Thrombosis |
From the Atherosclerosis Research Unit, King Gustaf V Research Institute, Department of Medicine, Karolinska Institute, Karolinska Hospital, Stockholm, Sweden. Present address of B.A. Allison, Department of Surgery, Division of Vascular Surgery, University of British Columbia, Vancouver, Canada.
Correspondence to P. Eriksson, King Gustaf V Research Institute, Karolinska Hospital, S-171 76 Stockholm, Sweden. E-mail Per.Eriksson{at}medks.ki.se
| Abstract |
|---|
|
|
|---|
Key Words: plasminogen activator inhibitor-1 LDL oxidized LDL triglycerides
| Introduction |
|---|
|
|
|---|
PAI-1 synthesis is regulated by a large number of substances,9 and both environmental and genetic factors contribute to determine plasma PAI-1 activity.10 A striking feature of PAI-1 is its positive association with the VLDL triglyceride (TG) concentration.11 VLDL has consistently been shown to induce a concentration-dependent increase in PAI-1 expression in cultured human umbilical vein endothelial cells (HUVECs)12 13 14 and liver cells.13 15 In contrast, variable effects have been reported for native and oxidatively modified LDL. Native LDL (nLDL) has generally been shown not to induce PAI-1 synthesis,14 16 17 unless high concentrations or prolonged incubation times (48 hours) are used.12 18 LDL oxidized by UV light (uvLDL) stimulates the synthesis and secretion of PAI-1 from cultured endothelial cells,16 whereas either stimulation,17 no effect,12 or reversal of nLDL-induced effects18 has been obtained with more drastic peroxidation using copper. Increased PAI-1 secretion by HUVECs in culture has been reported when LDL was modified by acetylation.18 Finally, Lp(a), an LDL-like lipoprotein containing the unique apo(a), which is structurally related to plasminogen, has been shown to induce PAI-1 secretion from HUVECs.19
The molecular mechanism(s) by which VLDL and modified LDL initiate secretion of PAI-1 from endothelial and liver cells needs further clarification. So far, the LDL receptor has been implicated in the interaction between VLDL and endothelial cells that results in secretion of PAI-1,12 whereas LDL effects do not appear to be dependent on interactions with the LDL receptor.16 18 The mechanisms underlying the effect of mildly oxidized LDL include hydrolysis of membrane phosphatidylinositol through activation of phospholipase A2,20 whereas more drastic, copper-induced peroxidation causes stimulation of PAI-1 secretion by transferable hydrophilic lipids, especially lysophosphatidylcholine.17 Recent studies on the molecular mechanisms by which VLDL increases PAI-1 expression in endothelial cells have identified a VLDL-response element in the promoter region of the PAI-1 gene locus.21 In HepG2 cells, on the other hand, VLDL does not increase PAI-1 gene transcription but instead stabilizes the 2 PAI-1 mRNA transcripts.15
Whereas considerable progress has been made in the understanding of the VLDL effects on PAI-1 expression, results on LDL are not consistent and the corresponding mechanisms less clearly delineated, not the least because of differences in experimental protocols used in the studies published so far. In the present study, enhancement of PAI-1 protein and mRNA expression by nLDL, uvLDL, and TG-enriched LDL (TG-LDL) was studied in HUVECs, using different incubation times. In addition, the 3 LDL preparations were examined with respect to their ability to induce binding of the VLDL-inducible transcription factor21 to the PAI-1 promoter. It was hypothesized that the TG content of the LDL particle influences PAI-1 expression in endothelial cells and that minimally modified LDL induces increased PAI-1 expression by a mechanism differing from that of TG-rich LDL.
| Methods |
|---|
|
|
|---|
Lipoprotein Preparation
Pooled plasma from normolipidemic subjects was used for
isolating plasma lipoproteins. Venous blood was drawn into Vacutainer
tubes containing Na2EDTA (1.4 mg/mL) and chilled
to 4°C immediately on collection, and plasma was recovered by
low-speed centrifugation (1400g for 20
minutes). VLDL22 and LDL23 were isolated
from normal human plasma by density gradient
ultracentrifugation, using SW 40 swinging bucket rotors
in an L855 ultracentrifuge (Beckman). The LDL fraction
(density, 1.025 to 1.050 kg/L) was collected as the yellow band located
between 4 and 5 cm from the bottom of the centrifuge
tube23 and desalted by passage over a Sephadex rG-25 M
PD-10 column (Pharmacia). The protein concentration was determined by
the method of Lowry et al.24
LDL was oxidatively modified by a 2-hour exposure to 254-nm UV light.25 TG-LDL was isolated from plasma that had been incubated with 1 mg/mL VLDL overnight at 37°C.26 For control purposes, plasma was incubated with an equivalent volume of PBS overnight at 37°C, before isolation of the LDL (PBS-LDL). All LDL preparations were filter-sterilized through a 0.2-µm syringe filter (Sartorius AG) before addition to the culture medium. VLDL preparations were run through a 0.45-µm filter.
