© 1999 American Heart Association, Inc.
Atherosclerosis and Lipoproteins |
Effects of a Frequent Apolipoprotein E Isoform, ApoE4Freiburg (Leu28
Pro), on Lipoproteins and the Prevalence of Coronary Artery Disease in Whites
From the Institut für Klinische Chemie und Pathobiochemie, Universität Magdeburg (M.O., J.D., A.A., C.L.), Institut für Klinische Chemie und Laboratoriumsmedizin, Universität Münster (W.W., H.F., G.A.), Abteilung für Endokrinologie und Stoffwechsel, Universität Marburg (A.S.), and Abteilung für Klinische Chemie, Universität Freiburg, Germany (M.O., M.N., H.W., C.L.); Gladstone Institute of Cardiovascular Disease, San Francisco (M.O., K.H.W., R.W.M.), Cardiovascular Research Institute (M.O., K.H.W., R.W.M.), and Departments of Medicine (R.W.M.) and Pathology (K.H.W., R.W.M.), University of California, San Francisco. Current address for Wei Wang Laboratory of Biochemical Genetics and Metabolism, The Rockefeller University, New York, NY 10021-6399.
Correspondence to Dr Matthias Orth, Universitätsklinikum Benjamin Franklin, Freie Universität, Institut für Klinische Chemie und Pathobiochemie (WE 13), Hindenburgdamm 30, D-12220 Berlin, Germany. E-mail orth{at}ukbf.fu-berlin.de
 |
Abstract |
|---|
 Top Abstract IntroductionMethodsResultsDiscussionReferences |
|---|
Abstract—Different isoforms of apoE modulate the concentrations of plasma lipoproteins and the risk for atherosclerosis. A novel apoE isoform, apoE4Freiburg, was detected in plasma by isoelectric focusing because its isoelectric point is slightly more acidic than that of apoE4. ApoE4Freiburg results from a base exchange in the APOE4 gene that causes the replacement of a leucine by a proline at position 28. Analysis of the allelic frequencies in whites in southwestern Germany revealed that this isoform is frequent among control subjects (10:4264 alleles) and is even more frequent in patients with coronary artery disease (21:2874 alleles; P=0.004; adjusted odds ratio, 3.09; 95% confidence interval, 1.20 to 7.97). ApoE4Freiburg affects serum lipoproteins by lowering cholesterol, apoB, and apoA-I compared with apoE4 (P<0.05). Our 4 apoE4Freiburg homozygotes suffered from various phenotypes of hyperlipoproteinemia (types IIa, IIb, IV, and V). In vitro binding studies excluded a binding defect of apoE4Freiburg, and in vivo studies excluded an abnormal accumulation of chylomicron remnants. ApoE4Freiburg and apoE4 accumulated to a similar extent in triglyceride-rich lipoproteins. HDLs, however, contained about 40% less apoE4Freiburg than apoE4. In conclusion, our data indicate that apoE4Freiburg exerts its possible atherogenic properties by affecting the metabolism of triglyceride-rich lipoproteins and HDL.
Key Words: apoE polymorphism • mutation • atherosclerosis • isoelectric focusing
|
Introduction |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Apolipoprotein E is a constituent of all human lipoproteins except LDL1 and occurs in 3 common isoforms (E2, E3, and E4) that are encoded by 3 codominant alleles (
2,
3, and 4) of the APOE gene.2 ApoE
plays a pivotal role in triglyceride and
cholesterol metabolism by mediating the
sequestration and removal of remnants of triglyceride-rich
lipoproteins via the heparan sulfate proteoglycan-LDL receptor-related
protein (LRP) and LDL receptor pathways.3 4 5 The apoE
isoforms have different affinities for these
pathways.3 6 7 8 The APOE alleles modulate
the risk for coronary artery disease
(CAD),9 10 cerebral
atherosclerosis,11 and
Alzheimer's disease.12 13 In addition to the
common apoE isoforms, several rare apoE variants have been identified
in hyperlipidemic patients and their kindreds. Most of
the variants are characterized by replacements of
one14 15 16 17 18 19 20 21 22 or more23 24 charged amino acids by
uncharged amino acids or vice versa. Some replacements in the LDL
receptor-binding region (positions 136 to 150) cause defective binding
to the LDL receptor and are associated with the recessive form of type
III hyperlipoproteinemia, and some replacements
of basic amino acids with neutral or acidic amino acids, leading to
defective heparan sulfate proteoglycan (HSPG) binding, were associated
with the dominant form of type III
hyperlipoproteinemia.3 18 Variants
with a basic amino acid at amino acid residue 3 display increased
binding to LDL receptors and were associated with increased LDL
cholesterol.25 26 The total number of patients
with mutant APOE alleles identified by studying
hyperlipidemic patients and their families, however, is
very low. The common isoforms of apoE and most of the known rare variants of apoE have been detected on the basis of different isoelectric points caused by replacements of charged amino acids by uncharged species (or vice versa). Replacements involving only uncharged amino acids should result either in no or in only small changes of the isoelectric point of the newly formed isoproteins. (The total charge of a protein is determined by the charges of the side chains of its amino acids and, to a lesser extent, by the 3-dimensional arrangement of the side chains.) These small changes of the isoelectric point are difficult to detect by isoelectric focusing in polyacrylamide gels and subsequent immunoblotting. Therefore, we developed a more sensitive protocol for these small charge differences using isoelectric focusing in agarose gels and immunofixation, combining specificity with improved resolution.27 Using this protocol, we detected a frequent novel isoform, apoE4Freiburg, that migrates to a slightly more acidic position than apoE4 after isoelectric focusing.
The aims of this study were to elucidate the underlying molecular basis of the apoE4Freiburg isoform, to compare its allelic frequencies among healthy control subjects and CAD patients in southwestern Germany, and to study its effects on fasting and postprandial plasma lipoprotein and apolipoprotein concentrations, receptor-binding activity, and accumulation in the various lipoprotein classes.
|
Methods |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The protocol for all studies involving human subjects was approved by the local ethics committee, and all participants gave written informed consent for their participation in this study.
Control Subjects and Patients of the Epidemiological and the
Family Studies
Subjects for the biochemical studies, the analysis of
allelic frequencies, the analysis of the effects of
4Freiburg and other APOE
alleles on plasma lipids and apolipoproteins, and cosegregation
analysis came from 3 study groups (control subject group,
patient group, and family study group). All subjects were whites
residing in the region surrounding Freiburg in southwestern Germany.
The control group consisted of 1589 healthy blood donors (1180 men, 409
women), who were recruited in 60 different towns, and 543 healthy
female employees of a large factory. All control subjects had been
screened by physicians for the absence of clinically overt CAD. The
patient group originated from the same geographical area and consisted
of 1437 patients (548 men, 889 women) from a cardiological hospital and
from the Cardiology Department of the Freiburg
University Hospital. All patients had a clinical diagnosis of CAD or
had survived a myocardial infarction. In addition, 991 had undergone
coronary angiography, and of these, 794 patients (80%)
displayed 1 or more stenoses occluding >50% of the vessel
lumen. The control subjects were younger than the patients (mean±SD:
39.3±12.4 versus 56.6±11.8 years). The family study group consisted
of 7 healthy apoE4Freiburg blood donors and 56 of
their relatives. The 63 subjects in this group were studied to
determine heritability and cosegregation of phenotype and
genotype of the new apoE isoform. These relatives were not
included in the analysis of allelic frequencies.
