Donate Help Contact The AHA Sign In Home
American Heart Association
Arteriosclerosis, Thrombosis, and Vascular Biology
Search: search_blue_button Advanced Search
Arteriosclerosis, Thrombosis, and Vascular Biology. 1999;19:1354-1360

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Allison, B. A.
Right arrow Articles by Eriksson, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Allison, B. A.
Right arrow Articles by Eriksson, P.
Related Collections
Right arrow Physiological and pathological control of gene expression
Right arrow Coagulation and fibronolysis
Right arrow Lipid and lipoprotein metabolism
(Arteriosclerosis, Thrombosis, and Vascular Biology. 1999;19:1354-1360.)
© 1999 American Heart Association, Inc.


Thrombosis

Effects of Native, Triglyceride-Enriched, and Oxidatively Modified LDL on Plasminogen Activator Inhibitor-1 Expression in Human Endothelial Cells

Beth A. Allison; Lennart Nilsson; Fredrik Karpe; Anders Hamsten; Per Eriksson

From the Atherosclerosis Research Unit, King Gustaf V Research Institute, Department of Medicine, Karolinska Institute, Karolinska Hospital, Stockholm, Sweden. Present address of B.A. Allison, Department of Surgery, Division of Vascular Surgery, University of British Columbia, Vancouver, Canada.

Correspondence to P. Eriksson, King Gustaf V Research Institute, Karolinska Hospital, S-171 76 Stockholm, Sweden. E-mail Per.Eriksson{at}medks.ki.se


*    Abstract
up arrowTop
*Abstract
down arrowIntroduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Abstract—Whereas VLDL has consistently been shown to induce a concentration-dependent increase in the expression of plasminogen activator inhibitor-1 (PAI-1) in human umbilical vein endothelial cells (HUVECs) and liver cells, variable effects have been reported for native and oxidatively modified LDL. In the present study, activation of PAI-1 protein and mRNA expression by native LDL (nLDL), UV-oxidized LDL (uvLDL), and triglyceride (TG)-enriched LDL was studied in HUVECs by using different incubation times and a wide range of lipoprotein concentrations. No significant increase of PAI-1 protein expression was observed after 4 hours of incubation with nLDL or uvLDL. However, PAI-1 protein secretion from HUVECs was markedly enhanced after 18 hours of incubation with uvLDL (200% increase at 10 µg/mL). Stimulation of PAI-1 protein expression in HUVECs by nLDL was seen, however, after increasing the TG content of the LDL particle. LDL enriched in phospholipid had no effect on PAI-1 secretion. PAI-1 mRNA levels on northern blot increased in parallel with the activation of PAI-1 protein expression by native and modified forms of LDL. Low concentrations of TG-enriched LDL (10 µg/mL) and higher concentrations of nLDL and uvLDL (100 µg/mL) were found to increase the binding of a VLDL-inducible transcription factor to the PAI-1 promoter. These results indicate that the TG content of the LDL particle influences PAI-1 expression in endothelial cells. Low concentrations of uvLDL enhanced PAI-1 protein and mRNA expression in the HUVECs after an 18-hour incubation but did not influence the VLDL-inducible transcription factor. This suggests that low levels of oxidized LDL increase PAI-1 expression by a different mechanism than VLDL and TG-enriched LDL.


Key Words: plasminogen activator inhibitor-1 • LDL • oxidized LDL • triglycerides


*    Introduction
up arrowTop
up arrowAbstract
*Introduction
down arrowMethods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Increased plasma plasminogen activator inhibitor-1 (PAI-1) activity causing low endogenous fibrinolytic capacity is a common finding in patients with manifest coronary heart disease1 and is associated with recurrence of cardiovascular events.2 3 4 5 The mechanism is considered to be coronary thrombosis, as PAI-1 is a rapid inhibitor of tissue-type plasminogen activator, which converts plasminogen to the proteolytic enzyme plasmin on fibrin deposits on injured arterial endothelium. However, elevated PAI-1 expression has also been found in atherosclerotic plaques, suggesting that PAI-1 may play a role in atherogenesis as well.6 7 8

PAI-1 synthesis is regulated by a large number of substances,9 and both environmental and genetic factors contribute to determine plasma PAI-1 activity.10 A striking feature of PAI-1 is its positive association with the VLDL triglyceride (TG) concentration.11 VLDL has consistently been shown to induce a concentration-dependent increase in PAI-1 expression in cultured human umbilical vein endothelial cells (HUVECs)12 13 14 and liver cells.13 15 In contrast, variable effects have been reported for native and oxidatively modified LDL. Native LDL (nLDL) has generally been shown not to induce PAI-1 synthesis,14 16 17 unless high concentrations or prolonged incubation times (48 hours) are used.12 18 LDL oxidized by UV light (uvLDL) stimulates the synthesis and secretion of PAI-1 from cultured endothelial cells,16 whereas either stimulation,17 no effect,12 or reversal of nLDL-induced effects18 has been obtained with more drastic peroxidation using copper. Increased PAI-1 secretion by HUVECs in culture has been reported when LDL was modified by acetylation.18 Finally, Lp(a), an LDL-like lipoprotein containing the unique apo(a), which is structurally related to plasminogen, has been shown to induce PAI-1 secretion from HUVECs.19