Modifications of the LDL preparations were analyzed by agarose gel electrophoresis27 and SDSpolyacrylamide gel electrophoresis.28 Peroxidation of the lipoprotein preparations was measured by using the LPO-586 colorimetric assay (Bioxytech SA). The degree of LDL oxidation was expressed as nanomoles of malondialdehyde (MDA) equivalent per milligram of LDL protein. The presence of endotoxin in the lipoprotein preparations was determined by using a quantitative chromogenic Limulus Amebocyte lysate assay (COATEST Endotoxin, Endosafe Inc). All lipoprotein preparations used in the described experiments had endotoxin levels <0.1 ng/mg of LDL protein.
Determination of PAI-1 Protein Secretion
Confluent cultures of HUVECs were incubated for 24 hours at
37°C in M199 containing 0.1% BSA. This incubation was followed by
either a 4-hour or an 18-hour incubation at 37°C with added
lipoproteins. In the 4-hour incubations, the lipoprotein-containing
medium was replaced at 4 hours with medium containing 0.1% BSA. In
both instances, a sample of the conditioned medium was collected 18
hours after the initial lipoprotein addition and stored at -70°C
until analysis. After centrifugation of the
conditioned medium at 10 000 rpm for 5 minutes, the PAI-1 protein
concentration in the medium was quantified by using an ELISA (TintELIZE
PAI-1, Biopool) that detects active and inactive (latent) forms of
PAI-1 as well as tissue-type plasminogen
activator/PAI-1 complexes. The cells were trypsinized and
counted. PAI-1 secretion was quantified as nanograms of PAI-1 per
104 cells, and the results were expressed as a
percentage of control (no lipoprotein added). The basal secretion of
PAI-1 from HUVECs was 100 to 150 ng/105
cells.
Analysis of PAI-1 mRNA Expression
Confluent cultures of HUVECs were incubated for 24 hours at
37°C in M199 medium with 0.1% BSA. After this incubation, the cells
were incubated for 4 hours or 18 hours with various lipoprotein
preparations. At this point, the medium was aspirated and the cells
were homogenized and the mRNA was isolated according to the
Rneasy handbook (QIAGEN). Northern blotting and hybridization on DuPont
GeneScreen Plus nylon membranes (NEN Research Products) were
performed according to the manufacturer's protocol. Blots were
hybridized with 106 cpm/mL
[
-32P]dCTP-labeled SfiI and
BglII fragment (1255 bp) of the cDNA for PAI-1 (courtesy of
Dr Tor Ny, Department of Biochemistry and Biophysics, University of
Umeå, Sweden).
Electromobility Shift Assay (EMSA)
Nuclear extracts were prepared according to Alksnis et
al.29 In brief, cells at near confluence from one 9-cm
Petri dish were harvested and washed in ice-cold PBS. The cells were
dissolved in 60 µL of hypotonic buffer (10 mmol/L Tris-HCl [pH
7.3], 10 mmol/L KCl, and 1.5 mmol/L
MgCl2) and centrifuged at 10 000 rpm for
30 seconds at 40°C. The pellet was dissolved in 80 µL of
lysis buffer (hypotonic buffer plus 0.4% NP-40) and incubated on ice
for 10 minutes. After 1-minute centrifugation, the
pellet was washed in 1 mL of 0.02 mol/L KCl buffer (20 mmol/L
Tris-HCl [pH 7.3], 21.75% [wt/vol] glycerol, 1.5 mmol/L
MgCl2, 0.2 mmol/L
Na2EDTA, and 0.02 mol/L KCl). The pellet was
dissolved in 15 µL of 0.02 mol/L KCl buffer with subsequent dropwise
addition of 60 µL of 0.6 mol/L KCl buffer (see above for 0.02 mol/L
KCl buffer) and gently shaken for 30 minutes at 4°C. After
centrifugation for 15 minutes, the supernatant was used
directly in electromobility shift analysis. All buffers were
supplemented freshly with 0.7 µg/mL leupeptin, 16.7 µg/mL
aprotinin, 0.5 mmol/L PMSF, and 0.33 µL/mL
2-mercaptoethanol. The protein concentration in the extracts was
estimated by the method of Kalb and Bernlohr.30 Incubation
for EMSA was conducted as described31 and applied on a 7%
(wt/vol) polyacrylamide/bisacrylamide (80:1) gel
and electrophoresed in 0.25x Tris-Gorate EDTA buffer for 2
hours at 200 V.