Blood was drawn by a standard procedure. Cholesterol, apoB, apoA-I, and triglycerides were measured in serum by enzymatic and turbidimetric tests (Boehringer Mannheim), as described.28 Genomic DNA was isolated from blood leukocytes of subjects of the family study by the alkaline lysis method.29 At the time of the blood sampling, the patients, the relatives of the blood donors in the family study, and the factory workers had been fasting overnight. Blood donors were in an undefined postprandial state and were therefore excluded from analysis of triglycerides. All study subjects were included in the statistical analysis of serum cholesterol, apoB, and apoA-I because these variables are not altered postprandially.30 31 32
Isoelectric Focusing of ApoE
In all subjects, phenotyping of apoE by isoelectric focusing was
performed as described.27 33 Briefly, 12 µL of a
delipidation solution (76 mmol/L urea [Merck], 19.2 mmol/L
DTT [Sigma], 10 mmol/L Tris [Merck], and 23% [vol/vol]
Tween 20 [Sigma]) was added to 50 µL of serum. After 30 minutes,
the samples were applied to a horizontal 2% agarose gel containing 3
mol/L urea and 4% (vol/vol) of an ampholyte mixture (pH 3 to 10 and pH
5 to 6, 1:1; Serva) and subjected to isoelectric focusing. After
focusing, the apoE isoforms underwent immunofixation by incubating the
gel with goat antiserum against apoE (Greiner) and staining the
immunofixed bands with Coomassie blue.
APOE Gene Sequencing
Genomic DNA was amplified by PCR for sequencing. Primers (21 to
24 bases long) were placed approximately 30 bases upstream of the 5'
end of the gene segments to be sequenced. The PCR reaction was
performed in 100 µL of PCR buffer (Beckman) with 10% DMSO (Sigma),
containing 0.5 to 1 µg genomic DNA, and final concentrations of
200 µmol/L dNTPs (Pharmacia) and 0.1 µmol/L of each
primer. Initial denaturation at 100°C for 10 minutes was followed by
the addition of 2 to 5 U Taq polymerase (Beckman) and 30
incubation cycles of 96°C (90 s), 60°C (1 minute), and 70°C (1
minute). For the sequencing of the G/C-rich exon 4 of apoE, 75% of the
dGTP content in the reaction mix was replaced with 7-deaza-dGTP
(Pharmacia), and temperature cycles were changed to 96°C (80 s),
55°C (1 minute), and 71°C (70 s) and repeated for 40 cycles. The
product was purified by electrophoresis in 2% NuSieve agarose
(FMC); DNA of the expected size was cut out of the gel and
electroeluted in 0.5x Tris-acetate/EDTA for 75 minutes at 200 V. The
DNA was desalted and concentrated to 70 µL by ultrafiltration in
Centricon X-100 tubes (Amicon).
Single strands for sequencing were produced by the Gyllensten and Erlich method34 using the same scheme as above. Primer concentration was 0.1 µmol/L; a second primer was not used. Single-strand templates containing exon 4 were synthesized with 7-deaza-dGTP at the same concentration used for double-strand production. Sequencing was done from single-strand templates using T7 polymerase (Pharmacia) and 35S-ddNTP (Amersham) following the supplier's instructions. Reaction products were run on a sequencing gel, dried, and visualized by autoradiography.
Genotyping for 4Freiburg by
Restriction Fragment Polymorphism
Rapid genotyping was performed by restriction digest of
PCR-amplified fragment of genomic DNA (primer 1,
TGACCCGACCTTGAACTTGTTCCA; primer 2, GGTATAGCCGCCCACCAGGAGG) with
MspI (Boehringer Mannheim) and subsequent fragment
length determination in a gel containing 3% NuSieve agarose and 1%
standard agarose. The gel was stained with ethidium bromide, and the
DNA visualized under UV light.
Receptor-Binding Studies
Human apoE4Freiburg, apoE3, and apoE4 were
isolated from d<1.006 kg/L lipoproteins of homozygotes, as described
previously,35 and checked for purity by SDS-PAGE. Human
LDL were isolated from plasma of normal fasting subjects by sequential
ultracentrifugation36 and radiolabeled by
the iodine monochloride method (NEN).37 The various
isoforms of apoE and dimyristoylphosphatidylcholine (DMPC, Sigma) were
mixed at a ratio of 1:3.75 (wt/wt, protein:DMPC), and complexes were
isolated by density gradient
ultracentrifugation.38 All of the
apoE · DMPC complexes contained apoE as the only protein moiety.
Normal human fibroblasts were plated at 3.5x104
cells/dish 1 week before the experiment. On day 5, the cells were
switched to medium (DMEM, Life Technologies) containing 10% human
lipoprotein-deficient serum. On day 7, the cells were incubated at
4°C in medium containing 2.0 µg/mL 125I-LDL
and increasing concentrations of apoE · DMPC complexes. The
competitive binding of these complexes against human
125I-LDL was determined.38
Distribution of ApoE with Different Lipoproteins
Plasma from fasting apoE4/apoE4Freiburg
heterozygotes was separated by gel filtration (Sepharose 6B-CL,
Pharmacia) as described.28 39 Gel filtration was used
instead of ultracentrifugation to avoid the high
centrifugal forces that strip apolipoproteins from lipoproteins during
separation.40 Fractions containing VLDL, IDL, and HDL
peaks were identified by measuring cholesterol and
triglycerides with enzymatic tests (Boehringer
Mannheim) and apoE with turbidimetry,41 using goat
antiserum against apoE (Greiner). Fractions obtained from the VLDL,
IDL, and HDL peaks were dialyzed to eliminate buffer constituents,
concentrated in vacuo (if necessary), separated by isoelectric
focusing, and immunofixed. The ratios of the different apoE isoforms in
VLDL, IDL, and HDL were calculated after densitometry of the
Coomassie-stained gels (SigmaGel, SPSS).
Effects of ApoE4Freiburg on Postprandial
Metabolism
The postprandial clearance of lipoproteins after the ingestion
of a standard fatty meal containing retinyl palmitate28
was assessed in 3 4Freiburg homozygotes. Blood samples
were obtained every other hour for 10 hours after the fatty meal.