The molecular mechanism(s) by which VLDL and modified LDL initiate secretion of PAI-1 from endothelial and liver cells needs further clarification. So far, the LDL receptor has been implicated in the interaction between VLDL and endothelial cells that results in secretion of PAI-1,12 whereas LDL effects do not appear to be dependent on interactions with the LDL receptor.16 18 The mechanisms underlying the effect of mildly oxidized LDL include hydrolysis of membrane phosphatidylinositol through activation of phospholipase A2,20 whereas more drastic, copper-induced peroxidation causes stimulation of PAI-1 secretion by transferable hydrophilic lipids, especially lysophosphatidylcholine.17 Recent studies on the molecular mechanisms by which VLDL increases PAI-1 expression in endothelial cells have identified a VLDL-response element in the promoter region of the PAI-1 gene locus.21 In HepG2 cells, on the other hand, VLDL does not increase PAI-1 gene transcription but instead stabilizes the 2 PAI-1 mRNA transcripts.15

Whereas considerable progress has been made in the understanding of the VLDL effects on PAI-1 expression, results on LDL are not consistent and the corresponding mechanisms less clearly delineated, not the least because of differences in experimental protocols used in the studies published so far. In the present study, enhancement of PAI-1 protein and mRNA expression by nLDL, uvLDL, and TG-enriched LDL (TG-LDL) was studied in HUVECs, using different incubation times. In addition, the 3 LDL preparations were examined with respect to their ability to induce binding of the VLDL-inducible transcription factor21 to the PAI-1 promoter. It was hypothesized that the TG content of the LDL particle influences PAI-1 expression in endothelial cells and that minimally modified LDL induces increased PAI-1 expression by a mechanism differing from that of TG-rich LDL.


*    Methods
up arrowTop
up arrowAbstract
up arrowIntroduction
*Methods
down arrowResults
down arrowDiscussion
down arrowReferences
 
Cell Culture
HUVEC cells were isolated from umbilical cords obtained at normal deliveries. The umbilical vein was canulated and perfused with 50 mL of PBS to remove any blood. Then, the vein was filled with 20 mL of 0.1% collagenase dissolved in PBS and incubated for 15 minutes at 37°C. The collagenase solution was drained from the cord and collected, and the cord was gently flushed with 20 mL of PBS, which was added to the collagenase solution. The cells in these pooled solutions were recovered by centrifugation at 200g for 5 minutes and seeded out on 9-cm culture dishes in M199 medium with 20% FCS, antibiotic/antimycotic (Sigma A-9909), and 8 µg/mL endothelial cell growth supplement (Collaborative Biomedical Products). The medium was changed 24 hours later. The cells were subcultured when confluent onto 0.2% gelatin (in PBS)–coated dishes. Cells from pooled multiple cords were used for experiments up until the fifth passage. Cell viability was tested by using trypan blue.

Lipoprotein Preparation
Pooled plasma from normolipidemic subjects was used for isolating plasma lipoproteins. Venous blood was drawn into Vacutainer tubes containing Na2EDTA (1.4 mg/mL) and chilled to 4°C immediately on collection, and plasma was recovered by low-speed centrifugation (1400g for 20 minutes). VLDL22 and LDL23 were isolated from normal human plasma by density gradient ultracentrifugation, using SW 40 swinging bucket rotors in an L8–55 ultracentrifuge (Beckman). The LDL fraction (density, 1.025 to 1.050 kg/L) was collected as the yellow band located between 4 and 5 cm from the bottom of the centrifuge tube23 and desalted by passage over a Sephadex rG-25 M PD-10 column (Pharmacia). The protein concentration was determined by the method of Lowry et al.24

LDL was oxidatively modified by a 2-hour exposure to 254-nm UV light.25 TG-LDL was isolated from plasma that had been incubated with 1 mg/mL VLDL overnight at 37°C.26 For control purposes, plasma was incubated with an equivalent volume of PBS overnight at 37°C, before isolation of the LDL (PBS-LDL). All LDL preparations were filter-sterilized through a 0.2-µm syringe filter (Sartorius AG) before addition to the culture medium. VLDL preparations were run through a 0.45-µm filter.

Modifications of the LDL preparations were analyzed by agarose gel electrophoresis27 and SDS–polyacrylamide gel electrophoresis.28 Peroxidation of the lipoprotein preparations was measured by using the LPO-586 colorimetric assay (Bioxytech SA). The degree of LDL oxidation was expressed as nanomoles of malondialdehyde (MDA) equivalent per milligram of LDL protein. The presence of endotoxin in the lipoprotein preparations was determined by using a quantitative chromogenic Limulus Amebocyte lysate assay (COATEST Endotoxin, Endosafe Inc). All lipoprotein preparations used in the described experiments had endotoxin levels <0.1 ng/mg of LDL protein.

Determination of PAI-1 Protein Secretion
Confluent cultures of HUVECs were incubated for 24 hours at 37°C in M199 containing 0.1% BSA. This incubation was followed by either a 4-hour or an 18-hour incubation at 37°C with added lipoproteins. In the 4-hour incubations, the lipoprotein-containing medium was replaced at 4 hours with medium containing 0.1% BSA. In both instances, a sample of the conditioned medium was collected 18 hours after the initial lipoprotein addition and stored at -70°C until analysis. After centrifugation of the conditioned medium at 10 000 rpm for 5 minutes, the PAI-1 protein concentration in the medium was quantified by using an ELISA (TintELIZE PAI-1, Biopool) that detects active and inactive (latent) forms of PAI-1 as well as tissue-type plasminogen activator/PAI-1 complexes. The cells were trypsinized and counted. PAI-1 secretion was quantified as nanograms of PAI-1 per 104 cells, and the results were expressed as a percentage of control (no lipoprotein added). The basal secretion of PAI-1 from HUVECs was 100 to 150 ng/105 cells.

