis Research, Vienna International Research Cooperation Center, University of Vienna, Austria. Present address of T.M., Cardiogene AG, Max-Planck-Strasse 15a, D-40699 Erkrath, Germany.
Correspondence to Erhard Hofer, Department of Vascular Biology and Thrombosis Research, Vienna International Research Cooperation Center, University of Vienna, Brunnerstrasse 59, A-1230 Vienna, Austria. E-mail erhard.hofer{at}univie.ac.at
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Tissue factor, the high-affinity receptor and cofactor for the plasma serine protease VII/VIIa, is the primary cellular initiator of the blood coagulation cascade. Inside the vasculature, expression of the tissue factor gene must be tightly controlled. Whereas the endothelium normally does not express tissue factor, on stimulation with inflammatory cytokines or endotoxin the gene is transcriptionally upregulated leading to a procoagulant state. We have now detected a repressive cis-acting element in the tissue factor promoter that downmodulates tissue factor transcription in endothelial cells. In reporter gene assays, deletion of this element leads to an increase of tissue factor transcription and insertion of a trimerized site reduces transcription. Specific protein/DNA complexes are formed on the element with nuclear extracts in electrophoretic mobility shift assays and cross-linking of the proteins followed by SDS-PAGE detects the presence of at least 2 subunits of
40 and 60 kDa, respectively. After transfection of
different cell types with the reporter genes, the suppressive effect of
the element can only be revealed in endothelial cells.
These data suggest that this element represents a novel
transcription factor target sequence that functions to suppress
expression of the tissue factor gene, preferentially in
endothelial cells thereby supporting a
noncoagulant state.
Key Words: tissue factor • endothelium • transcriptional repressor
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Tissue factor (TF) is a transmembrane glycoprotein with distant structural similarity to the cytokine receptor family and functions as the cellular activator of the extrinsic and intrinsic coagulation pathways.1 2 3 It forms a complex with the plasma serine protease factor VII/VIIa, which binds and activates factors IX and X. Whereas TF is constitutively produced on cells of the adventitia surrounding blood vessels, it is not normally expressed on cells exposed to circulating blood, such as endothelial cells (ECs) or immune cells.4 5 6 However, after exposure to endotoxin or inflammatory cytokines, ECs rapidly upregulate TF expression. Inappropriate expression of TF on ECs is associated with several diseases and can cause various forms of intravascular coagulation.7 8 9
The mechanisms that lead to TF gene upregulation in ECs or monocytes
after exposure to inflammatory stimuli have been investigated in some
detail.10 DNase I footprinting studies on both the human
and the porcine TF promoters have revealed the occupancy of several
sites, including nuclear factor-
B (NFB), AP-1, and Sp1 elements,
in the respective promoters.11 12 To investigate the roles
of these transcription factor binding sites in TF gene expression,
reporter genes containing various parts of the TF promoter have been
analyzed.12 13 14 Whereas primarily the NFB, and
to some degree also the 2 AP-1 elements, which are clustered between
-186 and -142 of the porcine TF promoter, are involved in the
activation of the gene in monocytic and ECs after stimulation with
endotoxin, the Sp1 elements are likely required for basal transcription
from the TF promoter. The region containing the Sp1 elements has been
further implicated in TF expression induced by phorbol
12-myristate 13-acetate in HeLa cells.15 The
TFB element, which deviates in 1 position from the NFB consensus
site, binds p65 and c-Rel subunits.12 16 17 These subunits
quickly accumulate in the nucleus after stimulation but are virtually
absent from nuclear extracts of untreated ECs.
However, it has remained elusive by which mechanisms TF expression is
prevented in quiescent ECs compared with the
subendothelium and which mechanisms contribute to the
fine-tuning of TF expression. Simply the absence of the
respec-tive NFB subunits in the nucleus might explain the
lack of expression in quiescent ECs and transcription could be
upregulated in relation to the amount of B accumulating in the
nuclei. In contrast, repressive elements could be present on the TF
promoter and prevent inappropriate expression in the absence of any
stimuli. We have therefore investigated additional regions of the TF
promoter previously shown by us to be occupied by proteins in footprint
analysis.12 In these studies, we noticed that
deletion of a region at -300 bp of the porcine TF promoter leads to a
severalfold higher transcription rate in reporter gene assays. We
define here the boundaries and sequence of the element responsible for
this effect and demonstrate that specific protein/DNA complexes are
formed on the porcine and the homologous human version of the element.