DNA Constructs for EMSA
For EMSAs, a double-stranded oligonucleotide
containing a VLDL-response element
(CGGGGAGTCAGCCGTGTATCATCGGAGGCGGCCGGGC) of the human PAI-1 promoter was
designed as described earlier.21 The probe was end-labeled
with [
-32P]ATP, using T4
polynucleotide kinase.32
Data Analysis
The amount of PAI-1 secreted from HUVECs was expressed as a
mean±SD value. Comparisons of the PAI-1 secretion obtained at the
different LDL concentrations were made by Student's unpaired 2-tailed
t test.
| Results |
|---|
|
|
|---|
|
The plasma PAI-1 activity correlates positively with the serum or VLDL
TG concentration.11 Furthermore, VLDL enhances PAI-1
secretion from HUVECs in vitro,12 13 14 and this activation
is abolished by blocking antibodies directed against the LDL
receptor.12 As both VLDL and LDL particles bind to the LDL
receptor, whereas only VLDL enhances PAI-1 secretion from
endothelial and liver cells in culture, the TG content
of the lipoprotein particle might be important for the induction of
PAI-1. To test this hypothesis, TG-enriched LDL particles, prepared by
incubating plasma with VLDL before the isolation of LDL, and PBS-LDL as
control, were incubated with HUVECs. As shown in Figure 2
, the stimulation of PAI-1 protein
secretion by LDL was enhanced by increasing the TG content of the LDL
particle. When the TG-to-protein ratio was increased by 46%, compared
with the PBS-LDL, the PAI-1 secretion from HUVECs exposed to 0 to 100
µg/mL TG-LDL for 4 hours was significantly (P<0.01,
P<0.05, P<0.001, P<0.001, and
P<0.05 at 8, 10, 20, 50, and 100 µg/mL LDL, respectively)
increased compared with PBS-LDL (Figure 2
). Individual
preparations of TG-LDL had different ratios of TG to protein. The
increase in PAI-1 secretion from HUVECs seemed to be directly
proportional to the TG content of the LDL preparation (Figure 2
). LDL that had been enriched in phosopholipid had no
effect on PAI-1 secretion (data not shown). To further study the
effects of TGs on PAI-1 expression, we incubated HUVECs with a TG
emulsion (Intralipid, Pharmacia) and measured the PAI-1 release into
the medium. As demonstrated in Figure 3A
and 3B
, addition of 1 to 5 mg/mL Intralipid resulted in a significant
increase in PAI-1 secretion from HUVECs.
|
|
Analysis of lipid peroxides in the different preparations of
LDL showed that uvLDL contained significantly more lipid peroxides than
the nLDL preparations, whereas TG-LDL and PBS-LDL consistently
had similar levels of lipid peroxides that were intermediate to nLDL
and uvLDL (Table
).
SDSpolyacrylamide gel electrophoresis of the LDL preparations
demonstrated that apoB100 was not degraded in any of the preparations
(data not shown). Agarose gel electrophoresis, on the other hand,
showed that TG-LDL and PBS-LDL displayed greater mobility than did
preparations of native LDL or LDL in unfractionated plasma. uvLDL also
consistently had enhanced mobility (Figure 4
). The enhanced, but equivalent,
mobility of TG-LDL and PBS-LDL indicates that the effect of TG-LDL on
PAI-1 secretion is not caused by increased lipid peroxidation.