Analysis of PAI-1 mRNA Expression
Confluent cultures of HUVECs were incubated for 24 hours at 37°C in M199 medium with 0.1% BSA. After this incubation, the cells were incubated for 4 hours or 18 hours with various lipoprotein preparations. At this point, the medium was aspirated and the cells were homogenized and the mRNA was isolated according to the Rneasy handbook (QIAGEN). Northern blotting and hybridization on DuPont GeneScreen Plus nylon membranes (NEN Research Products) were performed according to the manufacturer's protocol. Blots were hybridized with 106 cpm/mL [{alpha}-32P]dCTP-labeled SfiI and BglII fragment (1255 bp) of the cDNA for PAI-1 (courtesy of Dr Tor Ny, Department of Biochemistry and Biophysics, University of Umeå, Sweden).

Electromobility Shift Assay (EMSA)
Nuclear extracts were prepared according to Alksnis et al.29 In brief, cells at near confluence from one 9-cm Petri dish were harvested and washed in ice-cold PBS. The cells were dissolved in 60 µL of hypotonic buffer (10 mmol/L Tris-HCl [pH 7.3], 10 mmol/L KCl, and 1.5 mmol/L MgCl2) and centrifuged at 10 000 rpm for 30 seconds at 40°C. The pellet was dissolved in 80 µL of lysis buffer (hypotonic buffer plus 0.4% NP-40) and incubated on ice for 10 minutes. After 1-minute centrifugation, the pellet was washed in 1 mL of 0.02 mol/L KCl buffer (20 mmol/L Tris-HCl [pH 7.3], 21.75% [wt/vol] glycerol, 1.5 mmol/L MgCl2, 0.2 mmol/L Na2EDTA, and 0.02 mol/L KCl). The pellet was dissolved in 15 µL of 0.02 mol/L KCl buffer with subsequent dropwise addition of 60 µL of 0.6 mol/L KCl buffer (see above for 0.02 mol/L KCl buffer) and gently shaken for 30 minutes at 4°C. After centrifugation for 15 minutes, the supernatant was used directly in electromobility shift analysis. All buffers were supplemented freshly with 0.7 µg/mL leupeptin, 16.7 µg/mL aprotinin, 0.5 mmol/L PMSF, and 0.33 µL/mL 2-mercaptoethanol. The protein concentration in the extracts was estimated by the method of Kalb and Bernlohr.30 Incubation for EMSA was conducted as described31 and applied on a 7% (wt/vol) polyacrylamide/bisacrylamide (80:1) gel and electrophoresed in 0.25x Tris-Gorate EDTA buffer for 2 hours at 200 V.

DNA Constructs for EMSA
For EMSAs, a double-stranded oligonucleotide containing a VLDL-response element (CGGGGAGTCAGCCGTGTATCATCGGAGGCGGCCGGGC) of the human PAI-1 promoter was designed as described earlier.21 The probe was end-labeled with [{gamma}-32P]ATP, using T4 polynucleotide kinase.32

Data Analysis
The amount of PAI-1 secreted from HUVECs was expressed as a mean±SD value. Comparisons of the PAI-1 secretion obtained at the different LDL concentrations were made by Student's unpaired 2-tailed t test.


*    Results
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
*Results
down arrowDiscussion
down arrowReferences
 
HUVECs were exposed to nLDL or uvLDL for either 4 or 18 hours. In the 4-hour incubations, lipoproteins were replaced after 4 hours with medium and the incubation continued for an additional 14 hours before the medium was harvested and the cells counted. No significant stimulation of PAI-1 protein expression was observed after a 4-hour incubation with nLDL or uvLDL (data not shown). However, the PAI-1 protein secretion was markedly increased after incubation with 10 µg/mL (203±16% [mean±SD] of control, P=0.066) and 50 µg/mL (304±15% [mean±SD] of control, P<0.05) uvLDL for 18 hours (Figure 1Down). A small increase was seen at intermediate concentrations of uvLDL (120% of control at 20 µg/mL, NS). In contrast, nLDL did not significantly influence the PAI-1 secretion from HUVECs after an 18-hour incubation. Signs of cell toxicity, as determined by trypan blue exclusion and cell detachment, were not present in samples of endothelial cells incubated for 18 hours with nLDL or uvLDL in the 0 to 100 µg of protein/mL concentration range.



View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. HUVECs were exposed to nLDL or uvLDL for 18 hours before measuring PAI-1 protein in the medium and counting the cells. Three to 6 experiments, all performed in duplicate, were performed for each time point and cell type. Each data point represents the mean±SD. The results are expressed as percent increases in PAI-1 over control (no lipoproteins added).

The plasma PAI-1 activity correlates positively with the serum or VLDL TG concentration.11 Furthermore, VLDL enhances PAI-1 secretion from HUVECs in vitro,12 13 14 and this activation is abolished by blocking antibodies directed against the LDL receptor.12 As both VLDL and LDL particles bind to the LDL receptor, whereas only VLDL enhances PAI-1 secretion from endothelial and liver cells in culture, the TG content of the lipoprotein particle might be important for the induction of PAI-1. To test this hypothesis, TG-enriched LDL particles, prepared by incubating plasma with VLDL before the isolation of LDL, and PBS-LDL as control, were incubated with HUVECs. As shown in Figure 2Down, the stimulation of PAI-1 protein secretion by LDL was enhanced by increasing the TG content of the LDL particle. When the TG-to-protein ratio was increased by 46%, compared with the PBS-LDL, the PAI-1 secretion from HUVECs exposed to 0 to 100 µg/mL TG-LDL for 4 hours was significantly (P<0.01, P<0.05, P<0.001, P<0.001, and P<0.05 at 8, 10, 20, 50, and 100 µg/mL LDL, respectively) increased compared with PBS-LDL (Figure 2Down). Individual preparations of TG-LDL had different ratios of TG to protein. The increase in PAI-1 secretion from HUVECs seemed to be directly proportional to the TG content of the LDL preparation (Figure 2Down). LDL that had been enriched in phosopholipid had no effect on PAI-1 secretion (data not shown). To further study the effects of TGs on PAI-1 expression, we incubated HUVECs with a TG emulsion (Intralipid, Pharmacia) and measured the PAI-1 release into the medium. As demonstrated in Figure 3ADown and 3BDown, addition of 1 to 5 mg/mL Intralipid resulted in a significant increase in PAI-1 secretion from HUVECs.