In addition, we present data indicating that the repressor
functions selectively in ECs.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Cell Culture and Transient Transfection
ECs were isolated from porcine and bovine aortas and cultured as described.12 18 Human umbilical vein ECs (HUVECs), primary human vascular smooth muscle cells, and primary human fibroblasts were obtained as described19 20 21 and cultured in M199 medium supplemented with 20% newborn calf serum (HyClone), 2 mmol/L L-glutamine, 100 U/mL penicillin, and 100 µg/mL streptomycin. HUVEC cultures contained, in addition, 50 µg/mL EC growth supplement (Technoclone) and 5 U/mL heparin. Cells were used up to passage number 12. Lipopolysaccharide (LPS) and recombinant human interleukin-1
and tumor necrosis factor- (TNF-) used for
inductions were purchased from Sigma and from Genzyme Inc,
respectively. Transfections of porcine aortic ECs were performed by using psoralen- and UV-inactivated biotinylated adenovirus and streptavidin/poly-L-lysine as a vector for DNA delivery according to the protocol of Cotten et al,22 with minor modifications as described by Moll et al.12 Bovine aortic ECs, HUVECs, human fibroblasts, or human smooth muscle cells were transfected by using LipofectAMINE (GIBCO) according to the protocol provided by the manufacturer.
Reporter Gene Constructs and Assays
The basal TF promoter/luciferase reporter gene construct
containing the region from -330 to +118 of the porcine TF promoter
cloned into a modified pUBT-luc vector23 has been
described previously.12 The -295/+118 TF promoter
fragment was synthesized by PCR from the -330/+118 construct, using an
oligonucleotide providing a NotI cleavage
site fused to the sequence starting at position -295. The PCR fragment
was cleaved with NotI (at the 5'-end) and HindIII
(at the 3'-end, position +118) and cloned into the respective sites of
the pUBT-luc vector. The construct with a deletion of the
pyrimidine-rich repressor element (Py-box) was obtained from (1) a
synthetic oligonucleotide covering the sequences from
-330 to -307 with a NotI site at the 5'-end and an
XbaI site at the 3'-end, and (2) a PCR fragment synthesized
similarly as described above, using an oligonucleotide
providing an XbaI cleavage site fused to the 5'-end of the
sequence starting at position -287 of the TF promoter, the PCR
product extending to the HindIII site at +118. The
resulting construct has the sequences from position -306 to -288
substituted by an XbaI cleavage site (GCTCTAGAGC). The
TFB deletion construct has been described,12 the
double deletion of the Py-box and B sites was obtained by using a
fragment generated by PCR from the B deletion construct as described
above.
A trimerized Py-box
(GCTCTAGACCCCTTCTTCCCCACAG-ACCTGC ATCGAT
CCCCTTCTTCCCCACAGACCTGC
ATCG-ATCCCCTTCTTCCCCACAGACCTGCTCTAGAGC)
was synthesized with an Applied Biosystems DNA Synthesizer and the
oligonucleotide inserted into the XbaI site,
substituting the Py-box sequence in the corresponding deletion
construct. All constructs were partially sequenced to show fidelity of
the PCR and subcloning procedures. Luciferase assays were performed
with cellular lysates of transfected cells as
described.24 Between 103 and
105 luciferase units were obtained with the basal
TF promoter constructs, using 105 cells per
well for the transfections, respectively.