|
|
Northern blot analysis of mRNA levels confirmed the results
shown above concerning the stimulation of PAI-1 by native or modified
forms of LDL. Figure 5A
through 5C shows
a representative northern blot analysis of the
mRNA recovered from HUVECs. Figure 5A
shows the mRNA levels
after 18 hours of exposure to uvLDL. Both the 3.2-kb and the 2.2-kb
PAI-1 transcripts were enhanced by 10 to 100 µg/mL uvLDL. Neither
uvLDL nor nLDL increased PAI-1 mRNA levels after a 4-hour incubation
with the HUVECs (Figure 5B
). However, TG-LDL (10 to 100 µg/mL)
induced an increase in both the 3.2-kb and the 2.2-kb transcripts of
PAI-1 mRNA (Figure 5B
and 5C
) after a 4-hour incubation.
|
VLDL has recently been shown to activate binding of a
transcription factor to the PAI-1 promoter.21 An EMSA was
performed, to investigate whether native LDL or modified forms of LDL
also influenced the binding of this factor. Nuclear extracts were
prepared from HUVECs incubated with various lipoprotein preparations.
As shown in Figure 6
, the binding of the
VLDL-inducible factor was markedly enhanced by 10 µg/mL TG-LDL
(Figure 6
, lane 6) relative to the same concentration of nLDL,
uvLDL, or PBS-LDL. Higher concentrations (100 µg/mL) of nLDL and
uvLDL also induced this transcription factor. In addition, when HUVECs
were incubated with PBS-LDL with a total amount of TGs equal to 10
µg/mL TG-LDL, a similar increase in binding of the transcription
factor was obtained by the 2 lipoprotein preparations (Figure 7
).
|
|
| Discussion |
|---|
|
|
|---|
Consistent with most previous studies,14 16 17 we found no significant activation of PAI-1 synthesis by nLDL in HUVECs. In addition, our results suggest that minimal modification of LDL in vitro by UV radiation is not in itself sufficient to stimulate PAI-1 protein or mRNA expression in endothelial cells. Only when uvLDL was incubated with the HUVECs for 18 hours did it activate PAI-1 secretion, whereas no effect was obtained after a 4-hour incubation. This suggests that further modification of the uvLDL by the HUVECs is required to produce an oxidation product that induced PAI-1 expression. Our data on nLDL do not support the concept that nLDL enhances PAI-1 secretion by endothelial cells18 at concentrations corresponding to those found in plasma of normolipidemic or mildly to moderately hyperlipidemic individuals. Although inferences made from in vitro findings to the in vivo situation are hazardous, it is noteworthy that the plasma PAI-1 activity of nondiabetic, type IIa hypercholesterolemic patients with coronary heart disease has been found to be similar to the PAI-1 activity distribution of an age-matched segment of the general population.11 In contrast, our results concerning uvLDL extend the work of Latron et al, 16 who demonstrated a potent activation of PAI-1 secretion by HUVECs incubated with uvLDL for 24 hours.
The LDL TG content is determined by a process mediated by plasma lipid transfer proteins and is increased in response to elevated plasma chylomicron and VLDL TG levels.33 34 This process can be augmented in vitro by incubating plasma with purified VLDL to produce LDL with a higher-than-normal TG content.26 Analysis of the TG-enriched LDL particles produced in vitro revealed no change in apoE content.26 TG-LDL prepared in this manner proved to be a particularly potent activator of PAI-1 protein and mRNA in HUVECs. Analysis of the lipid peroxidation of the LDL preparations indicated that the potent stimulation of PAI-1 protein and mRNA correlated with the TG content of the TG-LDL and did not depend on enhanced lipid peroxidation. Previously, Stiko-Rahm et al 12 did not observe an increase in PAI-1 secretion from HUVECs in the presence of LDL isolated from hypertriglyceridemic plasma. Oxidative modification during the long (48 hours) incubation period used in the previous study is likely to explain this discrepancy, as the TG content of the LDL particle is a major determinant of its proneness to oxidative modification.35 In the present study, incubation of HUVECs with TG-LDL was terminated at 4 hours, to differentiate the effects caused by TG enrichment from those of oxidation in culture.