View larger version (14K):
[in this window]
[in a new window]
 
Figure 2. HUVECs were exposed to TG-LDL or control PBS-LDL for 4 hours. TG-LDL (27% and 46% increase in TG content compared with PBS-LDL) was generated by incubating plasma with 1 mg/mL VLDL overnight at 37°C before isolating the LDL fraction. PBS-LDL obtained by incubating plasma with an equivalent volume of PBS instead of VLDL before the LDL fractionation was used as a control for LDL oxidation during the incubation procedure. Lipoproteins were replaced with medium after 4 hours and the incubation continued for an additional 14 hours before PAI-1 protein was measured in the medium and the cells were counted. Each data point represents the mean±SD of 2 to 4 experiments performed in triplicate. The results are expressed as percent increases in PAI-1 over control (no lipoproteins added).



View larger version (13K):
[in this window]
[in a new window]
 
Figure 3. HUVECs were exposed to a TG emulsion (Intralipid, Pharmacia) for 4 hours (A) or 18 hours (B) before measuring PAI-1 protein in the medium and counting the cells. In the 4-hour incubations, the TG emulsion was replaced after 4 hours with medium and the incubation continued for an additional 14 hours. The results are expressed as percent increases in PAI-1 over control (vehicle added). Three experiments, all performed in triplicate (A), and 2 experiments, all performed in duplicate (B), were performed for each time point. Each data point represents the mean±SD. *P<0.05; **P<0.01; and ***P<0.001.

Analysis of lipid peroxides in the different preparations of LDL showed that uvLDL contained significantly more lipid peroxides than the nLDL preparations, whereas TG-LDL and PBS-LDL consistently had similar levels of lipid peroxides that were intermediate to nLDL and uvLDL (TableDown). SDS–polyacrylamide gel electrophoresis of the LDL preparations demonstrated that apoB100 was not degraded in any of the preparations (data not shown). Agarose gel electrophoresis, on the other hand, showed that TG-LDL and PBS-LDL displayed greater mobility than did preparations of native LDL or LDL in unfractionated plasma. uvLDL also consistently had enhanced mobility (Figure 4Down). The enhanced, but equivalent, mobility of TG-LDL and PBS-LDL indicates that the effect of TG-LDL on PAI-1 secretion is not caused by increased lipid peroxidation.


View this table:
[in this window]
[in a new window]
 
Table 1. Lipid Peroxidation of LDL Preparations



View larger version (112K):
[in this window]
[in a new window]
 
Figure 4. A representative agarose electrophoresis gel (1% agarose, pH 8.6) of all LDL preparations. Staining was performed with 0.2% Sudan black (2.4% zinc acetate in 60% EtOH).

Northern blot analysis of mRNA levels confirmed the results shown above concerning the stimulation of PAI-1 by native or modified forms of LDL. Figure 5ADown through 5C shows a representative northern blot analysis of the mRNA recovered from HUVECs. Figure 5ADown shows the mRNA levels after 18 hours of exposure to uvLDL. Both the 3.2-kb and the 2.2-kb PAI-1 transcripts were enhanced by 10 to 100 µg/mL uvLDL. Neither uvLDL nor nLDL increased PAI-1 mRNA levels after a 4-hour incubation with the HUVECs (Figure 5BDown). However, TG-LDL (10 to 100 µg/mL) induced an increase in both the 3.2-kb and the 2.2-kb transcripts of PAI-1 mRNA (Figure 5BDown and 5CDown) after a 4-hour incubation.



View larger version (40K):
[in this window]
[in a new window]
 
Figure 5. PAI-1 mRNA recovered from HUVECs after an 18-hour (A) or 4-hour (B and C) incubation with native or modified forms of LDL. Total RNA (5 µg) was hybridized with the labeled cDNA probe for PAI-1. Representative northern blots derived from the same membrane are shown in each figure. The corresponding blotting filters stained with methylene blue to show the 28S and the 18S ribosomal RNAs demonstrate that approximately equal amounts of RNA were loaded.

VLDL has recently been shown to activate binding of a transcription factor to the PAI-1 promoter.21 An EMSA was performed, to investigate whether native LDL or modified forms of LDL also influenced the binding of this factor. Nuclear extracts were prepared from HUVECs incubated with various lipoprotein preparations. As shown in Figure 6Down, the binding of the VLDL-inducible factor was markedly enhanced by 10 µg/mL TG-LDL (Figure 6Down, lane 6) relative to the same concentration of nLDL, uvLDL, or PBS-LDL. Higher concentrations (100 µg/mL) of nLDL and uvLDL also induced this transcription factor. In addition, when HUVECs were incubated with PBS-LDL with a total amount of TGs equal to 10 µg/mL TG-LDL, a similar increase in binding of the transcription factor was obtained by the 2 lipoprotein preparations (Figure 7Down).



View larger version (80K):
[in this window]
[in a new window]
 
Figure 6. EMSA of nuclear extracts derived from HUVECs when incubated for 12 hours with lipoproteins and bound to the probe for the VLDL-responsive element of the PAI-1 promoter. Arrow indicates VLDL-inducible factor; F, free DNA. Lane 1, no extract; lane 2, noninduced extract; lane 3, 10 µg/mL nLDL; lane 4, 10 µg/mL uvLDL; lane 5, 10 µg/mL PBS-LDL; lane 6, 10 µg/mL TG-LDL; lane 7, 100 µg/mL nLDL; lane 8, 100 µg/mL uvLDL; and lane 9, 75 µg/mL VLDL.