Nuclear Extract Preparation and Electrophoretic Mobility Shift
Assay
Nuclear extracts from confluent EC cultures, human vascular
smooth muscle cells, human fibroblasts, THP-1, and K562 cells were
prepared essentially as described by Moll et al.12 For the
electrophoretic mobility shift assays, 2.5 to 5 µg of nuclear protein
were incubated with 0.3 to 1.0 ng of radioactively labeled
oligonucleotide (105 cpm/µL) in
binding buffer (20 mmol/L HEPES-KOH, pH 7.9, 1 mmol/L EDTA,
5 mmol/L MgCl2, 50 mmol/L KCl, 1
mmol/L DTT, and 10% glycerol) for 20 to 30 minutes at room
temperature. Protein/DNA complexes were resolved on 5% PAGE in 0.5x
Tris-borate/EDTA electrophoresis buffer.25
The double-stranded synthetic oligonucleotides were
radioactively labeled by filling in the overhangs with Klenow enzyme in
the presence of [-32P]dATP and subsequently
purified over a 7% polyacrylamide gel. The sequences of the
probes used were as follows:
porcine TF Py-box: 5'-ctaCCCCTTCTTCCCCACAGACCT-GCgaatt-3';
5'-deletions: 2 bp, 5'-ctaCCTTCTTCCCCACAGACCTGCgaatt-3'; 4 bp, 5'-ctaTTCTTCCCCACAGACCTGCgaatt-3';
3'-deletions: 2 bp, 5'-ctaCCCCTTCTTCCCCACAGACCTgaatt-3'; 4 bp, 5'-ctaCCCCTTCTTCCCCACAGACgaatt-3'; 6 bp, 5'-ctaCCCCTTCTTCCCCACAGgaatt-3';
human TF Py-box: 5'-ctaTCCCTTTCCTGCCATAGACCTGC-gaatt-3';
Ets-1: 5'-ctaCAGAGCGGAAGTGACgaatt-3';
vWF Py-box: 5'-aattCCCCTTCCTCCAAACACAGCAGCgaatt-3';
Sp1: 5'-aattcCGGGGGCGGGACCAGGGCGGGGCCTCgaatt-3';
UV Cross-Linking and Southwestern Blotting
UV cross-linking experiments were performed according to Chodosh
et al,26 as previously described.12 In brief,
an elongated form of Py-box oligonucleotide
(5'-CCCTTGCGATATCCCCCTTCTTC-CCCACAGACCTGC-3') was body-labeled on
the top strand with [-32P]dATP, using Klenow
enzyme and a short oligonucleotide as primer
(5'-CCCTTGCGATATC-3'). The reaction was performed in the presence of
bromodeoxyuridine triphosphate (BrdUTP). Nuclear extract (10 µg) was
then incubated with 1.5 to 2x106 cpm of
gel-purified radioactive probe. After native gel electrophoresis, the
protein/DNA complexes were covalently cross-linked by UV irradiation
(302 nm, 12 minutes) in the gel. The bands containing the complexes of
interest were excised and the gel slice boiled for 5 minutes in 1
volume 2x SDS sample buffer. Subsequently, both gel slice and sample
buffer were loaded onto a 7.5% polyacrylamide gel and
analyzed by SDS-PAGE and autoradiography.
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
A Novel Conserved Sequence Element in the TF Promoter
We have previously characterized protein binding regions on the porcine TF promoter by footprint analysis and detected binding of Sp1, NF
B, and AP-1 factors.12 In these studies, an
additional region at -300 bp of the TF promoter has been found to be
protected from DNase I cleavage. A closer sequence comparison of the
DNase I–protected region of the porcine promoter12 with
the human TF gene26 identified a region of similar
sequence 50 bp further upstream in the human promoter (Figure 1
). In agreement with our findings in the
porcine system, this region in the human promoter has previously been
described to be protected from DNase I digestion in footprint
experiments.11 We have termed the CT-rich region closely
conserved between the human and porcine genes pyrimidine box (Py-box)
element.
|
Specific Protein/DNA Complexes Are Formed With the Py-Box
Element
To define the boundaries of the element and to characterize
potential proteins interacting with this region, gel retardation assays
were performed by using oligonucleotides covering the
sequences of the region. With oligonucleotides
containing the sequences from position -308 to -286 of the promoter,
we observed the formation of 2 specific protein/DNA complexes of
slightly differing mobilities with nuclear extracts from both quiescent
as well as LPS- or TNF-–treated cells (Figure 2A). To define the minimal DNA sequence
required for complex formation, a series of
oligonucleotides with sequential 2-bp deletions of
bases from either the 5'- or the 3'-ends were created. Binding assays
with these oligos are shown in Figure 2B. Removing 2
nucleotides from the 3'-end of the conserved region was
tolerated in part, although the quantity of bound factors was reduced
and the lower of the 2 complexes largely disappeared. When 2
nucleotides were removed from the 5'-end, or 4
nucleotides from the 3'-end, binding activity was
completely destroyed. This demonstrates that a minimum of 21 bp from
-308 to -288 is essential for complex formation.