In vitro VLDL activates secretion of PAI-1 from cultured HUVECs,12 13 14 36 with VLDL isolated from hypertriglyceridemic individuals having a greater effect on HUVECs than VLDL from normotriglyceridemic individuals.12 Recently, part of the molecular mechanism by which VLDL increases PAI-1 synthesis in endothelial cells has been clarified.21 A region of the PAI-1 promoter located adjacent to the binding site of the 5G allele-specific factor37 binds a VLDL-inducible transcription factor. In the present study, EMSA performed with HUVEC nuclear extracts and a probe containing the VLDL-responsive element has shown that TG-LDL induces the same transcription factor at both low and high concentrations. In contrast, only high concentrations of nLDL and uvLDL induce this factor. This suggests that high amounts of LDL TGs, whether provided by a high number of nLDL or uvLDL particles or a lower number of TG-enriched LDL particles, induce the same transcription factor as VLDL and that the TG content of the LDL particle is a determinant of PAI-1 expression in endothelial cells. Furthermore, it can be envisioned that apoB-containing TG-rich lipoprotein particles are merely vehicles facilitating the TG entry into the endothelial cell, as we have shown that similar effects can be obtained with TG emulsion particles that obviously do not use the LDL receptor for cellular uptake.
Low concentration of uvLDL (10 µg/mL) enhanced PAI-1 protein and mRNA
expression in the HUVECs after an 18-hour incubation but did not
activate the VLDL-inducible transcription factor. In contrast
to uvLDL, low concentration of TG-LDL activated the
VLDL-inducible transcription factor, suggesting that PAI-1 stimulation
by low levels of oxidized LDL is mediated by a different mechanism than
that of VLDL and TG-LDL. The alternating pattern in Figure 1
could be a result of oxidized LDL at the low concentration and of TGs
at the higher concentrations. Recent studies have shown that low levels
of oxidized LDL (8 µg/mL) induce the release of the cytokine
tumor necrosis factor-
(TNF
) in monocytes.38
However, no induction of TNF
was observed at high LDL
concentrations. TNF
also induces PAI-1 in
endothelial cells.39 Whether low
concentrations of oxidized LDL can induce TNF
and/or other
cytokines in endothelial cells, which then
induce PAI-1 in an autocrine manner, must be examined in future
studies.
The fairly heterogeneous PAI-1 responses to various LDL preparations observed in previous studies are likely to depend on differences in LDL composition and experimental conditions. Differences in cell passage, supplementation with growth factors, and incubation times belong to the latter category. As Lp(a) has been shown to increase PAI-1 synthesis and secretion by endothelial cells,19 the possibility also exists that LDL preparations have contained variable amounts of Lp(a) that enhance PAI-1 secretion. However, this was an unlikely situation in the present study because the density cuts used for isolating LDL (1.025 to 1.050 kg/L) would preclude significant contamination with Lp(a).
VLDL and modified LDL subspecies are likely to impair the fibrinolytic activity at the endothelial surface and promote fibrin deposition, which would favor thrombus formation in the event of plaque rupture. The molecular mechanisms explaining the activation of PAI-1 synthesis in endothelial cells by apoB-containing lipoproteins largely remain to be clarified.
| Acknowledgments |
|---|
Received September 17, 1998; accepted October 10, 1998.
| References |
|---|
|
|
|---|
2. Hamsten A, de Faire U, Walldius G, Dahlen G, Szamosi A, Landou C, Blombäck M, Wiman B. Plasminogen activator inhibitor in plasma: risk factor for recurrent myocardial infarction. Lancet. 1987;2:39.[Medline] [Order article via Infotrieve]
3.
Cortellaro M, Cofrancesco E, Boschetti C, Mussoni L,
Donati MB, Cardillo M, Catalano M, Gabrielli L, Lombardi B, Specchia
G, Tarazzi L, Tremoli E, Pozzoli E, Turri M. Increased
fibrin turnover and high PAI-1 activity as predictors of
ischemic events in atherosclerotic patients: a case-control
study: the PLAT Group. Arterioscler Thromb. 1993;13:14121417.
4. Malmberg K, Bavenholm P, Hamsten A. Clinical and biochemical factors associated with prognosis after myocardial infarction at a young age. J Am Coll Cardiol. 1994;24:592599.[Abstract]
5.
Juhan-Vague I, Pyke SDM, Alessi MC, Jespersen J,
Haverkate F, Thompson SG on behalf of the ECAT Study Group.
Fibrinolytic factors and the risk of myocardial infarction or sudden
death in patients with angina pectoris. Circulation. 1996;94:20572063.
6.