View larger version (97K):
[in this window]
[in a new window]
 
Figure 7. EMSA of nuclear extracts derived from HUVECs when incubated for 4 hours with lipoproteins and bound to the probe for the VLDL-responsive element of the PAI-1 promoter. Lane 1, no extract; lane 2, noninduced extract; lane 3, 10 µg/mL nLDL; lane 4, 10 µg/mL PBS-LDL; lane 5, 17 µg/mL PBS-LDL with a total amount of TGs equal to 10 µg/mL TG-LDL; lane 6, 10 µg/mL TG-LDL. Arrow indicates VLDL-inducible factor; F, free DNA.


*    Discussion
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
*Discussion
down arrowReferences
 
In the present study, we have characterized the effects of nLDL, minimally modified LDL (uvLDL), and TG-LDL on the activation of PAI-1 protein secretion and mRNA expression in HUVECs, using different incubation times and a wide range of lipoprotein concentrations. In particular, the parallel use of 4-hour and 18-hour incubations allowed us to differentiate direct effects of the various lipoprotein preparations from effects that are likely to be the result of endothelial cell-induced oxidation of lipoproteins.

Consistent with most previous studies,14 16 17 we found no significant activation of PAI-1 synthesis by nLDL in HUVECs. In addition, our results suggest that minimal modification of LDL in vitro by UV radiation is not in itself sufficient to stimulate PAI-1 protein or mRNA expression in endothelial cells. Only when uvLDL was incubated with the HUVECs for 18 hours did it activate PAI-1 secretion, whereas no effect was obtained after a 4-hour incubation. This suggests that further modification of the uvLDL by the HUVECs is required to produce an oxidation product that induced PAI-1 expression. Our data on nLDL do not support the concept that nLDL enhances PAI-1 secretion by endothelial cells18 at concentrations corresponding to those found in plasma of normolipidemic or mildly to moderately hyperlipidemic individuals. Although inferences made from in vitro findings to the in vivo situation are hazardous, it is noteworthy that the plasma PAI-1 activity of nondiabetic, type IIa hypercholesterolemic patients with coronary heart disease has been found to be similar to the PAI-1 activity distribution of an age-matched segment of the general population.11 In contrast, our results concerning uvLDL extend the work of Latron et al, 16 who demonstrated a potent activation of PAI-1 secretion by HUVECs incubated with uvLDL for 24 hours.

The LDL TG content is determined by a process mediated by plasma lipid transfer proteins and is increased in response to elevated plasma chylomicron and VLDL TG levels.33 34 This process can be augmented in vitro by incubating plasma with purified VLDL to produce LDL with a higher-than-normal TG content.26 Analysis of the TG-enriched LDL particles produced in vitro revealed no change in apoE content.26 TG-LDL prepared in this manner proved to be a particularly potent activator of PAI-1 protein and mRNA in HUVECs. Analysis of the lipid peroxidation of the LDL preparations indicated that the potent stimulation of PAI-1 protein and mRNA correlated with the TG content of the TG-LDL and did not depend on enhanced lipid peroxidation. Previously, Stiko-Rahm et al 12 did not observe an increase in PAI-1 secretion from HUVECs in the presence of LDL isolated from hypertriglyceridemic plasma. Oxidative modification during the long (48 hours) incubation period used in the previous study is likely to explain this discrepancy, as the TG content of the LDL particle is a major determinant of its proneness to oxidative modification.35 In the present study, incubation of HUVECs with TG-LDL was terminated at 4 hours, to differentiate the effects caused by TG enrichment from those of oxidation in culture.

In vitro VLDL activates secretion of PAI-1 from cultured HUVECs,12 13 14 36 with VLDL isolated from hypertriglyceridemic individuals having a greater effect on HUVECs than VLDL from normotriglyceridemic individuals.12 Recently, part of the molecular mechanism by which VLDL increases PAI-1 synthesis in endothelial cells has been clarified.21 A region of the PAI-1 promoter located adjacent to the binding site of the 5G allele-specific factor37 binds a VLDL-inducible transcription factor. In the present study, EMSA performed with HUVEC nuclear extracts and a probe containing the VLDL-responsive element has shown that TG-LDL induces the same transcription factor at both low and high concentrations. In contrast, only high concentrations of nLDL and uvLDL induce this factor. This suggests that high amounts of LDL TGs, whether provided by a high number of nLDL or uvLDL particles or a lower number of TG-enriched LDL particles, induce the same transcription factor as VLDL and that the TG content of the LDL particle is a determinant of PAI-1 expression in endothelial cells. Furthermore, it can be envisioned that apoB-containing TG-rich lipoprotein particles are merely vehicles facilitating the TG entry into the endothelial cell, as we have shown that similar effects can be obtained with TG emulsion particles that obviously do not use the LDL receptor for cellular uptake.

Low concentration of uvLDL (10 µg/mL) enhanced PAI-1 protein and mRNA expression in the HUVECs after an 18-hour incubation but did not activate the VLDL-inducible transcription factor. In contrast to uvLDL, low concentration of TG-LDL activated the VLDL-inducible transcription factor, suggesting that PAI-1 stimulation by low levels of oxidized LDL is mediated by a different mechanism than that of VLDL and TG-LDL. The alternating pattern in Figure 1Up could be a result of oxidized LDL at the low concentration and of TGs at the higher concentrations. Recent studies have shown that low levels of oxidized LDL (8 µg/mL) induce the release of the cytokine tumor necrosis factor-{alpha} (TNF{alpha}) in monocytes.38 However, no induction of TNF{alpha} was observed at high LDL concentrations. TNF{alpha} also induces PAI-1 in endothelial cells.39 Whether low concentrations of oxidized LDL can induce TNF{alpha} and/or other cytokines in endothelial cells, which then induce PAI-1 in an autocrine manner, must be examined in future studies.