|
Deletion of the Py-Box Element Increases Transcription
Rates
When we tested a deletion of the sequences from -330 to -295 of
the basal TF promoter, which removes the 5'-half of the Py-box element,
increased expression of a luciferase reporter gene was observed (Figure 3A). Further proof that the Py-box
element mediates the repressive effect observed is provided by a
substitution of the 19 central nucleotides of the element
(positions -306 to -288) by an XbaI cleavage site. This
substitution leads to a 3-fold increase in the transcriptional activity
of the promoter, comparable with the effect seen with the -295
deletion construct (Figure 3B). The relative increase is similar
for LPS-treated or nontreated cells.
|
As discussed previously,12 we generally observe a partial
activation of the TF gene by the transfection procedures, leading to
partially upregulated levels of TF transcription in cells without LPS
treatment. To determine whether the Py-box element would function to
ensure suppression of the TF gene in the absence of NFB activity, we
have tested whether removal of the Py-box element from the B-deleted
version of the basal -330-bp TF promoter would result in increased
transcription. Removal of the B site from the promoter has been
previously shown to lead to a strong reduction in promoter activity and
virtual unresponsiveness to LPS activation.12 Indeed,
additional removal of the Py-box element from the B-deficient TF
promoter results in increased transcription levels, suggesting a role
of the Py-box element in suppressing the activity of constitutive
transcription factors such as AP-1 and Sp1 in EC (Figure 3C
).
To exclude an effect of the XbaI linker sequence inserted on
the position of the Py-box, we have further tested whether a trimerized
Py-box element would function when reinserted into the XbaI
site in the corresponding Py-box deletion construct. As expected, a
3-fold reduction in comparison with the Py-box deletion construct is
observed (Figure 3C).
CT-Rich Sequences Within the Py-Box Are Essential for
Binding Activity
To identify the parts of the Py-box sequence required for complex
formation, we tested a series of 3-bp substitutions throughout the
21-bp region determined to be the minimal size of the element in
mobility shift assays. Consecutive substitutions of 3
nucleotides of the Py-box sequence by the triplet T-C-A
results in a complete loss of binding activity when
nucleotides 1 to 12 and 19 to 21 are replaced. In contrast,
substitutions of oligonucleotides 13 to 18 still
allowed the formation of somewhat reduced levels of the complex. These
data indicate that the pyrimidine parts of the sequence are essential
for complex formation and the sequence of the stretch from
oligonucleotides 13 to 18, which contains 4 purines, is
partially dispensable (Figure 4).
|
Proteins in the Range of 40 and 60 kDa Bind to the Py-Box
Element
To investigate the subunit composition of the protein
complex interacting with the Py-box, we have analyzed which
proteins can be covalently cross-linked to 5-bromodeoxyuridine
(BrdU)-substituted DNA after UV irradiation of gel-purified protein/DNA
complexes.27 Proteins cross-linked to the Py-box were
separated by SDS-PAGE, revealing a single strong band at 48 kDa and 3
weaker bands of 65 to 70 kDa (Figure 5). Assuming that the DNA in the complex
would comprise 4 to 8 kDa, this suggests the presence of 2 to 4
different DNA binding polypeptides of 40 and 60 to 65 kDa,
respectively.
|
Competition Experiments With Potential Related Elements
Having defined the minimal size of the Py-box binding site,
we have searched the nucleotide database for transcription
factor binding sites with homologies to the Py-box. We have noticed the
presence of a run of 5 nucleotides CTTCC, which could
represent the core sequence of an ets binding
site.28 However, when a standard ets-1 binding site is
used in competition experiments, the formation of specific complexes on
the Py-box element is not affected (Figure 6A). Further, Ets-1 antibodies do not
give a supershift when added to the electrophoretic mobility shift
assay (data not shown).
|
Further, we have aligned the Py-box sequence to promoters of several
genes expressed in ECs. In this analysis, we detect the best
homology to a stretch of the human von Willebrand factor
promoter (-381 to -359 bp; see Figure 1). It is noteworthy
that this sequence is present in the von Willebrand
promoter in a 174-bp fragment recently described to contain a
repressive element.29 30 We have also tested the sequence
from the von Willebrand promoter and found that this element
partially competes with the complex formation on the TF Py-box (Figure 6A) and gives a similar sized, although somewhat weaker, shift
in electrophoretic mobility shift assays (data not shown). It is
therefore possible that a Py-box-like element is present also in
the von Willebrand factor gene.