Schneiderman J, Sawdey MS, Keeton MR, Bordin GM,
Bernstein EF, Dilley RB, Loskutoff DJ. Increased type 1
plasminogen activator inhibitor
gene expression in atherosclerotic human arteries. Proc Natl Acad
Sci U S A. 1992;89:69987002.
7.
Lupu F, Bergonezelli G, Heim D, Cousin E, Genton C,
Bachman F, Kruithof E. Localization and production of
plasminogen activator inhibitor-1
in human healthy and atherosclerotic arteries. Arterioscler
Thromb. 1993;13:10901100.
8. Chomiki N, Henry M, Alessi MC, Anfosso F, Juhan-Vague I. Plasminogen activator inhibitor-1 expression in human liver and healthy or atherosclerotic vessel walls. Thromb Haemost. 1994;72:4453.[Medline] [Order article via Infotrieve]
9. Loskutoff D. Regulation of PAI-1 gene expression. Fibrinolysis. 1991;5:197206.
10. Hamsten A, Eriksson P. Fibrinolysis and atherosclerosis: an update. Fibrinolysis. 1994;8(suppl 1):253262.
11. Hamsten A, Wiman B, de Faire U, Blombäck M. Increased plasma levels of a rapid inhibitor of tissue plasminogen activator in young survivors of myocardial infarction. N Engl J Med. 1985;313:15571563.[Abstract]
12.
Stiko-Rahm A, Wiman B, Hamsten A, Nilsson J. Secretion
of plasminogen activator
inhibitor-1 from cultured human umbilical vein
endothelial cells is induced by very low density
lipoprotein. Arteriosclerosis. 1990;10:10671073.
13.
Mussoni L, Mannucci L, Sirtori M, Camera M, Maderna P,
Sironi L, Tremoli E. Hypertriglyceridemia
and regulation of fibrinolytic activity. Arterioscler
Thromb. 1992;12:1927.
14. Kaneko T, Wada H, Wakita Y, Minamikawa K, Nakase T, Mori Y, Deguchi K, Shirakawa S. Enhanced tissue factor activity and plasminogen activator inhibitor-1 antigen in human umbilical vein endothelial cells incubated with lipoproteins. Blood Coagul Fibrinolysis. 1994;5:385392.[Medline] [Order article via Infotrieve]
15.
Sironi L, Mussoni L, Prati L, Baldassarre D, Camera M,
Banfi C, Tremoli E. Plasminogen activator
inhibitor type-1 synthesis and mRNA expression in HepG2
cells are regulated by VLDL. Arterioscler Thromb Vasc Biol. 1996;16:8996.
16.
Latron Y, Chautan M, Anfosso F, Alessi MC, Nalbone G,
Lafont H, Juhan-Vague I. Stimulating effect of oxidized low density
lipoproteins on plasminogen activator
inhibitor-1 synthesis by endothelial cells.
Arterioscler Thromb. 1991;11:18211829.
17.
Kugiyama K, Sakamot T, Misumi I, Sugiyama S, Ohgushi M,
Ogawa H, Horiguchi M, Yasue H. Transferable lipids in oxidized
low-density lipoprotein stimulate plasminogen
activator inhibitor-1 and inhibit tissue-type
plasminogen activator release from
endothelial cells. Circ Res. 1993;73:335343.
18.
Tremoli E, Camera M, Maderna P, Sironi L, Prati L,
Colli S, Piovella F, Bernini F, Corsini A, Mussoni L. Increased
synthesis of plasminogen activator
inhibitor-1 by cultured human endothelial
cells exposed to native and modified LDLs: an LDL receptor-independent
phenomenon. Arterioscler Thromb. 1993;13:338346.
19.
Etingin O, Hajjar D, Hajjar K, Harpel P, Nachman
R. Lipoprotein (a) regulates plasminogen
activator inhibitor-1 expression in
endothelial cells: a potential mechanism in
thrombogenesis. J Biol Chem. 1991;266:24592465.
20. Chautan M, Latron Y, Anfosso F, Alessi MC, Lafont H, Juhan-Vague I, Nalbone G. Phosphatidylinositol turnover during stimulation of plasminogen activator inhibitor-1 secretion induced by oxidized low density lipoproteins in human endothelial cells. J Lipid Res. 1993;34:101110.[Abstract]
21.
Eriksson P, Nilsson L, Karpe F, Hamsten A.