Lipoproteins were separated by ultracentrifugation and
by gel filtration. Retinyl esters in chylomicrons and chylomicron
remnants were measured by a fluorometric assay.42
Statistical Analysis
Differences in the allele frequency distribution were tested
with Fischer's exact test. Statistical comparisons of the means
between groups were performed by t test. Multigroup
comparisons were tested by analysis of variance and were
followed by the Scheffé test if the F statistic was
significant. Odds ratios (ORs) as estimators of relative risk, together
with their 95% approximate confidence intervals (CIs), were calculated
to assess the association with CAD and the presence of
4Freiburg in relation to the
non-4Freiburg genotype. ApoA-I
and triglyceride concentrations of different
genotypes were adjusted with linear regression models including
sex and age (SPSS 7.5 for Windows, SPSS). For the postprandial studies,
the area under the curve of triglycerides was calculated by
the trapezoidal rule. All testing was 2-tailed with 0.05 as the level
of significance. Subjects with rare apoE mutations (ie, 2 with apoE1
and 1 with apoE6, 0.1% of all subjects) were excluded from
analysis. Because the distribution of triglycerides
was highly skewed (ie, a skewness of 4.36 in our sample of 2036
subjects), subjects with fasting triglycerides >7.874
mmol/L (n=12) were excluded from the analysis of
triglycerides when F statistics were used
(skewness after exclusion, 1.668; n=2024).
|
Results |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
Mobility of ApoE4Freiburg by Isoelectric Focusing
By isoelectric focusing of serum, the apoE4Freiburg isoform was discovered in combination with the common apoE isoforms E3, E4, and E2 (Figure 1A
) and as the only apoE isoform (Figure 1B). It is evident from these gels that
apoE4Freiburg is easily detected in serum of
apoE4/apoE4Freiburg heterozygotes because it
focuses in a slightly more acidic position than apoE4, and a pronounced
double band of similar intensity is easily discernible (Figure 1A). To detect apoE4Freiburg in
apoE2/apoE4Freiburg heterozygotes,
apoE3/apoE4Freiburg heterozygotes, or
homozygotes, samples containing apoE4 were run in an adjacent lane to
detect the slight acidic shift of apoE4Freiburg
versus apoE4.
|
DNA Sequencing and Segregation Analysis
The molecular basis of this isoform was identified by sequencing
all exons, 80 bases of 5' sequence, and the consensus splice donor and
acceptor sites of the APOE gene of 4 independent
4Freiburg carriers. A single mutation
was detected in all carriers studied. This mutation, a T-to-C mutation
in position 3100 of the APOE4 gene (GenBank accession
M10065), changes CTG of codon 28, coding for leucine, to CCG, coding
for proline (Figure 2).
|
The DNA mutation underlying the Leu
Pro replacement leads to the
formation of an MspI restriction site (C CGG). In the
absence of the mutation, the 271-bp fragment of genomic PCR-amplified
DNA is cleaved into 2 fragments of 191 and 80 bp. In the presence of
the mutation, the 191-bp fragment is cleaved into fragments of 136 and
55 bp (Figure 2
).
Heritability and cosegregation of genotype and
phenotype were studied in 7 study participants (blood donors)
and 56 of their relatives. Genotype (ie, presence of a specific
MspI restriction site of PCR-amplified genomic DNA) and
phenotype (ie, apoE4Freiburg band in
isoelectric focusing) were congruent in all families studied indicating
cosegregation of phenotype and genotype. The CCG
mutation was only observed on 4 chromosomes and not on
2 or 3 chromosomes. Screening of the 56
relatives (30 men, 26 women) identified 33 clinically healthy
heterozygous and homozygous carriers of
4Freiburg. There were 2
4Freiburg homozygotes, 3 heterozygotes
with 2, 21 with 3, and 7 with
4. Both homozygotes (subjects 2 and 3) were
hyperlipidemic but did not suffer from CAD (Table 1). Screening for common apoE
phenotypes revealed 1 subject with apoE2/E3, 16 subjects with
apoE3/E3, and 6 subjects with apoE3/E4 among these relatives.
|
Allele Frequencies of ApoE4Freiburg
The allelic frequencies of
4Freiburg were studied by phenotyping
2132 clinically healthy subjects (control group) and 1437 CAD patients
(patient group). The absolute and relative frequencies of the common
and apoE4Freiburg phenotypes are given in
Table 2. A total of 30 carriers of
4Freiburg were detected in these 3569
subjects. One CAD patient was homozygous and 29 subjects were
heterozygous for 4Freiburg. The
frequencies of the 4Freiburg allele
were 1:426 (10:4264 alleles) in the control group (with similar
frequencies among blood donors and factory workers, data not shown) and
significantly more common, 1:137 (21:2874) in the CAD patient group
(P=0.004). The age- and sex-adjusted OR for CAD was 3.09
(95% CI, 1.20 to 7.97) in carriers of
4Freiburg relative to noncarriers. The
most common heterozygous combination of
apoE4Freiburg, the combination with apoE3, was
also more frequent among patients than among control subjects (1.1%,
16 of 1437 versus 0.2%, 4 of 2132; P=0.0001). Restriction
of the analysis to patients in whom CAD was diagnosed by
angiography revealed an allelic frequency similar to that of all CAD
patients (1.7%, 1:61, 13 of 794).
|
The allelic frequencies of the common APOE alleles
(Table 2) in our white population were very similar to those
reported previously.9 The 4 allele
frequency was 0.1326 in patients and 0.1266 in control subjects
(P=0.320) (Table 2).
Binding to the LDL Receptor
ApoE4Freiburg protein was isolated from
4Freiburg homozygotes, complexed with
DMPC, and used for competition experiments with
125I-LDL. The in vitro binding properties of the
apoE4Freiburg · DMPC complexes were
compared with those of complexes containing apoE3 or apoE4. This
analysis revealed similar dose-response curves for these apoE
isoforms and excluded a binding defect of
apoE4Freiburg · DMPC complexes with LDL
receptors.
Effects of ApoE4Freiburg on Lipids and
Apolipoproteins
Three homozygotes from 2 unrelated families were identified in
this study, and a fourth homozygote was identified among the patients
of our lipid clinics. All homozygotes had various types of
hyperlipoproteinemia (type IIa, type IIb, type
IV, and type V) and 2, both with
hypertriglyceridemia, had CAD (Table 1).
The phenotypes of the homozygotes led us to study the effects
of the common APOE alleles (2, 3, and
4) and of 4Freiburg on
lipoprotein concentrations in all subjects. The effects of the
different common APOE alleles were analyzed by
comparing the wild-type apoE3/E3 with apoE2/E2, apoE4/E4, and apoE3/E4
(Figure 3) because these
phenotypes modulate concentrations of lipids and
apolipoproteins.43 44 45 The effects of
apoE4Freiburg on lipids and apolipoproteins were
studied in 2 steps. First, all carriers with 1 or 2 alleles of
4Freiburg (n=63) were compared with all
noncarriers of 4Freiburg (n=3562) with
the aim of including as many apoE4Freiburg
individuals as possible (Figure 4). The
caveat of this analysis is that the results are easily
confounded by known (opposite) effects of the other apoE isoforms.