The fairly heterogeneous PAI-1 responses to various LDL preparations observed in previous studies are likely to depend on differences in LDL composition and experimental conditions. Differences in cell passage, supplementation with growth factors, and incubation times belong to the latter category. As Lp(a) has been shown to increase PAI-1 synthesis and secretion by endothelial cells,19 the possibility also exists that LDL preparations have contained variable amounts of Lp(a) that enhance PAI-1 secretion. However, this was an unlikely situation in the present study because the density cuts used for isolating LDL (1.025 to 1.050 kg/L) would preclude significant contamination with Lp(a).

VLDL and modified LDL subspecies are likely to impair the fibrinolytic activity at the endothelial surface and promote fibrin deposition, which would favor thrombus formation in the event of plaque rupture. The molecular mechanisms explaining the activation of PAI-1 synthesis in endothelial cells by apoB-containing lipoproteins largely remain to be clarified.


*    Acknowledgments
 
This study was supported by grants from the Swedish Medical Research Council (8691), the Swedish Heart-Lung Foundation, the Marianne and Marcus Wallenberg Foundation, the European Commission (HIFMECH study; contract BMH4-CT96-0272), the King Gustaf V 80th Birthday Foundation, the King Gustaf V and Queen Victoria Foundation, the Petrus and Augusta Hedlund Foundation, and the Foundation for Old Servants. Dr Allison was supported by the Heart and Stroke Foundation of British Columbia and Yukon, Canada. We would like to acknowledge the excellent technical assistance of Barbro Burt and Kerstin Carlson.

Received September 17, 1998; accepted October 10, 1998.


*    References
up arrowTop
up arrowAbstract
up arrowIntroduction
up arrowMethods
up arrowResults
up arrowDiscussion
*References
 
1. Wiman B, Hamsten A. Impaired fibrinolysis and risk of thromboembolism. Prog Cardiovasc Dis. 1991;34:179–192.[Medline] [Order article via Infotrieve]

2. Hamsten A, de Faire U, Walldius G, Dahlen G, Szamosi A, Landou C, Blombäck M, Wiman B. Plasminogen activator inhibitor in plasma: risk factor for recurrent myocardial infarction. Lancet. 1987;2:3–9.[Medline] [Order article via Infotrieve]

3. Cortellaro M, Cofrancesco E, Boschetti C, Mussoni L, Donati MB, Cardillo M, Catalano M, Gabrielli L, Lombardi B, Specchia G, Tarazzi L, Tremoli E, Pozzoli E, Turri M. Increased fibrin turnover and high PAI-1 activity as predictors of ischemic events in atherosclerotic patients: a case-control study: the PLAT Group. Arterioscler Thromb. 1993;13:1412–1417.[Abstract/Free Full Text]

4. Malmberg K, Bavenholm P, Hamsten A. Clinical and biochemical factors associated with prognosis after myocardial infarction at a young age. J Am Coll Cardiol. 1994;24:592–599.[Abstract]

5. Juhan-Vague I, Pyke SDM, Alessi MC, Jespersen J, Haverkate F, Thompson SG on behalf of the ECAT Study Group. Fibrinolytic factors and the risk of myocardial infarction or sudden death in patients with angina pectoris. Circulation. 1996;94:2057–2063.[Abstract/Free Full Text]

6. Schneiderman J, Sawdey MS, Keeton MR, Bordin GM, Bernstein EF, Dilley RB, Loskutoff DJ. Increased type 1 plasminogen activator inhibitor gene expression in atherosclerotic human arteries. Proc Natl Acad Sci U S A. 1992;89:6998–7002.[Abstract/Free Full Text]

7. Lupu F, Bergonezelli G, Heim D, Cousin E, Genton C, Bachman F, Kruithof E. Localization and production of plasminogen activator inhibitor-1 in human healthy and atherosclerotic arteries. Arterioscler Thromb. 1993;13:1090–1100.[Abstract/Free Full Text]

8. Chomiki N, Henry M, Alessi MC, Anfosso F, Juhan-Vague I. Plasminogen activator inhibitor-1 expression in human liver and healthy or atherosclerotic vessel walls. Thromb Haemost. 1994;72:44–53.[Medline] [Order article via Infotrieve]

9. Loskutoff D. Regulation of PAI-1 gene expression. Fibrinolysis. 1991;5:197–206.

10. Hamsten A, Eriksson P. Fibrinolysis and atherosclerosis: an update. Fibrinolysis. 1994;8(suppl 1):253–262.

11. Hamsten A, Wiman B, de Faire U, Blombäck M. Increased plasma levels of a rapid inhibitor of tissue plasminogen activator in young survivors of myocardial infarction. N Engl J Med. 1985;313:1557–1563.[Abstract]

12. Stiko-Rahm A, Wiman B, Hamsten A, Nilsson J. Secretion of plasminogen activator inhibitor-1 from cultured human umbilical vein endothelial cells is induced by very low density lipoprotein. Arteriosclerosis. 1990;10:1067–1073.[Abstract/Free Full Text]

13. Mussoni L, Mannucci L, Sirtori M, Camera M, Maderna P, Sironi L, Tremoli E. Hypertriglyceridemia and regulation of fibrinolytic activity. Arterioscler Thromb. 1992;12:19–27.[Abstract/Free Full Text]