The Py-Box Element Gives Mobility Shifts With Extracts From
Human Umbilical Vein ECs and Other Human Cell Types
To test whether extracts from human ECs and the human version of
the Py-box are capable of forming similar complexes, the porcine Py-box
oligonucleotide was tested with extracts of porcine
aortic ECs and HUVECs. Identical bands are obtained with extracts from
the porcine and human cells (Figure 6B). In a similar manner,
the human Py-box sequence gives the same shift (Figure 7). To further evaluate whether the
complex-forming proteins are present in cell types of the
subendothelium, extracts from human primary vascular
smooth muscle cells and fibroblasts were tested. Again, similar
complexes were detected with nuclear extracts from smooth muscle cells
and fibroblasts (Figure 7).
|
Repressive Effect of the Py-Box Is Only Revealed in
Endothelial Cells
A potential cell-type specific function of the Py-box element was
tested by reporter gene assays by using the -330-bp basal TF promoter
and its Py-box deletion form. After transfection of HUVECs and 2
primary human cells constitutively producing TF, vascular smooth muscle
cells and fibroblasts, increased expression of the Py-box deletion
construct, compared with the control construct, could only be shown in
the ECs (Figure 8).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Whereas several cell types around blood vessels, such as adventitial fibroblasts and smooth muscle cells, keratinocytes of the skin and astroglia of the brain, constitutively express TF, vascular ECs and blood cells normally do not express the protein.4 5 6 This cell type-specific constitutive expression of TF suggests that the protein forms a hemostatic barrier around blood vessels that activates coagulation when the integrity of the vascular system is disrupted. In contrast, cells inside the vasculature such as ECs are only capable of upregulating TF in response to specific stimuli such as endotoxin or inflammatory cytokines. Inappropriate TF expression on these cells can lead to pathological conditions connected with inflammation, atherosclerosis, and intravascular thrombosis.7 8 9 Therefore, the TF gene must be tightly controlled in ECs. As recently shown by Mackman,10 Moll et al,12 and Parry and Mackman,17 the TF promoter is upregulated after activation of ECs by an NF
B-like site
binding c-Rel and p65, the binding factors being absent from nuclei of
unstimulated cells. However, it is still unclear how the absence of
expression is ensured in the presence of additional transcription
factors binding to the TF promoter in quiescent ECs such as AP-1 and
Sp1.12 14 Further, the proper quantitative adjustment of
only moderate transcription levels of TF in
cytokine-activated ECs may need control mechanisms in
addition to NFB activation.
Because we have previously observed a strong DNase I protected site
around -300 bp of the porcine TF promoter,12 we have
explored the possibility that this region would contain a transcription
factor binding site. Although our previous sequence comparison of the
porcine and human TF promoters12 has not revealed a
conserved sequence in this region, a closer inspection of the
neighboring sequences identified a closely related element in both
genes occurring 50 bp further upstream of the transcription start
site in the human promoter. Because the porcine promoter is lacking the
sequences between -37 bp and -69 bp of the human promoter, the
distance between the Py-box and the AP-1 and NFB sites is very
similar in the human and porcine promoters. Remarkably, the region
containing the human equivalent has also been described to contain a
strong DNase I–protected site and has been suggested to bind
regulatory proteins.11 In addition, the region upstream of
the AP-1 elements between -383 and -279 bp in the human TF promoter
has been shown to contain a negative regulatory element by reporter
gene studies in COS cells, but no further characterization has been
described.10 31
When the binding of nuclear proteins to
oligonucleotides containing the conserved sequences was
tested, a specific binding pattern showing 2 complexes of slightly
differing mobilities was revealed (Figure 2). The observed
binding was similar with extracts from untreated, or LPS- or
TNF-–induced ECs, suggesting occupancy of the site independent of
the activation status of the cells. This observation suggests that the
binding factors work to suppress transcription in quiescent ECs and to
fine-tune the rates in activated cells to moderate levels. The
limits of the binding element were clearly defined to a stretch of 23
bp, largely conserved between the human and porcine genes. A further
shortening of the sequence was not at all tolerated on the 5'-end and
only partially on the 3'-end. This indicates a relatively large binding
area.