Second, only the most frequent combinations of
apoE4Freiburg (ie, the combinations
apoE3/E4Freiburg and
apoE4/E4Freiburg) were compared with apoE3/E4 and
apoE4/E4, respectively. Although fewer subjects were analyzed
than in the first analysis, this analysis allows the
effects of 4Freiburg to be clearly
differentiated from those of 4 (Figure 3 and Table 3).
|
|
|
Analysis of cholesterol and apoB
concentrations revealed, as expected, that 2 and
4 had opposite effects on lipid and apolipoprotein
concentrations. Cholesterol and apoB were lower in apoE2/E2
and higher in apoE4/E4 and in apoE3/E4 than in apoE3/E3 (Figure 3A and 3B). No effects of the
4Freiburg allele on
cholesterol and apoB were detected when all subjects were
analyzed (Figure 4A and 4B). When the opposite effects
of the 2 and 4 alleles were excluded by
the direct comparison of apoE3/E4Freiburg with
apoE3/E4, however, this analysis revealed that
apoE3/E4Freiburg subjects had a 0.524 mmol/L
lower cholesterol (Figure 3A), and the comparison of
apoE4/E4Freiburg with apoE4/E4 revealed that
apoE4/apoE4Freiburg heterozygotes had 20.7 mg/dL
lower apoB (Figure 3B). ApoB was not significantly different
between apoE3/E4Freiburg and apoE3/E4 (Figure 3B), and cholesterol was not significantly different
between apoE4/E4Freiburg and apoE4/E4 (Figure 3A; for CIs, see Table 3).
ApoA-I concentrations were lower in apoE4/E4 and in apoE3/E4 than in
apoE3/E3, but no differences were observed in apoE2/E2 (Figure 3C). The 4Freiburg allele
had a profound effect on apoA-I concentration even when all subjects
were analyzed (Figure 4C). Mean apoA-I concentrations
were 17.2 mg/dL lower in carriers of
4Freiburg than in noncarriers (95% CI,
10.2 to 24.0 mg/dL; P=0.000; mean in noncarriers, 153.4
mg/dL); this relationship also held true after adjustment for age and
sex (21.1 mg/dL lower in subjects with the
apoE4Freiburg isoform; P=0.003).
ApoA-I was 15.9 mg/dL lower in
apoE3/E4Freiburg compared with apoE3/E4 but did
not reach statistical significance between
apoE4/E4Freiburg and apoE4/E4 (Figure 3C
and Table 3).
The analysis of the effects of different APOE
alleles on fasting triglycerides was restricted to the
study subjects in whom the blood samples were obtained under fasting
conditions (ie, all patients, all control subjects from the
occupational health clinics, and all participants of the family study,
n=2036). Fasting triglycerides were <7.874 mmol/L in
99.4% of all subjects, but the variability of triglyceride
concentrations (as indicated by standard deviation and skewness) in all
different apoE phenotypes studied exceeded by far the
variability of cholesterol, apoB, and apoA-I concentrations
(Figures 3 and 4). This higher variability was an obstacle for
the statistical analysis. Nevertheless,
triglycerides were higher in apoE2/E2, apoE4/E4, and
apoE3/E4 than in apoE3/E3. Although the number of subjects examined in
our study was quite large, the only difference that reached statistical
significance was between apoE3/E3 and apoE2/E2 (Figure 3D). When
the effects of the apoE4Freiburg isoform on
triglycerides were studied in all carriers of
4Freiburg, triglyceride
concentrations were higher by 0.402 mmol/L in subjects with
apoE4Freiburg (n=56) than in noncarriers (n=1968)
(95% CI, 0.032 to 0.837 mmol/L; P=0.035; mean in
apoE4Freiburg, 2.359 mmol/L) (Figure 4D), and this difference was still present after adjustment
for sex (P=0.006). Differences between apoE4 and
apoE4Freiburg did not reach statistical
significance in the comparison of certain phenotypes.
Triglycerides were 0.187 mmol/L higher in
apoE3/E4Freiburg(n=39) than in apoE3/E4 (n=419)
and 0.462 mmol/L higher in apoE4/E4Freiburg
(n=8) than in apoE4/E4 (n=31) (Figure 3D; for CIs, see Table 3).
In summary, the subjects with apoE4Freiburg had significantly lower cholesterol (versus E4/E4), lower apoB (versus E3/E4), and lower apoA-I, and, possibly, higher fasting triglycerides than those with apoE4.
Distribution of ApoE4Freiburg and ApoE4 with
Different Lipoproteins
Analysis by gel filtration of lipoproteins in 2
apoE4/apoE4Freiburg subjects on 2 independent
occasions (n=4) revealed that most of the plasma apoE is present in
VLDL and IDL and only very little is in HDL (Figure 5). To test whether the apoE isoforms
differ in their accumulation in VLDL and HDL, as has been observed for
apoE3 and apoE4,39 43 the amounts of apoE4 and
apoE4Freiburg present in VLDL, IDL, and HDL
were measured in these apoE4/apoE4Freiburg
heterozygotes. Both isoforms showed a very similar accumulation in VLDL
(ratio apoE4Freiburg to apoE4, 0.99) and in IDL
(ratio, 0.95), but much less apoE4Freiburg than
apoE4 (ratio, 0.67) accumulated in HDL (Figure 5).
|
), triglycerides (
), and
apoE (*) among different lipoproteins. Plasma (5 mL) from a fasting
male apoE4/E4Freiburg heterozygote was
chromatographed on a Sepharose 6B-CL column, and the
concentrations of cholesterol, triglycerides,
and apoE were determined in each eluate fraction. Aliquots of VLDL,
IDL, and HDL were subjected to isoelectric focusing and immunofixation.
The inset shows the relative amounts of apoE4 and
apoE4Freiburg in different lipoproteins.
Effects of ApoE4Freiburg on Postprandial
Lipoproteins
We also analyzed the effects of the
apoE4Freiburg isoform on postprandial
lipoproteins because the epidemiological data revealed several effects
of the apoE4Freiburg isoform on fasting
lipoproteins and because carriers of many rare apoE variants display a
delayed clearance of postprandial lipoproteins.44 A
standard fatty meal containing retinyl palmitate was given to 3
4Freiburg homozygotes (for clinical
characteristics, see subjects 1, 2, and 3 in Table 1), and the
different lipoprotein classes were monitored for 10 hours. These data
were compared with those from 2 control groups of normolipemic
subjects, 1 group of 29 subjects (with the apoE phenotypes
E2/E3, n=8; E3/E3, n=8; E3/E4, n=7; E4/4, n=6) designated
non-apoE2/E2, and 8 subjects with the phenotype
E2/E2.28 Although all 3
4Freiburg homozygotes displayed
different forms of hyperlipoproteinemia in the
fasting state, their postprandial increases of chylomicrons,
chylomicrons remnants, and VLDL were moderate and did not differ from
those obtained in non-apoE2/E2 normolipemic control subjects (Figure 6A through 6C).
|
We next examined in detail the composition of HDL after a fatty meal.