Very-low-density lipoprotein response element in the promoter region of
the human plasminogen activator
inhibitor-1 gene implicated in the impaired
fibrinolysis of
hypertriglyceridemia. Arterioscler
Thromb Vasc Biol. 1998;18:2026.
22. Karpe F, Steiner G, Olivecrona T, Carlson LA, Hamsten A. Metabolism of triglyceride-rich lipoproteins during alimentary lipemia. J Clin Invest. 1993;91:748758.
23. Redgrave T, Carlson L-A. Changes in plasma very low density lipoprotein content, composition and size after a fatty meal in normo- and hypertriglyceridemic man. J Lipid Res. 1979;20:217229.[Abstract]
24.
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein
measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265275.
25. Dousset N, Negre-Salvayre A, Lopez M, Salvayre R, Douste-Blazy L. Ultraviolet-treated lipoproteins as a model system for the study of the biological effects of lipid peroxides on cultured cell. I. Chemical modifications of ultraviolet-treated low-density lipoproteins. Biochim Biophys Acta. 1990;1045:219223.[Medline] [Order article via Infotrieve]
26. McKeone B, Patsch J, Pownall H. Plasma triglycerides determine low density lipoprotein composition, physical properties and cell-specific binding in cultured cells. J Clin Invest. 1993;91:19261933.
27. Nobel R. Electrophoretic separation of plasma lipoproteins in agarose gel. J Lipid Res. 1968;9:693700.[Abstract]
28. Karpe F, Hamsten A. Determination of apolipoproteins B-48 and B-100 in triglyceride-rich lipoproteins by analytical SDS-PAGE. J Lipid Res. 1994;35:13111317.[Abstract]
29.
Alksnis M, Barkhem T, Strömstedt P-E, Ahola H,
Kutoh E, Gustafsson J-Å, Poellinger L, Nilsson S. High level
expression of functional full length and truncated glucocorticoid
receptor in Chinese hamster ovary cells. J Biol Chem. 1991;266:1007810085.
30. Kalb VF, Bernlohr RW. A new spectrophotometric assay for protein in cell extracts. Anal Biochem. 1977;82:362371.[Medline] [Order article via Infotrieve]
31.
Dawson SJ, Wiman B, Hamsten A, Green F, Humphries
S, Henney AM. The two allele sequences of a common polymorphism
in the promoter of the plasminogen activator
inhibitor-1 (PAI-1) gene respond differently to
interleukin-1 in HepG2 cells. J Biol Chem. 1993;268:1073910745.
32.
Eriksson P, Wrange Ö. Protein-protein contacts in
the glucocorticoid receptor homodimer influence its DNA binding
properties. J Biol Chem. 1990;265:35353542.
33.
Deckelbaum R, Granot E, Oschry Y, Rose L, Eisenberg S.
Plasma triglyceride determines structure-composition in low
and high density lipoproteins.
Arteriosclerosis. 1984;4:225231.
34.
Albers J, Tollefson J, Chen C-H, Steinmetz A.
Isolation and characterisation of human lipid transfer proteins.
Arteriosclerosis. 1984;4:4958.
35. Regnstrom J, Nilsson J, Tornvall P, Landou C, Hamsten A. Susceptibility to low-density lipoprotein oxidation and coronary atherosclerosis in man. Lancet. 1992;339:11831186.[Medline] [Order article via Infotrieve]
36.
Li X-N, Grenett HE, Benza RL, Demissie S, Brown SL,
Tabengwa EM, Gianturco SH, Bradley WA, Fless GM, Booyse FM.
Genotype-specific transcriptional regulation of PAI-1
expression by hypertriglyceridemic VLDL and
Lp(a) in cultured human endothelial cells.
Arterioscler Thromb Vasc Biol. 1997;17:32153223.
37.
Eriksson P, Kallin B, van `t Hooft FM,
Bavenholm P, Hamsten A. Allele-specific increase in basal
transcription of the plasminogen-activator
inhibitor 1 gene is associated with myocardial infarction.
Proc Natl Acad Sci U S A. 1995;92:18511855.
38.
Jovinge S, Ares M, Kallin B, Nilsson J. Human
monocyte/macrophages release tumor necrosis factor alpha in
response to oxidized low density lipoprotein. Arterioscler Thromb
Vasc Biol. 1996;16:15731579.
39.