To prove that the 23-bp element caused the repressive effect and
not any other undetected site between -330 and -295 of the TF
promoter, a deletion construct substituting the 19 bp from the center
of the Py-box element was prepared and found to give an increased
transcription rate comparable with the -295 deletion construct.
Increased transcription rates of the deletion construct were observed
for untreated and LPS-treated ECs (Figure 3B) and similar
results were obtained for TNF-–induced cells (data not shown). To
further test the possibility that the Py-box element could function to
ensure absence of expression in quiescent ECs in the presence of AP-1
and Sp1 factors, we have tested the effect of deleting the Py-box
sequence from a promoter fragment without the B element. This
resulted again in increased transcription levels, suggesting a role in
the suppression of AP-1 and Sp1 transcription factors constitutively
present in ECs. Because also B-mediated induced levels of
transcription were reduced by the Py-box element, a second role could
be the fine-tuning of TF transcription to levels appropriate to
cytokine-stimulated ECs. In accordance with its function as a
suppressive element, a trimerized site reintroduced into the
XbaI site, substituting the Py-box in the deletion
construct, showed 3-fold reduced transcription levels compared with the
Py-box deletion construct (Figure 3C).
The core of the repressor binding site is extremely
pyrimidine-rich on the plus strand, containing close to 80%
pyrimidines. For this reason, we refer to this sequence as Py-box
element. A series of 3-bp substitutions throughout the element supports
the conclusion that the parts of the sequence that are pyrimidine-rich
on the plus strand and purine-rich on the opposite strand are essential
for the observed binding. A closer inspection of the sequence and
comparison with a collection of transcription factor binding sites
revealed some distant similarities to the binding sites of the
Ets family members, which are GA-rich on one strand and CT-rich on the
other strand.28 The GGAA Ets-1 core site is present on
the opposite strand of the porcine and human equivalents of the Py-box.
However, we believe it unlikely that an Ets family member is actually
binding to the Py-box. Our data show that a standard Ets-1 binding site
could not compete for Py-box binding (Figure 6) and an Ets-1
antibody did not supershift the complex (data not shown). These data
challenge the presence of Ets-1 in the Py-box binding complex,
although a distant relative of the large family cannot be
excluded.
The proteins binding to the Py-box oligonucleotide have
been further analyzed by using UV cross-linking (Figure 5). These data define a polypeptide in the size range of 40 kDa
and 3 further polypeptides of similar size in the range of 60 to 65
kDa. It is possible that these 3 polypeptides are differentially
modified forms of 1 subunit or 3 independent proteins.
Searching the promoters of other genes expressed in ECs, a striking
similarity of the Py-box to a sequence in the von Willebrand
factor promoter was detected (see Figure 1). This region from
the von Willebrand factor promoter competed reasonably well for
the binding to the Py-box element (Figure 6A) and gave a
comparable, although weaker, complex with nuclear extracts from ECs
(data not shown). The sequence is located in the von Willebrand
promoter within a larger segment recently shown to exert strong
repressive effects mediated by an NF1 binding site.29 30
It is possible that the pyrimidine-rich sequence in the same fragment
of the von Willebrand factor promoter contributes to the
repression of the gene.
Many transcription factors have been shown to be modulated in their activity by posttranslational modifications as phosphorylation.32 This in turn could either affect the binding properties of the factors to their respective binding site on DNA or could modulate the interaction with other transcription factors without influencing the binding to their cognate DNA element in the promoter. The latter mechanism could explain our observation that the inhibitive properties of the Py-box element can be only detected in ECs and not in primary fibroblasts or smooth muscle cells despite the presence of binding factors in these cells. It is possible that the inhibitive properties of the Py-box binding factors are only revealed after a certain modification of the factors in ECs. In contrast, in fibroblasts or smooth muscle cells, the inhibitive properties observed in ECs could be overcome in the context of different factors with strong activating properties.
Repressive transcription factors can exert their action through several
mechanisms.33 They could bind and then either directly
interact with other enhancer binding factors or general transcription
factors and thereby inhibit the transactivation of the transcriptional
machinery. In contrast, they could compete for the binding of
activatory transcription factors to the same region of the
promoter. There is ample evidence that many transcription factors can
act either as activating or as inhibitory factors,
depending on the specific array of the additional transcription factors
binding to an individual promoter. In the case of the Py-box binding
factors, we would favor currently the direct interaction with other
activating transcription factors constitutively binding to the TF
promoter in ECs. This inhibition is likely to be overcome in ECs by the
activity of NFB factors, which are strongly induced after
inflammatory activation of the endothelium. It remains
to be shown whether the described repressive element and its
interacting proteins, for which we propose a role in maintaining a
nonthrombotic environment inside the vasculature, define a mechanism
active also on other genes expressed in ECs.
|
Acknowledgments |
|---|
This work was supported by a grant from the Austrian Science Foundation to E.H. (SFB F005-10). We thank Mrs. Erni Scharzinger for excellent technical assistance.