Postprandial concentrations of HDL triglycerides, an
indicator for both high cholesteryl ester transfer protein activity and
the presence of high concentrations of triglyceride-rich
lipoproteins,45 increased in response to the postprandial
lipoprotein surge in all 3 groups (Figure 6D). There were,
however, differences between the groups. The total
triglyceride enrichment, as measured by the area under the
curve of HDL triglycerides, tended to be lowest in
(hyperlipidemic)
4Freiburg homozygotes, followed by
normolipemic non-apoE2/E2 subjects, and was significantly higher in
normolipemic 2 homozygotes (0.834, 1.129, 1.390
mmol · h-1 ·
L-1, respectively; P=0.038 for
4Freiburg/4Freiburg
versus 2/2). The ratio of apoA-I to HDL
cholesterol (Figure 6F) and the molar ratio of HDL
cholesterol to phospholipids
(4Freiburg/4Freiburg,
0.86±0.05; non-apoE2/E2, 0.94±0.02; 2/2, 0.92±0.04)
were similar among these 3 groups. Both ratios did not change
postprandially in homozygous 4Freiburg
patients or in normolipemic control subjects. In summary, these studies
revealed a normal clearance of postprandial lipoproteins and a slightly
lower enrichment of HDL with triglycerides in
4Freiburg homozygotes. The postprandial
changes of HDL composition (phospholipids, cholesterol)
were otherwise unremarkable.
|
Discussion |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
The molecular basis of the novel apoE isoform apoE4Freiburg is a thymidine-to-cytidine substitution at position 3100 of APOE4, which changes leucine to proline at position 28 of the polypeptide chain. ApoE4Freiburg differs from most other known apoE variants in that the amino acid replacement involves 2 neutral amino acids and therefore does not change the net charge of the isoprotein. Denaturing conditions present at isoelectric focusing allow the detection of a slightly more acidic net charge of the isoform, especially in apoE4/apoE4Freiburg heterozygotes (Figure 1A
). In this case, isoelectric focusing with subsequent
immunofixation leads to a doublet at the apoE4 position with the
additional band migrating to a position about a fifth net charge more
acidic than apoE4. The leucine-to-proline substitution in codon 28 is
not located within the receptor-binding region (residues 136 to 150),
the HSPG-binding sites (142 to 147), or the lipid-binding domain
in the carboxyl terminus (residues 244 to 272),35 46
and the predicted normal functions of these regions could be
demonstrated. In fact, normal receptor-binding function could be
demonstrated by comparing the binding properties of
apoE4Freiburg · DMPC complexes with those
of DMPC complexed with apoE3 or apoE4. Defective HSPG-binding is very
unlikely because of the phenotype of heterozygotes, which in
cases of defective HSPG-binding resembles autosomal dominant type III
hyperlipoproteinemia.3 A similar
binding to triglyceride-rich lipoproteins could be shown by
the similar accumulation of apoE4Freiburg and
apoE4 in VLDL and LDL (Figure 5). The predicted effect on the
apoE structure of the newly introduced proline is a disruption of the
first amphipathic helix because proline is known to be a helix breaker
and the affected residue is the fifth residue of the first amphipathic
helix.47
Screening of 3569 subjects for this isoform revealed that the
4Freiburg allele is the fourth most
frequent APOE allele in whites, at least in southwestern
Germany, when isoelectric focusing is used. In contrast to the
allele frequencies of other known apoE variants, which have been
identified in a few families only,44 48 the allelic
frequency of this isoform is fairly high among the population of
southwestern Germany (1:426 among control subjects and 1:137 among CAD
patients). The allelic frequency for the 4 allele was
slightly higher in patients than in control subjects. Preliminary
studies indicate that the variant also occurs in other parts of Germany
including Marburg (central Germany), Münster (northwestern
Germany), and Magdeburg (northeastern Germany). Despite its relatively
high allelic frequency, it may not have been detected earlier because
the small change in apparent pI is easily detected in
apoE4/E4Freiburg heterozygotes only with a
high-resolution isoelectric focusing method.27 Given
the allelic frequencies observed in control subjects in southwestern
Germany, this heterozygous combination occurs in less than 1 in 900
samples. ApoE4 variants with a slightly lower pI than apoE4 have been
described previously49 50 and might have been the first
descriptions of apoE4Freiburg.
The 3-fold increase in the allelic frequency of
4Freiburg in CAD patients suggests that this
isoform has atherogenic properties. To avoid selection bias, which
might occur if 4Freiburg patients were
more likely to survive a myocardial infarction or if the
4Freiburg allele were associated
with longevity,51 survivors of a myocardial
infarction and CAD patients who had not yet suffered a myocardial
infarction were included in the patient group. Adjustment for age and
sex did not change the higher allelic frequency among CAD patients.
Therefore, selection bias is not likely and the higher allelic
frequency in CAD patients may in fact reflect the atherogenic
properties of this isoform.
All 4 4Freiburg homozygotes identified
suffered from various forms of
hyperlipoproteinemia and 3 had different types
of hypertriglyceridemia. The
analysis of 60 heterozygotes did not link
4Freiburg with a specific
hyperlipoproteinemia phenotype. We
analyzed the effects of the common APOE alleles
and of 4Freiburg on the modulation of
serum lipids and apolipoproteins. Because
4Freiburg is probably derived from
4, special emphasis was placed on the comparisons of
apoE3/E4Freiburg with apoE3/E4 and of
apoE4/E4Freiburg with apoE4/E4 to identify
effects specific to apoE4Freiburg. Our study
confirmed the modulation of plasma lipoproteins and apolipoproteins by
the common APOE alleles observed in previous
studies.52 53 54 Specifically, the 2
allele decreased cholesterol and apoB and increased
triglycerides, and the 4 allele increased
cholesterol and apoB and decreased apoA-I. The
4 allele also increased triglycerides,
but because of the higher variability of triglyceride
concentrations,55 this effect did not reach
significance. These and other data52 53 indicate that the
effects of different APOE alleles on
triglycerides are opposite to the effects on HDL. Our
interpretation is that the effects of APOE on apoA-I
concentrations are secondary to the effects of modulating
triglyceride concentrations. The much higher
intraindividual variability of triglycerides (compared with
apoA-I),56 however, makes it more difficult to detect
these modulating effects on triglycerides.
The effects of 4Freiburg on the
concentration of fasting lipids and apolipoproteins were significantly
different from those of 4.
4Freiburg lowered
cholesterol (3/4Freiburg
versus 3/4), apoB
(4/4Freiburg versus
4/4), and apoA-I. The mechanism of the effect of
apoE4Freiburg on lipoproteins is unknown, but the
epidemiological data, together with data from the postprandial studies,
indicate a connection of 4Freiburg with
triglyceride-rich lipoproteins, apoA-I, and HDL
triglycerides. The effects of
apoE4Freiburg on cholesterol and apoB
concentrations can be explained by the known metabolic link
between high triglycerides and low LDL
cholesterol.57 To get some insight into
the molecular mechanism of apoE4Freiburg in
lipoprotein metabolism, we characterized the
receptor-mediated clearance of lipoproteins containing
apoE4Freiburg with 2 approaches.