14. Kaneko T, Wada H, Wakita Y, Minamikawa K, Nakase T, Mori Y, Deguchi K, Shirakawa S. Enhanced tissue factor activity and plasminogen activator inhibitor-1 antigen in human umbilical vein endothelial cells incubated with lipoproteins. Blood Coagul Fibrinolysis. 1994;5:385–392.[Medline] [Order article via Infotrieve]

15. Sironi L, Mussoni L, Prati L, Baldassarre D, Camera M, Banfi C, Tremoli E. Plasminogen activator inhibitor type-1 synthesis and mRNA expression in HepG2 cells are regulated by VLDL. Arterioscler Thromb Vasc Biol. 1996;16:89–96.[Abstract/Free Full Text]

16. Latron Y, Chautan M, Anfosso F, Alessi MC, Nalbone G, Lafont H, Juhan-Vague I. Stimulating effect of oxidized low density lipoproteins on plasminogen activator inhibitor-1 synthesis by endothelial cells. Arterioscler Thromb. 1991;11:1821–1829.[Abstract/Free Full Text]

17. Kugiyama K, Sakamot T, Misumi I, Sugiyama S, Ohgushi M, Ogawa H, Horiguchi M, Yasue H. Transferable lipids in oxidized low-density lipoprotein stimulate plasminogen activator inhibitor-1 and inhibit tissue-type plasminogen activator release from endothelial cells. Circ Res. 1993;73:335–343.[Abstract/Free Full Text]

18. Tremoli E, Camera M, Maderna P, Sironi L, Prati L, Colli S, Piovella F, Bernini F, Corsini A, Mussoni L. Increased synthesis of plasminogen activator inhibitor-1 by cultured human endothelial cells exposed to native and modified LDLs: an LDL receptor-independent phenomenon. Arterioscler Thromb. 1993;13:338–346.[Abstract/Free Full Text]

19. Etingin O, Hajjar D, Hajjar K, Harpel P, Nachman R. Lipoprotein (a) regulates plasminogen activator inhibitor-1 expression in endothelial cells: a potential mechanism in thrombogenesis. J Biol Chem. 1991;266:2459–2465.[Abstract/Free Full Text]

20. Chautan M, Latron Y, Anfosso F, Alessi MC, Lafont H, Juhan-Vague I, Nalbone G. Phosphatidylinositol turnover during stimulation of plasminogen activator inhibitor-1 secretion induced by oxidized low density lipoproteins in human endothelial cells. J Lipid Res. 1993;34:101–110.[Abstract]

21. Eriksson P, Nilsson L, Karpe F, Hamsten A. Very-low-density lipoprotein response element in the promoter region of the human plasminogen activator inhibitor-1 gene implicated in the impaired fibrinolysis of hypertriglyceridemia. Arterioscler Thromb Vasc Biol. 1998;18:20–26.[Abstract/Free Full Text]

22. Karpe F, Steiner G, Olivecrona T, Carlson LA, Hamsten A. Metabolism of triglyceride-rich lipoproteins during alimentary lipemia. J Clin Invest. 1993;91:748–758.

23. Redgrave T, Carlson L-A. Changes in plasma very low density lipoprotein content, composition and size after a fatty meal in normo- and hypertriglyceridemic man. J Lipid Res. 1979;20:217–229.[Abstract]

24. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem. 1951;193:265–275.[Free Full Text]

25. Dousset N, Negre-Salvayre A, Lopez M, Salvayre R, Douste-Blazy L. Ultraviolet-treated lipoproteins as a model system for the study of the biological effects of lipid peroxides on cultured cell. I. Chemical modifications of ultraviolet-treated low-density lipoproteins. Biochim Biophys Acta. 1990;1045:219–223.[Medline] [Order article via Infotrieve]

26. McKeone B, Patsch J, Pownall H. Plasma triglycerides determine low density lipoprotein composition, physical properties and cell-specific binding in cultured cells. J Clin Invest. 1993;91:1926–1933.

27. Nobel R. Electrophoretic separation of plasma lipoproteins in agarose gel. J Lipid Res. 1968;9:693–700.[Abstract]

28. Karpe F, Hamsten A. Determination of apolipoproteins B-48 and B-100 in triglyceride-rich lipoproteins by analytical SDS-PAGE. J Lipid Res. 1994;35:1311–1317.[Abstract]

29. Alksnis M, Barkhem T, Strömstedt P-E, Ahola H, Kutoh E, Gustafsson J-Å, Poellinger L, Nilsson S. High level expression of functional full length and truncated glucocorticoid receptor in Chinese hamster ovary cells. J Biol Chem. 1991;266:10078–10085.[Abstract/Free Full Text]

30. Kalb VF, Bernlohr RW. A new spectrophotometric assay for protein in cell extracts. Anal Biochem. 1977;82:362–371.[Medline] [Order article via Infotrieve]

31. Dawson SJ, Wiman B, Hamsten A, Green F, Humphries S, Henney AM. The two allele sequences of a common polymorphism in the promoter of the plasminogen activator inhibitor-1 (PAI-1) gene respond differently to interleukin-1 in HepG2 cells. J Biol Chem. 1993;268:10739–10745.[Abstract/Free Full Text]

32. Eriksson P, Wrange Ö. Protein-protein contacts in the glucocorticoid receptor homodimer influence its DNA binding properties. J Biol Chem. 1990;265:3535–3542.[Abstract/Free Full Text]

33. Deckelbaum R, Granot E, Oschry Y, Rose L, Eisenberg S. Plasma triglyceride determines structure-composition in low and high density lipoproteins. Arteriosclerosis. 1984;4:225–231.[Abstract/Free Full Text]

34. Albers J, Tollefson J, Chen C-H, Steinmetz A. Isolation and characterisation of human lipid transfer proteins. Arteriosclerosis. 1984;4:49–58.[Abstract/Free Full Text]