Received October 13, 1998; accepted December 18, 1998.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
- Edgington TS, Mackman N, Brand K, Ruf W. The structural biology of expression and function of tissue factor. Thromb Haemost. 1991;66:67–79.[Medline] [Order article via Infotrieve]
- Ruf W, Edgington TS. Structural biology of tissue factor, the initiator of thrombogenesis in vivo. FASEB J. 1994;8:385–390.[Abstract]
- Martin DM, Boys CW, Ruf W. Tissue factor: molecular recognition and cofactor function. FASEB J. 1995;9:852–859.[Abstract]
- Drake TA, Morrissey JH, Edgington TS. Selective cellular expression of tissue factor in human tissues: implications for disorders of hemostasis and thrombosis. Am J Pathol. 1989;134:1087–1097.[Abstract]
-
Wilcox JN, Smith KM, Schwartz SM, Gordon D.
Localization of tissue factor in the normal vessel wall and in the
atherosclerotic plaque. Proc Natl Acad Sci U S A. 1989;86:2839–2843.
[Abstract/Free Full Text] - Fleck RA, Rao LV, Rapaport SI, Varki N. Localization of human tissue factor antigen by immunostaining with monospecific, polyclonal anti-human tissue factor antibody. Thromb Res. 1990;59:421–437.[Medline] [Order article via Infotrieve]
- Morrissey JH, Drake TA. Procoagulant response of the endothelium and monocytes. In: Schlag G, Riedl H, eds. Pathophysiology of Shock, Sepsis and Organ Failure. Berlin, Germany: Springer-Verlag; 1993:564–574.
- Kirchhofer D, Tschopp TB, Hadvary P, Baumgartner HR. Endothelial cells stimulated with tumor necrosis factor-alpha express varying amounts of tissue factor resulting in inhomogenous fibrin deposition in a native blood flow system: effects of thrombin inhibitors. J Clin Invest. 1994;93:2073–2083.
- Levi M, ten Cate H, Bauer KA, van der Poll T, Edgington TS, Buller HR, van Deventer SJ, Hack CE, ten Cate J, Rosenberg RD. Inhibition of endotoxin-induced activation of coagulation and fibrinolysis by pentoxifylline or by a monoclonal anti-tissue factor antibody in chimpanzees. J Clin Invest. 1994;93:114–120.
- Mackman N. Regulation of the tissue factor gene. Faseb J. 1995;9:883–889.[Abstract]
-
Donovan-Peluso M, George LD, Hassett AC.
Lipopolysaccharide induction of tissue factor expression in
THP-1 monocytic cells: protein-DNA interactions with the promoter.
J Biol Chem. 1994;269:1361–1369.
[Abstract/Free Full Text] -
Moll T, Czyz M, Holzmüller H, Hofer-Warbinek R,
Wagner E, Winkler H, Bach FH, Hofer E. Regulation of the tissue factor
promoter in endothelial cells: binding of NF kappa B-,
AP-1-, and Sp1-like transcription factors. J Biol Chem. 1995;270:3849–3857.
[Abstract/Free Full Text] -
Mackman N, Brand K, Edgington TS.
Lipopolysaccharide-mediated transcriptional activation of the
human tissue factor gene in THP-1 monocytic cells requires both
activator protein 1 and nuclear factor kappa B binding
sites. J Exp Med. 1991;174:1517–1526.
[Abstract/Free Full Text] -
Parry GC, Mackman N. Transcriptional regulation of
tissue factor expression in human endothelial cells.
Arterioscler Thromb Vasc Biol. 1995;15:612–621.
[Abstract/Free Full Text] -
Cui MZ, Parry GC, Oeth P, Larson H, Smith M, Huang RP,
Adamson ED, Mackman N. Transcriptional regulation of the tissue factor
gene in human epithelial cells is mediated by Sp1 and EGR-1.