First, the in vitro clearance by LDL receptors was analyzed by
receptor-binding studies of apoE4Freiburg and
other apoE isoforms complexed with small DMPC disks. These
receptor-binding studies revealed no binding defect of
apoE4Freiburg. This is consistent with
the observation that none of the
4Freiburg homozygotes presented
with type III hyperlipoproteinemia, which is
associated with LDL receptor-binding-defective isoforms of
apoE.7
Second, the in vivo clearance of postprandial lipoproteins from 3
4Freiburg homozygotes was unremarkable
and did not differ from the clearance of triglyceride-rich
lipoproteins in normolipemic control subjects28
despite higher fasting triglycerides in the
4Freiburg homozygotes. Surprisingly,
the postprandial accumulation of triglycerides in HDL was
even less pronounced than in the normolipemic control subjects. Higher
fasting and postprandial triglycerides have been shown to
increase triglycerides in HDL.28
A possible clue for the molecular mechanism comes from the studies of
the association of apoE4 and apoE4Freiburg with
different lipoproteins. Although the majority of each isoform
accumulated in triglyceride-rich lipoproteins (Figure 5), marked differences were observed in their accumulation in
HDL. Unequivocally less apoE4Freiburg than apoE4
was associated with HDL in the patients studied. These data do not
exclude a lower HDL preference of apoE4Freiburg
caused by certain lipid-binding characteristics.58
However, certain lipoprotein particles (Lp) in HDL containing apoE (ie,
triglyceride-rich LpE:A-I) may be removed more rapidly in
carriers of apoE4Freiburg than in carriers of the
common apoE isoforms. Rapid removal of
LpE4Freiburg:A-I also reduces apoA-I
concentrations. The rapid removal of
LpE4Freiburg:A-I might be partly responsible for
the lower apoA-I concentrations in carriers of
4Freiburg, the lower postprandial
triglyceride-enrichment of HDL in
4Freiburg homozygotes observed after a
fatty meal, and the higher allelic frequency of
4Freiburg in CAD patients. Because of
the low number of homozygotes available and the multifactorial
modulation of HDL concentrations, we cannot calculate the quantity of
HDL cholesterol and HDL triglycerides removed
after a fatty meal. However, the preferential uptake of
LpE4Freiburg:A-I might take place at all times
and not only after a fatty meal and might decrease HDL long-term. We
further speculate that these LpE4Freiburg:A-I
might interfere with the catabolism of triglyceride-rich
lipoproteins and subsequently decrease HDL. Elevated concentrations of
triglyceride-rich lipoproteins decrease HDL, presumably by
the activation of cholesteryl ester transfer protein–mediated lipid
transfer.45 High concentrations of
triglyceride-rich lipoproteins and low concentrations of
HDL promote CAD.55 56 In this context, it is intriguing to
see a 3-fold higher allelic frequency of
4Freiburg among CAD patients than among
control subjects. The receptor-binding studies with
apoE4Freiburg · DMPC cannot address the
effects of different apoE isoforms on the clearance of LpE:A-I. Because
of their high homogeneity and good reproducibility between different
preparations, these DMPC complexes have been successfully used for
numerous receptor-binding studies. In alternative methods (eg, use of
native lipoproteins obtained from different subjects), differences in
protein and lipid composition can confound the results. An alternative
hypothesis for the differences in the accumulation of
apoE4Freiburg in HDL is that the effects result
from differences in its lipoprotein preference, either directly by
stabilization of the long helices at the expense of short helices,
which might cause a low affinity for HDL,59 or
indirectly by its effects on the arginine-61 side
chain.58
In summary, apoE4Freiburg is a frequent apoE mutation and is significantly more common among CAD patients. The observed effects of this isoform on plasma lipids and apolipoproteins under fasting and postprandial conditions, the phenotype of homozygous and heterozygous carriers, receptor-binding studies, and the distribution of apoE4Freiburg among different lipoproteins imply that this isoform exerts its atherogenic properties by modulating the metabolism of triglyceride-rich lipoproteins and HDL.
|
Acknowledgments |
|---|
This study was supported in part by the Deutsche Forschungsgemeinschaft (Or 79 1–1) (M.O.), the Kempkes Stiftung Marburg (A.S.), and by NIH Program Project Grant HL 41633 (K.H.W., R.W.M.).The authors thank Kay S. Arnold, Isolde Friedrich, Eva Maria Gittel, and Yvonne M. Newhouse for their excellent technical assistance, Dr Stanley C. Rall for comments on the manuscript, and Stephen Ordway and Gary Howard for editorial assistance.
Received August 13, 1998; accepted October 12, 1998.
|
References |
|---|
|
TopAbstractIntroductionMethodsResultsDiscussionReferences |
|---|
1. Havel RJ, Kotite L, Vigne JL, Kane JP, Tun P, Phillips N, Chen GC. Radioimmunoassay of human arginine-rich apolipoprotein, apoprotein E: concentration in blood plasma and lipoproteins as affected by apoprotein E-3 deficiency. J Clin Invest. 1980;66:1351–1362.
2.
Mahley RW. Apolipoprotein E: cholesterol
transport protein with expanding role in cell biology.
Science. 1988;240:622–630.
3.
Ji ZS, Fazio S, Mahley RW. Variable heparan
sulfate proteoglycan binding of apolipoprotein E variants may modulate
the expression of type III
hyperlipoproteinemia. J Biol
Chem. 1994;269:13421–13428.
4. Rohlmann A, Gotthardt M, Hammer RE, Herz J. Inducible inactivation of hepatic LRP gene by Cre-mediated recombination confirms role of LRP in clearance of chylomicron remnants. J Clin Invest. 1998;101:689–695.[Medline] [Order article via Infotrieve]
5. Linton MF, Hasty AH, Babaev VR, Fazio S. Hepatic apo E expression is required for remnant lipoprotein clearance in the absence of the low density lipoprotein receptor. J Clin Invest. 1998;101:1726–1736.[Medline] [Order article via Infotrieve]
6.
Weisgraber KH, Innerarity TL, Mahley RW. Abnormal
lipoprotein receptor-binding activity of the human E apoprotein due to
cysteine-arginine interchange at a single site. J Biol
Chem. 1982;257:2518–2521.
7.
Rall SC Jr, Weisgraber KH, Innerarity TL, Mahley RW.
Structural basis for receptor binding heterogeneity of
apolipoprotein E from type III
hyperlipoproteinemic subjects. Proc Natl
Acad Sci U S A. 1982;79:4696–4700.
8.
Kowal RC, Herz J, Weisgraber KH, Mahley RW, Brown MS,
Goldstein JL. Opposing effects of apolipoproteins E and C on
lipoprotein binding to low density lipoprotein receptor-related
protein. J Biol Chem. 1990;265:10771–10779.
9.
Hixson JE. Apolipoprotein E polymorphisms affect
atherosclerosis in young males: Pathobiological
Determinants of Atherosclerosis in Youth (PDAY)
Research Group. Arterioscler Thromb. 1991;11:1237–1244.