Schleef RR, Bevilacqua MP, Sawdey M, Gimbrone MA Jr,
Loskutoff DJ. Cytokine activation of vascular
endothelium: effects on tissue-type
plasminogen activator and type 1
plasminogen activator inhibitor.
J Biol Chem. 1988;263:57975803.
This article has been cited by other articles:
![]() |
J. P. Corsetti, D. Ryan, A. J. Moss, D. L. Rainwater, W. Zareba, and C. E. Sparks Plasminogen Activator Inhibitor-1 Polymorphism (4G/5G) Predicts Recurrence in Nonhyperlipidemic Postinfarction Patients Arterioscler. Thromb. Vasc. Biol., March 1, 2008; 28(3): 548 - 554. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Song, J. L. Barth, Y. Yu, K. Lu, A. Dashti, Y. Huang, C. K. Gittinger, W. S. Argraves, and T. J. Lyons Effects of Oxidized and Glycated LDL on Gene Expression in Human Retinal Capillary Pericytes Invest. Ophthalmol. Vis. Sci., August 1, 2005; 46(8): 2974 - 2982. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Whatling, H. Bjork, S. Gredmark, A. Hamsten, and P. Eriksson Effect of macrophage differentiation and exposure to mildly oxidized LDL on the proteolytic repertoire of THP-1 monocytes J. Lipid Res., September 1, 2004; 45(9): 1768 - 1776. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Lyons, A. J. Jenkins, D. Zheng, D. T. Lackland, D. McGee, W. T. Garvey, and R. L. Klein Diabetic Retinopathy and Serum Lipoprotein Subclasses in the DCCT/EDIC Cohort Invest. Ophthalmol. Vis. Sci., March 1, 2004; 45(3): 910 - 918. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. E. Sobel, D. J. Taatjes, and D. J. Schneider Intramural Plasminogen Activator Inhibitor Type-1 and Coronary Atherosclerosis Arterioscler. Thromb. Vasc. Biol., November 1, 2003; 23(11): 1979 - 1989. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-C. Alessi, D. Bastelica, A. Mavri, P. Morange, B. Berthet, M. Grino, and I. Juhan-Vague Plasma PAI-1 Levels Are More Strongly Related to Liver Steatosis Than to Adipose Tissue Accumulation Arterioscler. Thromb. Vasc. Biol., July 1, 2003; 23(7): 1262 - 1268. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Konstantinides, K. Schafer, and D. J. Loskutoff Do PAI-1 and Vitronectin Promote or Inhibit Neointima Formation?: The Exact Role of the Fibrinolytic System in Vascular Remodeling Remains Uncertain Arterioscler. Thromb. Vasc. Biol., December 1, 2002; 22(12): 1943 - 1945. [Full Text] [PDF] |
||||
![]() |
S. Ren, H. Lee, L. Hu, L. Lu, and G. X. Shen Impact of Diabetes-Associated Lipoproteins on Generation of Fibrinolytic Regulators from Vascular Endothelial Cells J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 286 - 291. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jormsjo, C. Whatling, D. H. Walter, A. M. Zeiher, A. Hamsten, and P. Eriksson Allele-Specific Regulation of Matrix Metalloproteinase-7 Promoter Activity Is Associated With Coronary Artery Luminal Dimensions Among Hypercholesterolemic Patients Arterioscler. Thromb. Vasc. Biol., November 1, 2001; 21(11): 1834 - 1839. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. MERTENS and P. HOLVOET Oxidized LDL and HDL: antagonists in atherothrombosis FASEB J, October 1, 2001; 15(12): 2073 - 2084. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Ploplis, I. Cornelissen, M. J. Sandoval-Cooper, L. Weeks, F. A. Noria, and F. J. Castellino Remodeling of the Vessel Wall after Copper-Induced Injury Is Highly Attenuated in Mice with a Total Deficiency of Plasminogen Activator Inhibitor-1 Am. J. Pathol., January 1, 2001; 158(1): 107 - 117. [Abstract] [Full Text] [PDF] |
||||
![]() |
J D Pearson Normal endothelial cell function Lupus, March 1, 2000; 9(3): 183 - 188. [Abstract] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
ATVB Home | Subscriptions | Archives | Feedback | Authors | Help | AHA Journals Home | Search Copyright © 1999 American Heart Association, Inc. All rights reserved. Unauthorized use prohibited. |