J Biol Chem. 1996;271:2731–2739.
[Abstract/Free Full Text] -
Oeth PA, Parry GC, Kunsch C, Nantermet P, Rosen CA,
Mackman N. Lipopolysaccharide induction of tissue factor gene
expression in monocytic cells is mediated by binding of c-Rel/p65
heterodimers to a kappa B-like site. Mol Cell Biol. 1994;14:3772–3781.
[Abstract/Free Full Text] -
Parry GC, Mackman N. A set of inducible genes expressed
by activated human monocytic and endothelial
cells contain kappa B-like sites that specifically bind c-Rel-p65
heterodimers. J Biol Chem. 1994;269:20823–20825.
[Abstract/Free Full Text] - Warren JB. Large vessel endothelial isolation. In: Warren JB, ed. The Endothelium: An Introduction to Current Research. New York, NY: Wiley-Liss; 1990:263–272.
-
Wojta J, Hoover RL, Daniel TO. Vascular origin
determines plasminogen activator expression in
human endothelial cells. J Biol Chem. 1989;264:2846–2852.
[Abstract/Free Full Text] - Wojta J, Gallicchio M, Zoellner H, Hufnagl P, Last K, Filonzi EL, Binder BR, Hamilton JA, McGrath K. Thrombin stimulates expression of tissue-type plasminogen activator and plasminogen activator inhibitor type 1 in cultured human vascular smooth muscle cells. Thromb Haemost. 1993;70:469–474.[Medline] [Order article via Infotrieve]
-
Zhang JC, Fabry A, Paucz L, Wojta J, Binder BR. Human
fibroblasts downregulate plasminogen activator
inhibitor type-1 in cultured human macrovascular and
microvascular endothelial cells. Blood. 1996;88:3880–3886.
[Abstract/Free Full Text] - Cotten M, Wagner E, Birnstiel ML. Receptor-mediated transport of DNA into eukaryotic cells. Methods Enzymol. 1993;217:618–644.[Medline] [Order article via Infotrieve]
- de Martin R, Vanhove B, Cheng Q, Hofer E, Csizmadia V, Winkler H, Bach FH. Cytokine-inducible expression in endothelial cells of an I kappa B alpha-like gene is regulated by NF kappa B. EMBO J. 1993;12:2773–2779.[Medline] [Order article via Infotrieve]
-
de Wet J, Wood KV, DeLuca M, Helinski DR, Subramani S.
Firefly luciferase gene: structure and expression in mammalian cells.
Mol Cell Biol. 1987;7:725–737.
[Abstract/Free Full Text] - Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press; 1989.
- Mackman N, Morrissey JH, Fowler B, Edgington TS. Complete sequence of the human tissue factor gene, a highly regulated cellular receptor that initiates the coagulation protease cascade. Biochemistry. 1989;28:1755–1762.[Medline] [Order article via Infotrieve]
-
Chodosh LA, Carthew RW, Sharp PA. A single polypeptide
possesses the binding and transcription activities of the adenovirus
major late transcription factor. Mol Cell Biol. 1986;6:4723–4733.
[Abstract/Free Full Text] - Wasylyk B, Hahn SL, Giovane A. The Ets family of transcription factors. Eur J Biochem. 1993;211:7–18.[Medline] [Order article via Infotrieve]
-
Jahroudi N, Lynch DC.
Endothelial-cell-specific regulation of von
Willebrand factor gene expression. Mol Cell Biol. 1994;14:999–1008.
[Abstract/Free Full Text] -
Jahroudi N, Ardekani AM, Greenberger JS. An NF1-like
protein functions as a repressor of the von Willebrand factor
promoter. J Biol Chem. 1996;271:21413–21421.
[Abstract/Free Full Text] -
Mackman N, Fowler BJ, Edgington TS, Morrissey JH.
Functional analysis of the human tissue factor promoter and
induction by serum. Proc Natl Acad Sci U S A. 1990;87:2254–2258.
[Abstract/Free Full Text] - Ernst P, Smale ST. Combinatorial regulation of transcription I: general aspects of transcriptional control. Immunity. 1995;2:311–319.[Medline] [Order article via Infotrieve]
- Johnson AD. The price of repression. Cell. 1995;81:655–658.[Medline] [Order article via Infotrieve]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||