10. Eichner JE, Kuller LH, Orchard TJ, Grandits GA, McCallum LM, Ferrell RE, Neaton JD. Relation of apolipoprotein E phenotype to myocardial infarction and mortality from coronary artery disease. Am J Cardiol. 1993;71:160–165.[Medline] [Order article via Infotrieve]
11. de Andrade M, Thandi I, Brown S, Gotto A, Jr, Patsch W, Boerwinkle E. Relationship of the apolipoprotein E polymorphism with carotid artery atherosclerosis. Am J Hum Genet. 1995;56:1379–1390.[Medline] [Order article via Infotrieve]
12.
Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE,
Gaskell PC, Small GW, Roses AD, Haines JL, Pericak-Vance MA. Gene dose
of apolipoprotein E type 4 allele and the risk of
Alzheimer's disease in late onset families.
Science. 1993;261:921–923.
13.
Farrer LA, Cupples LA, Haines JL, Hyman B, Kukull WA,
Mayeux R, Myers RH, Pericak-Vance MA, Risch N, van Duijn CM. Effects of
age, sex, and ethnicity on the association between apolipoprotein E
genotype and Alzheimer disease: a
meta-analysis: APOE and Alzheimer Disease Meta
Analysis Consortium. JAMA. 1997;278:1349–1356.
14.
Rall SC Jr, Weisgraber KH, Innerarity TL, Bersot TP,
Mahley RW, Blum CB. Identification of a new structural variant of human
apolipoprotein E, E2(Lys146Gln), in a type III
hyperlipoproteinemic subject with the E3/2
phenotype. J Clin Invest. 1983;72:1288–1297.
15. Weisgraber KH, Rall SC Jr, Innerarity TL, Mahley RW, Kuusi T, Ehnholm C. A novel electrophoretic variant of human apolipoprotein E: identification and characterization of apolipoprotein E1. J Clin Invest. 1984;73:1024–1033.
16.
Wardell MR, Brennan SO, Janus ED, Fraser R, Carrell RW.
Apolipoprotein E2-Christchurch (136 ArgSer): new variant of human
apolipoprotein E in a patient with type III
hyperlipoproteinemia. J Clin
Invest. 1987;80:483–490.
17.
Lalazar A, Weisgraber KH, Rall SC Jr, Giladi H,
Innerarity TL, Levanon AZ, Boyles JK, Amit B, Gorecki M, Mahley RW,
Vogel T. Site-specific mutagenesis of human apolipoprotein E: receptor
binding activity of variants with single amino acid substitutions.
J Biol Chem. 1988;263:3542–3545.
18. Mann WA, Gregg RE, Sprecher DL, Brewer HB Jr. Apolipoprotein E-1Harrisburg: a new variant of apolipoprotein E dominantly associated with type III hyperlipoproteinemia. Biochim Biophys Acta. 1989;1005:239–244.[Medline] [Order article via Infotrieve]
19. Rall SC Jr, Newhouse YM, Clarke HR, Weisgraber KH, McCarthy BJ, Mahley RW, Bersot TP. Type III hyperlipoproteinemia associated with apolipoprotein E phenotype E3/3: structure and genetics of an apolipoprotein E3 variant. J Clin Invest. 1989;83:1095–1101.
20. Mailly F, Xu CF, Xhignesse M, Lussier-Cacan S, Talmud PJ, Davignon J, Humphries SE, Nestruck AC. Characterization of a new apolipoprotein E5 variant detected in two French-Canadian subjects. J Lipid Res. 1991;32:613–620.[Abstract]
21.
Feussner G, Funke H, Weng W, Assmann G, Lackner
KJ, Ziegler R. Severe type III
hyperlipoproteinemia associated with unusual
apolipoprotein E1 phenotype and 1/`null'
genotype. Eur J Clin Invest. 1992;22:599–608.[Medline]
[Order article via Infotrieve]
22. Wenham PR, McDowell IF, Hodges VM, McEneny J, MJ OK, Davies RJ, Nicholls DP, Trimble ER, Blundell G. Rare apolipoprotein E variant identified in a patient with type III hyperlipidaemia. Atherosclerosis. 1993;99:261–271.[Medline] [Order article via Infotrieve]
23. Havekes L, de Wit E, Leuven JG, Klasen E, Utermann G, Weber W, Beisiegel U. Apolipoprotein E3-Leiden: a new variant of human apolipoprotein E associated with familial type III hyperlipoproteinemia. Hum Genet. 1986;73:157–163.[Medline] [Order article via Infotrieve]
24.
Wardell MR, Weisgraber KH, Havekes LM, Rall SC Jr.
Apolipoprotein E3-Leiden contains a seven-amino acid insertion that is
a tandem repeat of residues 121–127. J Biol Chem. 1989;264:21205–21210.
25. Dong LM, Yamamura T, Yamamoto A. Enhanced binding activity of an apolipoprotein E mutant, APO E5, to LDL receptors on human fibroblasts. Biochem Biophys Res Commun. 1990;168:409–414.[Medline] [Order article via Infotrieve]
26. Wardell MR, Rall SC Jr, Schaefer EJ, Kane JP, Weisgraber KH. Two apolipoprotein E5 variants illustrate the importance of the position of additional positive charge on receptor-binding activity. J Lipid Res. 1991;32:521–528.[Abstract]
27.
Luley C, Haas B, Bührer B, Wieland H. Improvement
of apolipoprotein E phenotyping by isoelectric focusing/immunofixation.
Clin Chem. 1992;38:168.
28. Orth M, Wahl S, Hanisch M, Friedrich I, Wieland H, Luley C. Clearance of postprandial lipoproteins in normolipemics: role of the apolipoprotein E phenotype. Biochim Biophys Acta. 1996;1303:22–30.[Medline] [Order article via Infotrieve]
29. Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning. A Laboratory Manual. Plainview, NY: Cold Spring Harbor Press; 1989.
30. Luley C. Entwicklung eines Verfahrens zur routinemäßigen Messung potentiell atherogener Lipoproteine in der Postprandialphase. Albert-Ludwigs Universität, Freiburg i. Br, 1992.
31.
Karpe F, Bard JM, Steiner G, Carlson LA, Fruchart JC,
Hamsten A. HDLs and alimentary lipemia: studies in men with previous
myocardial infarction at a young age. Arterioscler Thromb. 1993;13:11–22.
32.
Cabezas MC, de Bruin TW, Jansen H, Kock LA, Kortlandt
W, Erkelens DW. Impaired chylomicron remnant clearance in familial
combined hyperlipidemia. Arterioscler
Thromb. 1993;13:804–814.
33. Luley C, Baumstark MW, Wieland H. Rapid apolipoprotein E phenotyping by immunofixation in agarose. J Lipid Res. 1991;32:880–883.[Abstract]
34.
Gyllensten UB, Erlich HA. Generation of single-stranded
DNA by the polymerase chain reaction and its application to direct
sequencing of the HLA-DQA locus. Proc Natl Acad Sci U S A. 1988;85:7652–7656.
35. Rall SC Jr, Weisgraber KH, Mahley RW. Isolation and characterization of apolipoprotein E. Methods Enzymol. 1986;128:273–287.[Medline] [Order article via Infotrieve]
36.
Innerarity TL, Mahley RW, Weisgraber KH, Bersot TP.