35. Regnstrom J, Nilsson J, Tornvall P, Landou C, Hamsten A. Susceptibility to low-density lipoprotein oxidation and coronary atherosclerosis in man. Lancet. 1992;339:1183–1186.[Medline] [Order article via Infotrieve]

36. Li X-N, Grenett HE, Benza RL, Demissie S, Brown SL, Tabengwa EM, Gianturco SH, Bradley WA, Fless GM, Booyse FM. Genotype-specific transcriptional regulation of PAI-1 expression by hypertriglyceridemic VLDL and Lp(a) in cultured human endothelial cells. Arterioscler Thromb Vasc Biol. 1997;17:3215–3223.[Abstract/Free Full Text]

37. Eriksson P, Kallin B, van `t Hooft FM, Bavenholm P, Hamsten A. Allele-specific increase in basal transcription of the plasminogen-activator inhibitor 1 gene is associated with myocardial infarction. Proc Natl Acad Sci U S A. 1995;92:1851–1855.[Abstract/Free Full Text]

38. Jovinge S, Ares M, Kallin B, Nilsson J. Human monocyte/macrophages release tumor necrosis factor alpha in response to oxidized low density lipoprotein. Arterioscler Thromb Vasc Biol. 1996;16:1573–1579.[Abstract/Free Full Text]

39. Schleef RR, Bevilacqua MP, Sawdey M, Gimbrone MA Jr, Loskutoff DJ. Cytokine activation of vascular endothelium: effects on tissue-type plasminogen activator and type 1 plasminogen activator inhibitor. J Biol Chem. 1988;263:5797–5803.[Abstract/Free Full Text]




This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. P. Corsetti, D. Ryan, A. J. Moss, D. L. Rainwater, W. Zareba, and C. E. Sparks
Plasminogen Activator Inhibitor-1 Polymorphism (4G/5G) Predicts Recurrence in Nonhyperlipidemic Postinfarction Patients
Arterioscler Thromb Vasc Biol, March 1, 2008; 28(3): 548 - 554.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
W. Song, J. L. Barth, Y. Yu, K. Lu, A. Dashti, Y. Huang, C. K. Gittinger, W. S. Argraves, and T. J. Lyons
Effects of Oxidized and Glycated LDL on Gene Expression in Human Retinal Capillary Pericytes
Invest. Ophthalmol. Vis. Sci., August 1, 2005; 46(8): 2974 - 2982.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
C. Whatling, H. Bjork, S. Gredmark, A. Hamsten, and P. Eriksson
Effect of macrophage differentiation and exposure to mildly oxidized LDL on the proteolytic repertoire of THP-1 monocytes
J. Lipid Res., September 1, 2004; 45(9): 1768 - 1776.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
T. J. Lyons, A. J. Jenkins, D. Zheng, D. T. Lackland, D. McGee, W. T. Garvey, and R. L. Klein
Diabetic Retinopathy and Serum Lipoprotein Subclasses in the DCCT/EDIC Cohort
Invest. Ophthalmol. Vis. Sci., March 1, 2004; 45(3): 910 - 918.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
B. E. Sobel, D. J. Taatjes, and D. J. Schneider
Intramural Plasminogen Activator Inhibitor Type-1 and Coronary Atherosclerosis
Arterioscler Thromb Vasc Biol, November 1, 2003; 23(11): 1979 - 1989.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
M.-C. Alessi, D. Bastelica, A. Mavri, P. Morange, B. Berthet, M. Grino, and I. Juhan-Vague
Plasma PAI-1 Levels Are More Strongly Related to Liver Steatosis Than to Adipose Tissue Accumulation
Arterioscler Thromb Vasc Biol, July 1, 2003; 23(7): 1262 - 1268.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Konstantinides, K. Schafer, and D. J. Loskutoff
Do PAI-1 and Vitronectin Promote or Inhibit Neointima Formation?: The Exact Role of the Fibrinolytic System in Vascular Remodeling Remains Uncertain
Arterioscler Thromb Vasc Biol, December 1, 2002; 22(12): 1943 - 1945.
[Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. Ren, H. Lee, L. Hu, L. Lu, and G. X. Shen
Impact of Diabetes-Associated Lipoproteins on Generation of Fibrinolytic Regulators from Vascular Endothelial Cells
J. Clin. Endocrinol. Metab., January 1, 2002; 87(1): 286 - 291.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
S. Jormsjo, C. Whatling, D. H. Walter, A. M. Zeiher, A. Hamsten, and P. Eriksson
Allele-Specific Regulation of Matrix Metalloproteinase-7 Promoter Activity Is Associated With Coronary Artery Luminal Dimensions Among Hypercholesterolemic Patients
Arterioscler Thromb Vasc Biol, November 1, 2001; 21(11): 1834 - 1839.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
A. MERTENS and P. HOLVOET
Oxidized LDL and HDL: antagonists in atherothrombosis
FASEB J, October 1, 2001; 15(12): 2073 - 2084.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
V. A. Ploplis, I. Cornelissen, M. J. Sandoval-Cooper, L. Weeks, F. A. Noria, and F. J. Castellino
Remodeling of the Vessel Wall after Copper-Induced Injury Is Highly Attenuated in Mice with a Total Deficiency of Plasminogen Activator Inhibitor-1
Am. J. Pathol., January 1, 2001; 158(1): 107 - 117.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
J D Pearson
Normal endothelial cell function
Lupus, March 1, 2000; 9(3): 183 - 188.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Allison, B. A.
Right arrow Articles by Eriksson, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Allison, B. A.
Right arrow Articles by Eriksson, P.
Related Collections
Right arrow Physiological and pathological control of gene expression
Right arrow Coagulation and fibronolysis
Right arrow Lipid and lipoprotein metabolism