Apoprotein (E–A-II) complex of human plasma lipoproteins, II: receptor
binding activity of a high density lipoprotein subfraction modulated by
the apo(E–A-II) complex. J Biol Chem. 1978;253:6289–6295.
37. Bilheimer DW, Eisenberg S, Levy RI. The metabolism of very low density lipoprotein proteins, I: preliminary in vitro and in vivo observations. Biochim Biophys Acta. 1972;260:212–221.[Medline] [Order article via Infotrieve]
38.
Innerarity TL, Pitas RE, Mahley RW. Binding of
arginine-rich (E) apoprotein after recombination with phospholipid
vesicles to the low density lipoprotein receptors of fibroblasts.
J Biol Chem. 1979;254:4186–4190.
39. Weisgraber KH. Apolipoprotein E distribution among human plasma lipoproteins: role of the cysteine-arginine interchange at residue 112. J Lipid Res. 1990;31:1503–1511.[Abstract]
40. Mackie A, Caslake MJ, Packard CJ, Shepherd J. Concentration and distribution of human plasma apolipoprotein E. Clin Chim Acta. 1981;116:35–45.[Medline] [Order article via Infotrieve]
41.
Schwarz S, Haas B, Luley C, Schäfer JR, Steinmetz
A. Quantification of apolipoprotein A-IV in human plasma by
immunonephelometry. Clin Chem. 1994;40:1717–1721.
42.
Orth M, Hanisch M, Kröning G,
Porsch-Özcürümez M, Wieland H, Luley C. Fluorometric
determination of retinyl esters in triglyceride-rich
lipoproteins. Clin Chem. 1998;44:1459–1465.
43.
Steinmetz A, Jakobs C, Motzny S, Kaffarnik H.
Differential distribution of apolipoprotein E isoforms in human plasma
lipoproteins. Arteriosclerosis. 1989;9:405–411.
44. Rall S Jr, Mahley RW. The role of apolipoprotein E genetic variants in lipoprotein disorders. J Intern Med. 1992;231:653–659.[Medline] [Order article via Infotrieve]
45. Mann CJ, Yen FT, Grant AM, Bihain BE. Mechanism of plasma cholesteryl ester transfer in hypertriglyceridemia. J Clin Invest. 1991;88:2059–2066.
46.
Weisgraber KH, Rall SC Jr, Mahley RW, Milne RW, Marcel
YL, Sparrow JT. Human apolipoprotein E: determination of the heparin
binding sites of apolipoprotein E3. J Biol Chem. 1986;261:2068–2076.
47.
Wilson C, Wardell MR, Weisgraber KH, Mahley RW, Agard
DA. Three-dimensional structure of the LDL receptor-binding domain of
human apolipoprotein E. Science. 1991;252:1817–1822.
48.
Pocovi M, Cenarro A, Civeira F, Myers RH, Casao E,
Esteban M, Ordovas JM. Incomplete dominance of type III
hyperlipoproteinemia is associated with the
rare apolipoprotein E2 (Arg136Ser) variant in multigenerational
pedigree studies. Atherosclerosis. 1996;122:33–46.[Medline]
[Order article via Infotrieve]
49. Utermann G. Apolipoprotein E polymorphism in health and disease. Am Heart J. 1987;113:433–440.[Medline] [Order article via Infotrieve]
50. Steinmetz A. Clinical implications of the apolipoprotein E polymorphism and genetic variants: current methods for apo E phenotyping. Ann Biol Clin (Paris). 1991;49:1–8.[Medline] [Order article via Infotrieve]
51. Kervinen K, Savolainen MJ, Salokannel J, Hynninen A, Heikkinen J, Ehnholm C, Koistinen MJ, Kesäniemi YA. Apolipoprotein E, and B polymorphisms: longevity factors assessed in nonagenarians. Atherosclerosis. 1994;105:89–95.[Medline] [Order article via Infotrieve]
52.
Kataoka S, Robbins DC, Cowan LD, Go O, Yeh JL, Devereux
RB, Fabsitz RR, Lee ET, Welty TK, Howard BV. Apolipoprotein E
polymorphism in American Indians and its relation to plasma
lipoproteins and diabetes: the Strong Heart Study. Arterioscler
Thromb Vasc Biol. 1996;16:918–925.
53. Braeckman L, De BD, Rosseneu M, De Backer G. Apolipoprotein E polymorphism in middle-aged Belgian men: phenotype distribution and relation to serum lipids and lipoproteins. Atherosclerosis. 1996;120:67–73.[Medline] [Order article via Infotrieve]
54. Boerwinkle E, Visvikis S, Welsh D, Steinmetz J, Hanash SM, Sing CF. The use of measured genotype information in the analysis of quantitative phenotypes in man, II: the role of the apolipoprotein E polymorphism in determining levels, variability, and covariability of cholesterol, betalipoprotein, and triglycerides in a sample of unrelated individuals. Am J Med Genet. 1987;27:567–582.[Medline] [Order article via Infotrieve]
55.
Austin MA. Plasma triglyceride and
coronary heart disease. Arterioscler Thromb. 1991;11:2–14.
56.
Jeppesen J, Hein HO, Suadicani P, Gyntelberg F.
Triglyceride concentration and ischemic heart
disease: an eight-year follow-up in the Copenhagen Male Study.
Circulation. 1998;97:1029–1036.
57.
Grundy SM, Vega GL. Two different views of the
relationship of hypertriglyceridemia to
coronary heart disease: implications for treatment. Arch
Intern Med. 1992;152:28–34.
58.
Dong LM, Wilson C, Wardell MR, Simmons T, Mahley RW,
Weisgraber KH, Agard DA. Human apolipoprotein E: role of arginine 61 in
mediating the lipoprotein preferences of the E3 and E4 isoforms.
J Biol Chem. 1994;269:22358–22365.
59. Segrest JP, Jones MK, De Loof H, Brouillette CG, Venkatachalapathi YV, Anantharamaiah GM. The amphipathic helix in the exchangeable apolipoproteins: a review of secondary structure and function. J Lipid Res. 1992;33:141–166.[Abstract]
This article has been cited by other articles:
 |
|
 |
|
  A. M. Bennet, E. Di Angelantonio, Z. Ye, F. Wensley, A. Dahlin, A. Ahlbom, B. Keavney, R. Collins, B. Wiman, U. de Faire, et al. Association of Apolipoprotein E Genotypes With Lipid Levels and Coronary Risk JAMA, September 19, 2007; 298(11): 1300 - 1311. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Song, M. J. Stampfer, and S. Liu Meta-Analysis: Apolipoprotein E Genotypes and Risk for Coronary Heart Disease Ann Intern Med, July 20, 2004; 141(2): 137 - 147. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. H. McDermott, J. P.J. Halcox, W. H. Schenke, M. A. Waclawiw, M. N. Merrell, N. Epstein, A. A. Quyyumi, and P. M. Murphy Association Between Polymorphism in the Chemokine Receptor CX3CR1 and Coronary Vascular Endothelial Dysfunction and Atherosclerosis Circ. Res., August 31, 2001; 89(5): 401 - 407. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||